Literature DB >> 29621294

The redox-sensing protein Rex modulates ethanol production in Thermoanaerobacterium saccharolyticum.

Tianyong Zheng1,2, Anthony A Lanahan2,3,4, Lee R Lynd1,2,3,4, Daniel G Olson2,3,4.   

Abstract

Thermoanaerobacterium saccharolyticum is a thermophilic anaerobe that has been engineered to produce high amounts of ethanol, reaching ~90% theoretical yield at a titer of 70 g/L. Here we report the physiological changes that occur upon deleting the redox-sensing transcriptional regulator Rex in wild type T. saccharolyticum: a single deletion of rex resulted in a two-fold increase in ethanol yield (from 40% to 91% theoretical yield), but the resulting strains grew only about a third as fast as the wild type strain. Deletion of the rex gene also had the effect of increasing expression of alcohol dehydrogenase genes, adhE and adhA. After several serial transfers, the ethanol yield decreased from an average of 91% to 55%, and the growth rates had increased. We performed whole-genome resequencing to identify secondary mutations in the Δrex strains adapted for faster growth. In several cases, secondary mutations had appeared in the adhE gene. Furthermore, in these strains the NADH-linked alcohol dehydrogenase activity was greatly reduced. Complementation studies were done to reintroduce rex into the Δrex strains: reintroducing rex decreased ethanol yield to below wild type levels in the Δrex strain without adhE mutations, but did not change the ethanol yield in the Δrex strain where an adhE mutation occurred.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29621294      PMCID: PMC5886521          DOI: 10.1371/journal.pone.0195143

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Thermoanaerobacterium saccharolyticum is a thermophilic anaerobe that naturally produces ethanol. Wild type T. saccharolyticum produces ethanol at about 46% of the theoretical maximum yield [1], it also generates other fermentation products such as lactate and acetate. T. saccharolyticum has been engineered to produce ethanol at ~90% theoretical maximum yield and a titer of 70 g/L [2,3]; in these engineered strains the lactate and acetate production pathways have been deleted. While T. saccharolyticum is able to consume many of the sugars present in the hemicellulose fraction of lignocellulose, it is unable to consume cellulose. The organism has been studied both for its high levels of ethanol production and as a co-culture partner for a cellulolytic organism (e.g. Clostridium thermocellum) [4]. Numerous studies have focused on the roles of enzymes in T. saccharolyticum, including secreted hydrolases involved in the degradation of hemicellulose [5], the bifunctional alcohol dehydrogenase AdhE [6], and alcohol dehydrogenase AdhA [1]. Additionally, fermentation end-product analyses [7] and genome-scale microarray data [8] have been reported. In addition to studying the central metabolic pathways in T. saccharolyticum, we are also interested in the regulation of genes involved in the ethanol production pathway. Rex is a global transcription factor that has been studied in many facultative [9-12] and strict [13-19] anaerobes. It senses intracellular NADH/NAD+ levels and controls the expression of many genes involved in energy metabolism and anaerobic fermentation. In its homodimer form, Rex represses gene expression by binding to both the promoter region of a DNA strand (N-terminus) and an NAD+ molecule (C-terminus) thus inhibiting transcription of the target gene. When the molecule of NAD+ bound to its C-terminus is replaced by NADH, conformational changes trigger the release of the Rex dimer from the DNA thereby allowing transcription to proceed [20]. The Rex protein is important in regulating metabolism: when NADH/NAD+ ratios are high in the cell, it signals that energy-generating catabolic processes (such as glycolysis) are proceeding at a sufficient rate. Therefore by releasing adhE repression under high concentrations of NADH, AdhE can convert NADH to NAD+ and replenish the NAD+ pool. We have recently identified key alcohol dehydrogenase genes in the T. saccharolyticum ethanol production pathway: adhE and adhA are both necessary for high levels of ethanol production in T. saccharolyticum [1]. In vitro assays have shown that Rex regulates adhE expression in Staphylococcus aureus [10], Streptococcus mutans [11,21], Enterococcus faecalis [12], Thermoanaerobacter ethanolicus [13], Clostridium acetobutylicum [14,15], and Thermotoga sp. RQ-2 [16]. Moreover, Rex has previously been inactivated in S. aureus [10], E. faecalis [12], C. acetobutylicum [14,15], Desulfovibrio vulgaris [17], and S. mutans [21]. In C. acetobutylicum and S. aureus, ethanol yield increased in the Rex-inactivated strains [10,14,15]. These results suggest that inactivating Rex could serve as an engineering strategy to increase desired fermentation products such as ethanol. Therefore one aim of this study was to examine the role of Rex in T. saccharolyticum ethanol production. Another aim was to explore the potential of deleting rex as an engineering strategy for higher ethanol yield in bacterial organisms. Specifically, we were interested in whether deleting rex would create a high-ethanol phenotype that is stable across numerous generations. A final aim was to identify putative Rex-binding sites in T. saccharolyticum, to better understand which genes it regulates.

Materials and methods

Plasmid and strain construction

Strains and cloning plasmids used in this study are listed in Table 1. The rex deletion was made with pTZvec13 using previously-described techniques for genetic modification [1,22]. Briefly, pTZvec13 consists of a kanamycin marker flanked by the upstream and downstream regions of the rex gene. Sequence information of pTZvec13 can be found in Genbank accession number KY863518. T. saccharolyticum cells and the pTZvec13 vector were inoculated into a rich growth medium (CTFUD) [23] and incubated at 55 °C to allow transformation (note that T. saccharolyticum is naturally competent [22]). Cells were harvested at OD600 ~0.6 and plated on CTFUD agar with 200 μg/ml kanamycin. Colonies were picked following a two-day incubation period at 55 °C and subsequently analyzed by PCR and gel electrophoresis. Kanamycin was only used in the medium during the initial strain isolation process to select for the chromosomal gene deletion. Deletion of rex was confirmed by PCR and whole-genome sequencing.
Table 1

Strains used in this study.

Strain nameDescriptionCloning plasmidsSource or reference
LL1025Wild-type T. saccharolyticum strain JW/SL-YS485/Mai et al. [24] Genbank No. CP003184
LL1414Wild-type T. saccharolyticum Δrex::kan strain, a.k.a. Rex2pTZvec13This study. Genbank No. KY863518
LL1415Wild-type T. saccharolyticum Δrex::kan strain, a.k.a. Rex4pTZvec13This study. Genbank No. KY863518
LL1416Wild-type T. saccharolyticum Δrex::kan strain, a.k.a. Rex5pTZvec13This study. Genbank No. KY863518
LL1417Wild-type T. saccharolyticum Δrex::kan strain, a.k.a. Rex8pTZvec13This study. Genbank No. KY863518
LL1356Rex2 after serial transfers, a.k.a. RexAdp-2/This study. SRA No. SRP112528
LL1357Rex4 after serial transfers, a.k.a RexAdp-4/This study. SRA No. SRP112529
LL1358Rex5 after serial transfers, a.k.a RexAdp-5/This study. SRA No. SRP112523
LL1359Rex8 after serial transfers, a.k.a RexAdp-8/This study. SRA No. SRP11252
LL1553LL1357 rex complementation strain, a.k.a RexCmp-4pTZvec14This study. Genbank No. MG020537
LL1554LL1358 rex complementation strain, a.k.a RexCmp-5pTZvec14This study. Genbank No. MG020537
The rex gene deletion was complemented using the plasmid pTZvec14 (Genbank accession number MG020537), which consists of the rex gene and an erythromycin marker, flanked by upstream and downstream regions of the rex deletion region. The transformation protocol of pTZvec14 is identical to that of pTZvec13 as described above, followed by incubation at 50 °C with 15 μg/ml erythromycin selection. Resulting complementation strains are referred to as RexCmp-4 and RexCmp-5 (Table 1). Sanger sequencing of the reconstituted rex region in strains RexCmp-4 and RexCmp-5 confirmed successful complementation of the gene.

Media and growth conditions

T. saccharolyticum strains were grown in CTFUD rich medium for transformations and enzymatic assays as previously described [6]. Following transformation, rex deletion colonies #2,4,5 and 8 were picked and inoculated into CTFUD rich medium, resulting in strains Rex-2, Rex-4, Rex-5 and Rex-8 (a.k.a LL1414-1417 in Table 1). These strains were then subjected to 3~7 rounds of serial transfers (1% v/v inoculum) on a chemically defined medium MTC-6 [25]. Specifically, strain Rex-2 underwent 6 rounds of serial transfers (~40 generations) and became strain RexAdp-2 (a.k.a. LL1356); Rex-4 and Rex-5 underwent 3 rounds of serial transfers (~20 generations) and became strains RexAdp-4 and RexAdp-5 (a.k.a. LL1357 and LL1358 respectively); Rex-8 underwent 7 rounds of serial transfers (~46 generations) and became strain RexAdp-8 (a.k.a. LL1359). To promote cell growth for use in fermentation end product analysis, RT-qPCR, and growth-rate analysis, T. saccharolyticum strains were grown in MTC-6 medium with the addition of 0.5 g/L yeast extract (a.k.a “modified MTC-6 media”).

Fermentation end product analysis and enzymatic assays

For fermentation end product analysis, strains were inoculated into 5 ml modified MTC-6 media (5 g/L cellobiose) at 1% v/v inoculum. Cultures were grown in CorningTM FalconTM 15 ml Conical Centrifuge Tubes and incubated anaerobically without shaking at 55 °C for 72 hours. Each fermentation experiment was performed in biological duplicates. Upon harvesting, cultures were prepared as previously described for HPLC (High Pressure Liquid Chromatography) analysis [1]. Fermentation end products are presented in S1 Table. For enzymatic assays, cell extracts were generated and assays were performed as previously described [1]. Briefly, ADH reactions were performed anaerobically at pH 7.0, 55°C, in a reaction mixture containing 0.2 mM NADH or NADPH, 20 mM acetaldehyde, 100 mM Tris-HCl, 5 μM FeSO4 and different concentrations of cell extract. The final volume was 1000 μl, and the reaction was initiated by addition of acetaldehyde. ADH activity was measured in the ethanol-forming direction; one unit of activity (U) is described as the formation of 1 μmol of product per minute. Specific activities are expressed as U/mg of protein. Protein concentrations of cell extracts were measured using the PierceTM Bradford Assay Kit (part number 3200) with bovine serum albumin as the standard.

Growth rate analysis

Sterile 96-well flat-bottom plates were used to culture strains for growth rate analysis. Each well was filled with 200 μL modified MTC-6 medium and inoculated with actively growing cultures to a starting OD600 of ~0.05. The plate was sealed with a transparent sealing film and placed into a BioTek PowerWave XS plate reader inside an anaerobic chamber. The plate was shaken for 30 seconds every 3 minutes, followed by an OD600 measurement. The incubation temperature of the plate reader was 55°C and cultures were grown for three days. OD600 values at each time point were exported to GraphPad Prism 7.0a, where growth curves were generated and growth rates were calculated.

Gene expression analysis

RT-qPCR was performed to measure gene expression. Cells were grown at 55°C to mid-log phase—OD600 ~ 0.5 for faster growing strains (wild type, LL1356-1359), and OD600 ~ 0.2 for slower growing strains (LL1414-1417). Harvested cultures were stored at -20°C after addition of RNAprotect (Qiagen). Genomic RNA was prepared using the RNeasy Mini Kit (Qiagen part number 74104), and subsequent cDNA was synthesized using the iScript cDNA Synthesis Kit (BioRad part number 170–8891). To assure adequate removal of the genomic RNA, control reactions were performed where reverse transcriptase was not added. RT-qPCR was performed using the SsoFast™ EvaGreen® Supermix (BioRad part number 172–5201). For quantification, a gBlock template that includes the adhE, adhA and recA amplicons sequences in a 1:1:1 ratio was diluted to known concentrations to generate a standard curve. Primers used for qPCR are presented in S2 Table. Standard molecular techniques were used to perform the RT-qPCR reaction; biological duplicates and technical triplicates were performed for each reaction.

Whole genome sequencing

Strains LL1356-1359 were grown on CTFUD rich medium (note that CTFUD medium gives better yields of genomic DNA yield, compared with MTC-6). The genomic DNA was submitted to the Joint Genome Institute (JGI) where Illumina MiSeq sequencing was performed as previously described [25], generating paired-end reads with an average read length of 150 bp and paired distance of 500 bp. Raw data was analyzed using CLC Genomics Workbench, version 8 (Qiagen, USA). First reads were mapped to the reference genome (NC_017992). Mapping was improved by 2 rounds of local realignment. The CLC Probabilistic Variant Detection algorithm was used to determine small mutations (single and multiple nucleotide polymorphisms, short insertions and short deletions). Variants that were identical to those of the wild type strain (i.e. due to errors in the reference sequence) were filtered out. To determine larger mutations, the CLC InDel and Structural Variant algorithm was run. This tool analyzes unaligned ends of reads and annotates regions where a structural variation may have occurred, which are called breakpoints. Since the read length averaged 150 bp and the minimum mapping fraction was 0.5, a breakpoint can have up to 75 bp of sequence data. The resulting breakpoints were filtered to eliminate those with fewer than 10 reads or less than 20% “not perfectly matched.” The breakpoint sequence was searched with the Basic Local Alignment Search Tool (BLAST) algorithm [26] for similarity to known sequences. Pairs of matching left and right breakpoints were considered evidence for structural variations such as transposon insertions and gene deletions.

Prediction of Rex-regulated genes

The Rex binding motif was searched for in the T. saccharolyticum genome using the web-based tool PATLOC (http://www.cmbl.uga.edu/software/patloc.html) [27]. A palindromic sequence consisting of 5 AT rich nucleotides separated by 8 AT-rich nucleotides was used to search for the Rex-binding motif, syntax codes WTGWW{WWWWWWWW}[1]-5-4-3-2-1, WTGWW{WWWWWWWW}[1]-5-4-3-N-1 and WTGWW{WWWWWWWW}[1]-5-4-3-2-N were used as the search criteria. This search criteria yielded palindromic sequences allowing at most one mismatch between the 5 bp AT-rich sequence and its reverse complementary sequence occurring within the last two nucleotides (5-4-3-N-1 and 5-4-3-2-N). The search criteria also allowed at most one C/G nucleotide in the 8 bp AT-rich span. Both strands of DNA in the genome were included in the search. Putative binding sites that were more than 200 bp upstream of the nearest gene or where the function of the nearest gene was not annotated were excluded from subsequent analysis.

Results

Deleting rex increased ethanol yield but decreased growth rate

In wild type T. saccharolyticum, the Tsac_2615 gene encodes a protein with 87% amino acid sequence identity to the T. ethanolicus Rex protein. We deleted the T. saccharolyticum rex gene (Tsac_2615) by replacing it with the kanamycin resistance gene kan (see Material and methods), resulting in strains Rex-2, Rex-4, Rex-5 and Rex-8 (each representing a single colony). These strains produced ethanol at an average of 91% theoretical maximum yield, which was more than a two-fold increase compared to wild type (40%) (Fig 1). However, growth rates significantly decreased in these Δrex strains and each Δrex strain had a μMAX that was less than a third of that in wild type (Table 2).
Fig 1

Ethanol yields of Δrex strains before and after serial transfers.

Wt is shown in grey, Δrex strains before adaptation are shown in blue, Δrex strains after adaptations in red, and rex complementation strains in green. Cultures were grown on 5 g/L cellobiose in modified MTC-6 media (see Material and methods), and theoretical ethanol yield from cellobiose is 0.54 g ethanol per gram cellobiose. Ethanol yields are calculated based on the amount of substrate consumed (initial and final concentrations of cellobiose were measured). Ethanol yield is presented in percent theoretical maximum, which assumes that one molecule of glucose (or glucose equivalent) can be converted into, at most, two molecules of ethanol.

Table 2

Growth rate and Max OD600 of Δrex strains.

StrainGrowth rate μMAXMax OD600
wild type0.31 ± 0.010.43 ± 0.02
Rex20.10 ± 0.010.44 ± 0.02
Rex2-Adp0.38 ± 0.020.76 ± 0.01
Rex40.09 ± 0.010.29 ± 0.01
Rex4-Adp0.29 ± 0.010.68 ± 0.01
Rex50.06 ± 0.070.20 ± 0.02
Rex5-Adp0.16 ± 0.010.61 ± 0.02
Rex80.06 ± 0.010.29 ± 0.03
Rex8-Adp0.12 ± 0.010.24 ± 0.01

Ethanol yields of Δrex strains before and after serial transfers.

Wt is shown in grey, Δrex strains before adaptation are shown in blue, Δrex strains after adaptations in red, and rex complementation strains in green. Cultures were grown on 5 g/L cellobiose in modified MTC-6 media (see Material and methods), and theoretical ethanol yield from cellobiose is 0.54 g ethanol per gram cellobiose. Ethanol yields are calculated based on the amount of substrate consumed (initial and final concentrations of cellobiose were measured). Ethanol yield is presented in percent theoretical maximum, which assumes that one molecule of glucose (or glucose equivalent) can be converted into, at most, two molecules of ethanol.

Adaptation increased growth rate but decreased ethanol yield in Δrex strains

To investigate the stability of the high ethanol phenotype in the Δrex strains, we conducted serial transfers for strains Rex-2, 4, 5 and 8 (see Material and methods). After at least 20 generations, the adapted strains (RexAdp-2, RexAdp-4, RexAdp-5, and RexAdp-8) all grew faster than their parent strains, displaying a two to three-fold increase in growth rate (Table 2, μMAX). Three out of four adapted strains (RexAdp-2, 4, 5) had higher maximal OD600 levels than their parent strains (Table 2). Interestingly, this increase in growth rate was accompanied by a 29%-50% decrease in ethanol yield comparing to non-adapted Δrex strains (Fig 1).

Secondary mutations in adapted Δrex strains

Adapted strains RexAdp-2, RexAdp-4, RexAdp-5, and RexAdp-8 were submitted for whole-genome sequencing to analyze secondary mutations associated with the rex deletion. Mutations in the DNA sequence that caused alterations in amino acid sequences or promoter regions were found at 27 locations across the genome, as listed in Table 3. Most mutations occurred in transcription and biosynthesis related genes, as well as genes encoding membrane-associated proteins. Most of these mutations only occurred in one of the four adapted strains, but mutations in adhE (Tsac_0416), trx (Tsac_0492), Auxin efflux carrier (Tsac_2140), and rpoN (Tsac_2488) appeared frequently, appearing in at least three out of four adapted strains. In particular, adhE accumulated three different mutations, as well as a mutation in its promoter region (Table 3).
Table 3

Secondary mutations in adapted Δrex strains.

Locus/ locationGeneProtein product of locus gene or downstream geneCategoryStart siteTypeaMutation description bFraction of reads supporting mutationc
RexAdp-2RexAdp-4RexAdp-5RexAdp-8
Tsac_0038UbiC transcription regulator-associatedTrans d37942SNVG → A, Leu49Phe48%0%0%0%
Tsac_0138araCTwo component transcriptional regulatorTrans143079INST. saccharolyticum mega plasmid CP0031850%0%95%0%
Tsac_0377ACT domain-containing proteinSyn408737SNVC → A, Gly67Trp99%0%0%0%
Tsac_0393CRISPR-associated proteinMisc430181SNVC → A, Glu454*0%0%99%0%
184 bp upstream of Tsac_0416adhEAdhE, Alcohol dehydrogenase, iron-typeCarb447044INS- → AT0%38%0%20%
Tsac_0416449017SNVC → A, Thr597Lys57%0%0%0%
SNVC → T, Thr597Ile30%0%0%0%
449041SNVC → T, Thr605Ile10%0%76%0%
Tsac_0492trxPyridine nucleotide-disulphide oxidoreductaseMisc517443SNVT → C, Lys27Arg100%100%0%100%
Tsac_0542Cobyrinic acid a,c-diamide synthaseSyn566929SNVG → T0%0%0%100%
Tsac_0947Putative transcriptional activator, Baf familyTrans992952SNVT → C0%0%100%0%
Tsac_1176Histidinol dehydrogenaseSyn1219174SNVC → T, Pro369Ser0%0%100%0%
Tsac_1265Selenoprotein BSyn1315478SNVT → C0%0%67%0%
Tsac_1588phoUPhoUMem1667093SNVC → T, Gln71*0%0%84%0%
Tsac_1705Dihydroorotate dehydrogenaseSyn1775863INST. saccharolyticum mega plasmid CP0031850%0%90%0%
Tsac_1961sigKRNA polymerase, sigma 28 subunitTrans2009358INST. saccharolyticum phage THSA-485A, CP0031860%0%81%0%
46 bp upstream of Tsac_2008PeroxiredoxinMisc2054419SNVC → T0%0%100%0%
32 bp upstream of Tsac_2140Auxin efflux carrier family proteinMem2178994DELATA → -100%100%0%100%
Tsac_21402179432SNVC → T, Ser135Leu0%0%100%0%
Tsac_2480Uncharacterized protein family UPF0251Misc2530745INSPossible transposon downstream of Tsac_18300%57%0%0%
Tsac_2488rpoNRNA polymerase, sigma 54 subunitTrans2538897SNVC → A, Glu395*0%0%82%0%
SNVC →A, Glu395Gln20%
2539210DELT → -, Lys290fs0%0%0%99%
2539210INS- → TTTTTGTATTGTCTTTGACAAGTA, Lys289_Lys290insAsnThrCysGlnArgGlnTyrLys97%0%0%0%
Tsac_2564phosphotransferase system PTS lactose/cellobiose-specific IIA subunitMem2618525SNVC → T, Ala80Thr0%0%100%0%
Tsac_2602Extracellular ligand-binding receptorMem2652896INS- → AAT, Asn85_Lys86insAsn0%87%0%0%
Tsac_2615rexRedox-sensing transcriptional repressorTrans2663911Targeted insertionrex gene replaced with kan100%100%100%100%

a SNV: single nucleotide variation; INS: insertion; DEL: deletion

b * annotates a stop codon,—annotates a deletion

c percentage of sequencing reads that contain mutation. Variants that were identical to those of the wild type strain were filtered out.

d Trans: transcription; Syn: biosynthesis; Misc: miscellaneous; Carb: carbon metabolism; Mem: membrane-associated

a SNV: single nucleotide variation; INS: insertion; DEL: deletion b * annotates a stop codon,—annotates a deletion c percentage of sequencing reads that contain mutation. Variants that were identical to those of the wild type strain were filtered out. d Trans: transcription; Syn: biosynthesis; Misc: miscellaneous; Carb: carbon metabolism; Mem: membrane-associated

adhE and adhA expression levels increased in Δrex strains

Gene expression levels of adhE and adhA were measured via RT-qPCR and results are presented in Fig 2. When rex was deleted in wild type T. saccharolyticum, the resulting strains Rex-2, 4, 5, 8 showed a ten to twelve-fold increase in adhE expression and two to six-fold increase in adhA expression (Fig 2). However, after adaptation, the resulting strains RexAdp-2, 4, 5, 8 showed significant decreases in adhE expression comparing to non-adapted Δrex strains (Rex-2, 4, 5, 8). Nevertheless, adhE expression in the adapted strains was still higher than wild type levels (Fig 2, panel A). adhA expression levels in the adapted strains were similar or slightly higher than those in non-adapted Δrex strains (Fig 2, panel B).
Fig 2

Gene expression levels of adhE and adhA.

Panel A shows adhE expression levels and panel B shows adhA expression levels. Strains were grown at 55°C to mid-log phase—OD600 ~ 0.5 for faster growing strains (wild type, LL1356-1359), and OD600 ~ 0.2 for slower growing strains (LL1414-1417). Wt is shown in grey, Δrex strains before adaptation in blue and Δrex strains after adaptation in red. Gene expression levels of adhE and adhA are normalized to recA. Biological duplicates were performed for each reaction; error bars represent one standard deviation.

Gene expression levels of adhE and adhA.

Panel A shows adhE expression levels and panel B shows adhA expression levels. Strains were grown at 55°C to mid-log phase—OD600 ~ 0.5 for faster growing strains (wild type, LL1356-1359), and OD600 ~ 0.2 for slower growing strains (LL1414-1417). Wt is shown in grey, Δrex strains before adaptation in blue and Δrex strains after adaptation in red. Gene expression levels of adhE and adhA are normalized to recA. Biological duplicates were performed for each reaction; error bars represent one standard deviation.

Alcohol dehydrogenase activity increased in Δrex strains

To determine the effect of the rex deletion on alcohol dehydrogenase (ADH) enzymatic activity, ADH activity in the direction of ethanol formation was measured. As presented in Table 4, comparing to wild type, NADH-linked ADH activity increased when rex was deleted (Rex-2, 4, 5, 8). The adapted strains RexAdp-2, 4, 5, and 8 showed different levels of decrease in NADH-ADH activity compared to the non-adapted strains. RexAdp-2 and RexAdp-5 showed almost complete elimination of NADH-ADH activity. This was not unexpected, as both RexAdp-2 and RexAdp-5 had at least one mutation in adhE (Table 3). Surprisingly, we did not see an increase in NADPH-ADH activity (contributed by AdhA) in either the adapted or the non-adapted Δrex strains (Table 4). In fact, NADPH-ADH activity remained at about 50% of wild-type levels in all measured Δrex strains (Table 4).
Table 4

ADH activity in Δrex strains.

StrainLL numberDescriptionADH specific activity aEthanol yield (% theoretical) b
NADHNADPH
Wild typeLL1025Wild type2.39 ± 0.010.77 ± 0.1640%
Rex-2LL1414Before adaptation4.89 ± 0.370.31 ± 0.0488%
RexAdp-2LL1356After adaptation, mutation in adhE0.00 ± 0.050.24 ± 0.0156%
Rex-4LL1415Before adaptation5.17 ± 0.770.33 ± 0.194%
RexAdp-4LL1357After adaptation, mutation upstream of adhE3.43 ± 0.840.25 ± 0.0765%
Rex-5LL1416Before adaptation11.23 ± 1.960.35 ± 0.0987%
RexAdp-5LL1358After adaptation, mutation in adhE0.02 ± 0.010.31 ± 0.0656%
Rex-8LL1417Before adaptation13.23 ± 1.640.36 ± 0.0693%
RexAdp-8LL1359After adaptation, mutation upstream of adhE2.42 ± 0.280.28 ± 0.0444%

Specific activity is an average of two technical replicates. Error is one standard deviation. Units are U/mg cell extract protein, where 1 U indicates the formation of 1 umol of product per minute.

ethanol yields from Fig 1, provided here for comparison.

Specific activity is an average of two technical replicates. Error is one standard deviation. Units are U/mg cell extract protein, where 1 U indicates the formation of 1 umol of product per minute. ethanol yields from Fig 1, provided here for comparison.

Complementation of the rex deletion

To separate the effect of deleting rex from the effect of subsequent secondary mutations, we complemented the rex deletion by inserting rex at its original locus (see Material and methods). We hypothesized that if the secondary mutations did not affect the regulatory role of Rex in ethanol production, then complementation of rex in the adapted Δrex strains should result in an ethanol yield comparable to or lower than wild type levels. We performed the complementation in all four of the adapted strains RexAdp-2, 4, 5, 8, however only RexAdp-4 and RexAdp-5 yielded successful transformants: RexCmp-4 and RexCmp-5. This is possibly due to the lower transformation efficiency we observed with erythromycin selection in T. saccharolyticum as compared to kanamycin selection. Analysis of fermentation end products showed that strain RexCmp-4 produced ethanol at 31% theoretical yield, which was lower than wild type levels and about half the ethanol yield in its parent strain. On the contrary, RexCmp-5 produced ethanol at 56% theoretical yield, which was the same as its parent strain RexAdp-5.

Predicted Rex-binding sites in T. saccharolyticum

We selected the Rex-binding DNA motif ATTGTTANNNNNNTAACAAT in T. ethanolicus [13] as a template to search for similar motifs in T. saccharolyticum, due to the close phylogenic relationship between the two organisms. The T. ethanolicus Rex-binding DNA motif was searched using the BLAST algorithm against the upstream regions of adhE and adhA of T. saccharolyticum, and a putative T. saccharolyticum Rex-binding DNA motif with a consensus sequence of TTGTTANNNNNNTAACNN was identified (S1 Fig). Based on this consensus sequence, we searched for similar palindromes comprising 5 bp inverted repeats with a G/C center (e.g. TTGTT and AACAA), where the inverted repeats were separated by an 8 bp span of AT-rich bases (see Material and methods). The potentially functional binding sites (within 200 bp of the nearest downstream gene) are summarized in Table 5. Many predicted sites were located upstream of genes related to energy metabolism, carbon metabolism, biosynthesis, and membrane-associated transporters.
Table 5

Putative Rex-binding sites in T. saccharolyticum.

Locus aGene(s) bProtein productCategoryRex-binding sequenceDistance to gene c
Tsac_0014Cof-like hydrolaseMisc dTTGTAAATTTACATACTA-65
Tsac_0416adhEAdhECarbTTGTTAAATGAATAACAA-150
Tsac_0416adhEAdhECarbTTGTTAATAAATTAACAC-31
Tsac_0648Cation diffusion facilitator family transporterMemATGATAATCAATAATCTT-116
Tsac_0675echABCDEF-hypABFCDEEnergy-conserving Ni-Fe hydrogenase; Ni-Fe hydrogenase maturation factorEnergyTTGTTAAATAATAAACAA-138
Tsac_0692Extracellular solute-binding protein family 1MemTTGAAATTATTATTTCAA-169
Tsac_0706asrABCAnaerobic sulfite reductaseMiscTGGTTATTTATTTAACAAA-56
Tsac_0744Stage V sporulation protein TSpoTTGAACTTAAAATTTCAG-36
Tsac_0924ACT domain-containing proteinSynATGATAATAAAACATCAA-82
Tsac_0932Stage II sporulation protein ESpoATGATATAATCATATCAA-37
Tsac_0989Glutamyl-tRNA synthetaseSynATGTATATGATAATACAA-35
Tsac_1035Translation initiation factor IF-1SynAAGAAAAAATTGATTCAT-154
Tsac_1163ABC-type transporter, integral membrane subunitMemACGATATATGTAAATCAT-92
Tsac_1375marRRegulatory protein MarRMiscCTGAAATAATCATTTCAA-86
Tsac_1550hfsABCDIron hydrogenases; sporulation proteinEnergyTTGTTAATAAATTAACTA-78
Tsac_1619Prephenate dehydrogenaseCarbGTGATTTTAAATGATCAA-10
Tsac_17533-oxoacyl-(acyl-carrier-protein) reductaseSynTTGATAAACTTTTATCCA-35
Tsac_1856PHP domain proteinSynTTGTTTTTAGTTTAACAT-33
Tsac_1947Fimbrial assembly family proteinMemATGATTCAAAAAAATCAA-186
Tsac_1985ABC transporter relatedMemTTGAATTGAAATTTTCTA-82
Tsac_2078ABC-2 type transporterMemCTGATGAATTAAAATCAA-99
Tsac_2087adhAAlcohol dehydrogenase AdhACarbTAGTTAAATTTATAACAA-34
Tsac_2115rodARod shape-determining protein RodAMiscTAGTATTATATCATACAA-60
Tsac_2192MutS2 proteinSynATGAATTTTTGTATTCTT-88
Tsac_2363hydGFe-hydrogenase maturation proteinEnergyTTGTTAAATATTCAACAA-92
Tsac_2550Nucleoside-triphosphatase rdgBSynATGATTTTATTCAATCCT-74
Tsac_2619Gluconate 2-dehydrogenaseCarbTTGATTACATAATATCCA-44
Tsac_2652Sigma 54 modulation protein/ribosomal proteinS30EAMiscATGAAATCTAATATTCCT-62
Tsac_2683PhosphoribosyltransferaseSynAAGATTATTATCTATCAT-165

The locus tag of the nearest downstream gene

Known gene names based on sequence homology

Distance from Rex-binding site to the start of the nearest downstream gene (including length of the Rex-binding site)

Trans: transcription; Syn: biosynthesis; Misc: miscellaneous; Carb: carbon metabolism; Mem: membrane-associated; Spo: sporulation

The locus tag of the nearest downstream gene Known gene names based on sequence homology Distance from Rex-binding site to the start of the nearest downstream gene (including length of the Rex-binding site) Trans: transcription; Syn: biosynthesis; Misc: miscellaneous; Carb: carbon metabolism; Mem: membrane-associated; Spo: sporulation

Discussion

adhE and adhA gene expression increased in Δrex strains

As shown in Fig 2, expression of alcohol dehydrogenase genes adhE and adhA increased in Δrex strains Rex-2, 4, 5, and 8. The significant increase in adhE expression agrees with previous studies in other microorganisms that measured adhE gene expression in Rex-inactivated strains [10,12,15,21], suggesting that Rex regulates adhE expression in T. saccharolyticum. Corresponding to the decrease in ethanol production in adapted Δrex strains (Fig 1), a decrease in adhE expression was also observed (Fig 2). RexAdp-4 and RexAdp-8 had the largest decrease in adhE expression, which may be explained by the secondary mutation found 184 bp upstream of adhE in these strains (Table 3). In T. ethanolicus, adhA was a predicted target of Rex based on its binding motif and was shown to be regulated by Rex in in vitro DNA-binding assays [13]. In the current study we provide in vivo gene expression data that suggests Rex is a regulator for adhA. It should be noted that AdhA herein refers to the iron-containing alcohol dehydrogenase with at least 60% protein sequence identity to the T. saccharolyticum AdhA (as previously reviewed [1], a variety of proteins named AdhA exist that are not homologous to the T. saccharolyticum AdhA). Interestingly, the increase in adhA expression was less significant than the increase in adhE expression in Δrex strains (Fig 2). This may be due to the fact that only one predicted Rex binding site was found upstream of T. saccharolyticum adhA, while two were found upstream of adhE (Table 5). Taken together, the data strongly suggests that Rex negatively regulates both adhE and adhA in T. saccharolyticum.

Secondary mutations and their effect on ethanol production

One of the most significantly affected genes by deleting rex was adhE. All of the adapted rex deletion strains had mutations either within or just upstream of the adhE gene. AdhE is a bifunctional alcohol dehydrogenase with two domains, ADH and ALDH, and it catalyzes the last two steps of ethanol formation [1,6]. One explanation for the high frequency of mutations in adhE would be the sudden increase in ethanol production after deleting rex (Fig 1). Without the ability to regulate adhE expression levels, the NADH pool could become depleted due to over-production of ethanol. This would be disruptive to metabolism, leading to slower growth. Additionally, overflow through the ethanol pathway would decrease the flow toward acetate production, as shown by the ~10 fold decrease in acetate production in S1 Table. Decreased acetate production would lead to a decrease in ATP production, contributing to slower growth. Therefore, adhE mutations that limit ethanol production could provide a selective advantage. Protein sequence alignment showed that AdhE mutations T597K, T597I, and T605I, occurred at highly conserved residues in the alcohol dehydrogenase domain of AdhE (S2 Fig), thus we would anticipate a large decrease in ADH enzymatic activity. Indeed, in RexAdp-2 and RexAdp-5, we saw complete elimination of NADH-linked ADH activity (Table 4), which was expected because the wild type T. saccharolyticum AdhE was shown to be NADH-linked [6]. However, there were no mutations in adhA, a gene we predicted to be regulated by Rex as well (Table 5). Corresponding enzymatic activity also showed no significant reduction in NADPH-linked ADH activity compared to the non-adapted parent strains (Table 4), indicating no reduction in AdhA activity [1]. The lack of influence of the rex deletion on AdhA activity suggests a weaker control of Rex on adhA expression. We have previously shown that although both NADH and NADPH-linked ADH enzymes exist in T. saccharolyticum, the actual flux through these pathways can vary [28]. Interestingly, while the electron transfer stoichiometry is significantly different in the two systems, both the NADH-linked and the NADPH-linked pathways resulted in high ethanol yield [28]. In this study, although total ADH activity (NADH+NADPH-linked) decreased by ~95% in RexAdp-2 and RexAdp-5 compared to their parent strains due to loss of AdhE ADH function, their ethanol yields only decreased by about 36% (Fig 1 and Table 4). The ability to produce ethanol indicates that the mutation did not affect the ALDH domain of AdhE, as AdhE is the only known enzyme capable of reducing acetyl-CoA to acetaldehyde, based on our current understanding [1]. The seemingly discrepancy between loss of enzyme activity and loss of ethanol yield may be due to the shift in ADH cofactor specificity. It is likely that before the adhE mutation, there was not a significant flux through AdhA (although the enzyme is fully functional as measured by in vitro assays), and the electron flux from pyruvate to acetyl-CoA mainly flows through the NADH-linked FNOR (Ferredoxin:NAD+ oxidoreductase) [29], rendering this a primarily NADH-linked system. After the adhE mutation, the cell relies completely upon the NADPH-linked AdhA for reduction of acetaldehyde to ethanol. From pyruvate to acetyl-CoA, electrons would likely flow through NfnAB (NADP oxidoreductase) instead of the NADH-linked FNOR to balance the NADP+ generated by AdhA, therefore shifting toward a primarily NADPH-linked system. The ability for AdhA to produce high levels of ethanol in the absence of AdhE ADH activity agrees with previous results [1][30]. Additionally, we saw several mutations accumulate in RNA polymerase genes sigK and rpoN, indicating an overall decrease in transcription. There were also mutations in biosynthesis genes and genes encoding membrane-associated proteins (Table 3). These mutations in biosynthesis genes may reflect a stress response to the sudden increase in ethanol production upon loss of rex. The effects of ethanol stress have been most extensively studied in yeast [31]. Ethanol stress influences several aspects of yeast physiology, resulting in decreased mRNA and protein levels [32,33], decreased transport processes [34], and decreased H+-ATPase activity [35]. It is also well known that ethanol has a negative effect on membrane-associated proteins [36-38]. Therefore, the secondary mutations related to transcription and membrane-associated proteins (Table 3) may be adaptive responses to ethanol stress. It should be noted that the mutations presented in Table 3 include mutations that occurred before and after growth adaptation. Since biological changes start to take place as soon as the rex gene is successfully deleted, mutations may already have accumulated by the time rex deletion colonies were picked and analyzed, thus the pre-adaptation strains Rex 2, 4, 5, 8 may also contain mutations. However, we were unable to sequence the genome of the pre-adaptation strains (Rex 2, 4, 5, 8) because the adaptation happened so quickly—we saw a significant increase in growth rate after only 2–3 serial transfers. To re-grow strains Rex 2, 4, 5, 8 for genome sequencing, we would essentially be introducing a new round of adaptation for faster growth, where new mutations may occur. This may explain the difference in NADH-linked ADH activity in the pre-adaptation rex deletion strains (Table 4, Rex 2, 4, 5, 8), as some adhE mutations may have already accumulated in subpopulations of these strains. Another possible reason for the difference in ADH activity in pre-adaptation strains is the mutations in biosynthesis genes discussed above. Since adhE is one of the most highly expressed genes in T. saccharolyticum [8], changes in biosynthesis may largely affect the percentage of AdhE proteins in the cell extract, which will in turn affect NADH-linked ADH activity. When the rex gene was restored in strain RexAdp-4, we observed ethanol yield decrease by half, suggesting that Rex was now inhibiting adhE expression, and providing additional evidence that the previous increase in ethanol yield (when rex was initially deleted) was due to the specific function of the Rex protein. The ethanol yield of RexCmp-4 was lower than what was observed in the wild type strain, which suggests a role for at least one of the secondary mutations. The most likely candidate is the mutation upstream of adhE (Table 3), which could also explain the decreased adhE expression in the RexAdp-4 strain (Fig 2). We did not observe a change in ethanol yield when rex was restored in strain RexAdp-5, generating strain RexCmp-5. We believe the explanation for this result is that the RexAdp-5 strain (and subsequently RexCmp-5 strain) contained an AdhE mutation that eliminated its ADH activity (Table 4), and thus masked the result of the rex complementation.

Putative Rex-regulated genes

In a previous study, Ravcheev et al. utilized comparative genetics to analyze 119 genomes from 11 bacterial taxonomic groups (not including T. saccharolyticum) in search of a common set of genes regulated by Rex [16]. Their results predicted that a small set of “core Rex regulons” existed in different organisms, meaning these genes were predicted to be regulated by Rex in at least two taxonomic groups. “Core Rex regulons” included genes in energy metabolism, central glycolytic pathways, and fermentation [16]. In T. saccharolyticum, our sequence analysis also predicted a number of genes involved in energy metabolism and electron transfer, carbon metabolism, and fermentation (Table 5). In particular, two putative Rex-binding sites were found upstream of adhE and one upstream of adhA (Table 5), indicating a high degree of control of Rex on T. saccharolyticum ethanol fermentation [1]. Additionally, Ravcheev et al. presented three Rex regulons specific to the thermoanaerobacterales taxon: hydG, echABCDEF, and hypABFCDE [16]. The thermoanaerobacterales taxon in the Ravcheev et al. study included three genomes (T. ethanolicus, Thermoanaerobacter tengcongensis, and Caldicellulosiruptor saccharolyticus), and putative Rex-binding sites were predicted with the RegPredict Web server tool (regpredict.lbl.gov) [16]. In this study, we utilized a different site-prediction platform PATLOC (http://www.cmbl.uga.edu/software/patloc.html) to find putative Rex-binding sites because the T. saccharolyticum genome was not available in the RegPredict database. Interestingly, despite the difference in algorithms, our predictions in T. saccharolyticum also yielded hydG, echABCDEF, and hypABFCDE. In T. saccharolyticum, echABCDEF and hypABFCDE are part of the same operon lead by a common promoter region, which included the putative Rex-binding site. The echABCDEF genes encode the energy-conserving Ni-Fe hydrogenase involved in electron transfer and H2 production[39], and the hypABFCDE genes encode proteins related to the maturation of the energy-conserving Ni-Fe hydrogenase [16]. hydG is a Fe-hydrogenase maturation protein necessary for assembling the active sites of Fe hydrogenases [40]. These results suggest that Rex may play an important role in T. saccharolyticum energy metabolism and electron transfer. However, Rex regulons are highly variable between different species, which might be explained by Rex regulons changing rapidly and adapting to the organisms’ different lifestyles and ecological niches [16]. Our analysis in T. saccharolyticum provides new putative Rex regulons involved in biosynthesis, membrane-associated transportation and sporulation.

Deleting rex as an engineering strategy for higher ethanol production

One goal of this study was to investigate deleting rex as an engineering strategy for increased ethanol production in T. saccharolyticum. Currently the best ethanol-producing strain of T. saccharolyticum is LL1049 (a.k.a. M1442 [3]), a strain generated by deleting several genes including ldh (lactate dehydrogenase) and pta-ack (phosphotransacetylase and acetate kinase). LL1049 produces ethanol at 75%~90% theoretical yield under different fermentation conditions [1,3]. However, it was surprising to see a significant decrease in T. saccharolyticum growth rate associated with the rex deletion (Table 2). This growth defect contrasted sharply with previous studies in other organisms [10,12,14,15,17,21], where the Rex-inactivated strains presented growth curves similar to the wild type strain (under anaerobic fermentation conditions). The reduction in T. saccharolyticum growth may be due to changes in transcription of Rex-regulated growth-related genes, or due to secondary mutations that occurred upon rex deletion. When the slow-growing Δrex strains (Rex-2, 4, 5, 8) were selected for faster growth via serial transfers, the resulting strains (RexAdp-2, 4, 5, 8) showed a large decrease in ethanol yield (Fig 1). These results suggest that, contrary to our expectations, we were unable to obtain a strain with both high ethanol yield and robust growth after deleting the rex gene. Therefore, deletion of the rex gene does not seem to be a promising strategy for improving ethanol yield in T. saccharolyticum.

Conclusions

In this work we have demonstrated that the Rex protein plays a role in regulating ethanol production in T. saccharolyticum by gene deletion and complementation experiments. We identified a number of secondary mutations in rex deletion strains that occurred after adaptation for faster growth and correlated with a decrease in ethanol yield. Thus, it appears that in the absence of a functional rex gene, there is selective pressure for T. saccharolyticum to decrease AdhE activity by introducing mutations within or upstream of the gene. This causes the initial high-ethanol phenotype in rex deletion strains to be lost after several rounds of serial transfers. Although deletion of rex is not a promising technique for engineering improved ethanol yield, this work sheds light on the role of Rex in regulating ethanol production in this organism.

Putative Rex-binding motif in T. saccharolyticum.

Locations of putative Rex-binding motifs: -35 bp upstream of adhA, -151 bp upstream of adhE and -32 bp upstream of adhE. Consensus sequence: NTTGTTANNNNNNTAACNNN. Nucleotide coloring: A-red, T-green, G-yellow, C-blue. (PDF) Click here for additional data file.

Sequence conservation of AdhE.

Partial sequence alignment of AdhE from Thermoanaerobacter ethanolicus, Thermoanaerobacter mathranii, Thermoanaerobacterium saccharolyticum, Entamoeba histolytica, Escherichia coli, Clostridium thermocellum, Leuconostoc mesenteroides, Lactococcus lactis, Oenococcus oeni, and Streptococcus equinus. Residues highlighted in red are the most conserved; residues highlighted in blue are least conserved. Residues enclosed in blue brackets indicate mutation sites shown in Table 3; mutations include T597K, T597I, and T605I. (PDF) Click here for additional data file.

Fermentation end product analysis.

(PDF) Click here for additional data file.

qPCR primers.

(PDF) Click here for additional data file.
  35 in total

1.  Pattern locator: a new tool for finding local sequence patterns in genomic DNA sequences.

Authors:  Jan Mrázek; Shaohua Xie
Journal:  Bioinformatics       Date:  2006-11-08       Impact factor: 6.937

2.  Effects of ethanol and other alkanols on the general amino acid permease of Saccharomyces cerevisiae.

Authors:  C Leão; N van Uden
Journal:  Biotechnol Bioeng       Date:  1984-04       Impact factor: 4.530

Review 3.  Energy conservation via electron bifurcating ferredoxin reduction and proton/Na(+) translocating ferredoxin oxidation.

Authors:  Wolfgang Buckel; Rudolf K Thauer
Journal:  Biochim Biophys Acta       Date:  2012-07-16

4.  Rex (encoded by DVU_0916) in Desulfovibrio vulgaris Hildenborough is a repressor of sulfate adenylyl transferase and is regulated by NADH.

Authors:  G A Christensen; G M Zane; A E Kazakov; X Li; D A Rodionov; P S Novichkov; I Dubchak; A P Arkin; J D Wall
Journal:  J Bacteriol       Date:  2014-10-13       Impact factor: 3.490

5.  Transcriptional regulation of central carbon and energy metabolism in bacteria by redox-responsive repressor Rex.

Authors:  Dmitry A Ravcheev; Xiaoqing Li; Haythem Latif; Karsten Zengler; Semen A Leyn; Yuri D Korostelev; Alexey E Kazakov; Pavel S Novichkov; Andrei L Osterman; Dmitry A Rodionov
Journal:  J Bacteriol       Date:  2011-12-30       Impact factor: 3.490

6.  Both adhE and a Separate NADPH-Dependent Alcohol Dehydrogenase Gene, adhA, Are Necessary for High Ethanol Production in Thermoanaerobacterium saccharolyticum.

Authors:  Tianyong Zheng; Daniel G Olson; Sean J Murphy; Xiongjun Shao; Liang Tian; Lee R Lynd
Journal:  J Bacteriol       Date:  2017-01-12       Impact factor: 3.490

7.  Deletion of nfnAB in Thermoanaerobacterium saccharolyticum and Its Effect on Metabolism.

Authors:  Jonathan Lo; Tianyong Zheng; Daniel G Olson; Natalie Ruppertsberger; Shital A Tripathi; Liang Tian; Adam M Guss; Lee R Lynd
Journal:  J Bacteriol       Date:  2015-06-29       Impact factor: 3.490

8.  Redox sensing by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus.

Authors:  Martin Pagels; Stephan Fuchs; Jan Pané-Farré; Christian Kohler; Leonhard Menschner; Michael Hecker; Peter J McNamarra; Mikael C Bauer; Claes von Wachenfeldt; Manuel Liebeke; Michael Lalk; Gunnar Sander; Christof von Eiff; Richard A Proctor; Susanne Engelmann
Journal:  Mol Microbiol       Date:  2010-03-30       Impact factor: 3.501

Review 9.  Tolerance and stress response to ethanol in the yeast Saccharomyces cerevisiae.

Authors:  Junmei Ding; Xiaowei Huang; Lemin Zhang; Na Zhao; Dongmei Yang; Keqin Zhang
Journal:  Appl Microbiol Biotechnol       Date:  2009-09-16       Impact factor: 4.813

10.  Analysis of composition and structure of Clostridium thermocellum membranes from wild-type and ethanol-adapted strains.

Authors:  Michael D Timmons; Barbara L Knutson; Sue E Nokes; Herbert J Strobel; Bert C Lynn
Journal:  Appl Microbiol Biotechnol       Date:  2009-02-17       Impact factor: 4.813

View more
  2 in total

1.  Conversion of phosphoenolpyruvate to pyruvate in Thermoanaerobacterium saccharolyticum.

Authors:  Jingxuan Cui; Marybeth I Maloney; Daniel G Olson; Lee R Lynd
Journal:  Metab Eng Commun       Date:  2020-01-23

2.  Cross-feeding and wheat straw extractives enhance growth of Clostridium thermocellum-containing co-cultures for consolidated bioprocessing.

Authors:  Alan G Froese; Richard Sparling
Journal:  Bioprocess Biosyst Eng       Date:  2021-01-03       Impact factor: 3.210

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.