| Literature DB >> 29599916 |
Angela Lamarca1, Daisuke Nonaka2,3, Wolfgang Breitwieser4, Garry Ashton5, Jorge Barriuso1,3, Mairéad G McNamara1,3, Sharzad Moghadam5, Jane Rogan5, Wasat Mansoor1, Richard A Hubner1, Christopher Clark4, Bipasha Chakrabarty2, Juan W Valle1,3.
Abstract
BACKGROUND: The extent of resistance to immune surveillance in patients with well-differentiated (Wd) (grade 1/2) small-intestinal neuroendocrine tumours (Si-NETs) is unknown.Entities:
Keywords: PD-L1; immunotherapy; neuroendocrine; treatment; tumour infiltrating lymphocytes
Year: 2018 PMID: 29599916 PMCID: PMC5871087 DOI: 10.18632/oncotarget.24464
Source DB: PubMed Journal: Oncotarget ISSN: 1949-2553
Patients’ baseline characteristics
| Variable | Frequency | % | |
|---|---|---|---|
| Female | 28 | 45.16 | |
| Male | 34 | 54.84 | |
| Median (range) | 63.75 | 26.17-85.93 | |
| None | 16 | 25.81 | |
| Mild | 41 | 66.13 | |
| Moderate | 5 | 8.06 | |
| No | 54 | 87.10 | |
| Yes | 8 | 12.90 | |
| 0 | 27 | 43.55 | |
| 1 | 30 | 48.39 | |
| 2 | 4 | 6.45 | |
| 3 | 1 | 1.61 | |
| Yes (Any symptom) | 26 | 41.94 | |
| Flushing | 15 | 24.19 | |
| Diarrhoea | 19 | 30.65 | |
| Wheezing | 3 | 4.84 | |
| II | 3 | 4.84 | |
| III | 25 | 40.32 | |
| IV | 34 | 54.84 | |
| 2 | 6 | 9.68 | |
| 3 | 20 | 32.26 | |
| 4 | 20 | 32.26 | |
| X | 16 | 25.81 | |
| 0 | 2 | 3.23 | |
| 1 | 43 | 69.35 | |
| X | 17 | 27.42 | |
| 0 | 28 | 45.16 | |
| 1 | 34 | 54.84 | |
| 1 | 19 | 30.65 | |
| 2 | 11 | 17.74 | |
| 3 | 4 | 6.45 | |
| Distant mesenteric lymph nodes | 16 | 25.81 | |
| Liver | 24 | 38.71 | |
| Lung | 1 | 1.61 | |
| Peritoneum | 9 | 14.52 | |
| Bone | 2 | 3.23 | |
| Pancreas | 1 | 1.61 | |
| Ovary | 1 | 1.61 |
ECOG-PS: Eastern Cooperative Oncology Group Performance Status score; 95%-CI: 95% confidence interval; NET: neuroendocrine tumour; PMH: past medical history; ACE-27: Adult Comorbidity Evaluation (ACE)-27 index; ENETS: European Neuroendocrine Tumour Society; X: not evaluated.
Characteristics of retrieved samples
| Variable | Frequency | % | |
|---|---|---|---|
| Grade 1 | 47 | 67.14 | |
| Grade 2 | 23 | 32.86 | |
| Median (range) | 2 (0.7-18) | ||
| Median (range) | 12 (2-30) | ||
| Median (range) | 91 (3-600) | ||
| No | 55 | 78.57 | |
| Yes | 15 | 21.43 | |
| Chemotherapy | 5* | 7.14 | |
| SSA | 5 | 7.14 | |
| Steroids | 3 | 4.29 | |
| IFN | 2 | 2.86 | |
| Primary tumour | 47 | 67.14 | |
| Metastatic site | 23 | 32.86 | |
| Liver | 19 | 27.14 | |
| Peritoneum | 2 | 2.86 | |
| Mesenteric mass | 1 | 1.43 | |
| Ovarian metastases | 1 | 1.43 | |
* 4 of these 5 samples are from to the same patient.
IHC: immunohistochemistry; 95%-CI: 95% confidence interval; mm: millimetres; mm2: squared millimetres; SSA: somatostatin analogues; IFN: interferon.
Figure 1IHC assessment of FFPE archival tissue samples (x200 magnification)
Patient 1: Tumour was negative for PD-L1 (1.A); there were CD3 positive tumour infiltrating lymphocytes (1.B). Patient 2: PD-L1 stain demonstrates membranous expression of tumour cells as well as infiltrating immune cells (the immune cells show strong expression while the expression in the tumour is variable in intensity (2.A)); CD3+ tumour infiltrating lymphocytes (2.B). PD-L1: Programmed death-ligand 1; IHC: immunohistochemistry; FFPE: formalin-fixed paraffin embedded.
IHC expression of PD-1, PD-L1, PD-L2 and TILs
| Cell type explored | Grade of expression | PD-L1 expression | PD-L2 expression | PD-1 expression | Lymphoid aggregates | CD3 | CD68 | CD4 | CD8 | CD20 | CD4/CD8 ratio (applicable only for samples with CD4 and CD8 expression) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | Freq | % | ||
| No | 61 | 87.14 | 70 | 100 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| Yes | 9 | 12.86 | 0 | 0 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 0% | 61 | 87.14 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 5% | 7 | 10.00 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 10% | 0 | 0 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 20% | 2 | 2.86 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| No | 53 | 75.71 | 70 | 100 | 52 | 74.29 | 51 | 72.86 | 3 | 4.29 | 3 | 4.29 | 38 | 54.29 | 2 | 2.86 | 42 | 60.00 | n/a | n/a | |
| Yes | 17 | 24.29 | 0 | 0 | 18 | 25.71 | 19 | 27.14 | 67 | 95.71 | 67 | 95.71 | 32 | 45.71 | 68 | 97.14 | 28 | 40.00 | n/a | n/a | |
| 0% | 53 | 75.71 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 5% | 15 | 21.43 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 10% | 1 | 1.43 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| 20% | 1 | 1.43 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | |
| None | n/a | n/a | n/a | n/a | 52 | 74.29 | n/a | n/a | 3 | 4.29 | 3 | 4.29 | 38 | 54.29 | 2 | 2.86 | 42 | 60.00 | n/a | n/a | |
| Focal | n/a | n/a | n/a | n/a | 17 | 24.29 | n/a | n/a | 62 | 88.57 | 67 | 95.71 | 30 | 42.86 | 65 | 92.86 | 27 | 38.57 | n/a | n/a | |
| Moderate | n/a | n/a | n/a | n/a | 1 | 1.43 | n/a | n/a | 5 | 7.14 | 0 | 0 | 2 | 2.86 | 3 | 4.29 | 1 | 1.43 | n/a | n/a | |
| Severe | n/a | n/a | n/a | n/a | 0 | 0 | n/a | n/a | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | n/a | n/a | |
| 1:1 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | 13 | 40.63 | |
| 1:2 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | 13 | 40.63 | |
| 1:3 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | 2 | 6.25 | |
| 1:4 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | 3 | 9.38 | |
| 2:1 | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | n/a | 1 | 3.13 | |
IHC: immunohistochemistry; TILs: tumour infiltrating lymphocytes; Freq: frequency; n/a not applicable; TILs: tumour infiltrating lymphocytes; PD-1: Programmed cell death protein 1; PD-L1: Programmed death-ligand 1; PD-L2: Programmed death-ligand 2.
Figure 2Distribution and overlapping of IHC characteristics
PD-L1: Programmed death-ligand 1; IHC: immunohistochemistry.
Figure 3RT-qPCR results correlated with IHC findings
Values of expression in RT-qPCR are shown as the difference between the gene of interest and the housekeeping gene. IHC: immunohistochemistry; RT-qPCR: reverse transcription quantitative polymerase chain reaction.
Studies exploring the PD1 pathway in neuroendocrine neoplasms
| Tumour differentiation | Subgroup of NETs explored | Reference | Findings |
|---|---|---|---|
| Small cell NEC (any site (n=94); including lung primary (n=61)) | Schultheis | PD-1 expression in stroma 47.9% | |
| Merkel cell carcinoma (n=21) | Behr | PD-L1 expression in tumour (8/19); PD-L1 expression in TILs (7/19) | |
| Merkel cell carcinoma (n=136) | Benhamou | PD-L1 expression in tumour (57%) | |
| Large Cell NECs (LCNECs) (n=10) | Fan | PD-1 expression 80% | |
| Small Cell Lung Cancer (SCLCs) (n=48) | Fan | PD-1 expression 54.5% | |
| Mixed population of foregut and hindgut primaries (n=15) | Kim | PD-L1 expression 7/15 (46.7%) | |
| Pancreatic NETs (13.7% poorly-differentiated) (n=117) | Saganas | PD-L1 expression within primary tumours: 58% negative, 42% positive (34% moderately positive, 8% strongly positive) | |
| Mixed population of various gastrointestinal primaries (n=120) | Yinying | PD-1 expression in TILs 55.8% | |
| Lung primaries (11 LCNECs, 49 TC, 5 AC) | Kossai | PD-L1 expression 0% | |
| Lung carcinoids (n=22) | Fan | PD-1 expression 59.1% | |
| Da Silva | PD-1 expression in stroma 45% | ||
| Pancreatic NETs (n=21) | Da Silva | PD-1 expression in stroma 47% | |
| Mixed population of foregut and hindgut primaries (n=17) | Kim et al [ | PD-L1 expression 0/17 (0%) | |
| Cives et al [ | PD-1 expression in TILs observed only in PD-L1 expressing NETs (17/22) | ||
| Lamarca | PD-1 expression in TILs 18% |
Highlighted rows represent those studies/cohorts with similar characteristics to current study population.
NEC: neuroendocrine carcinoma; NETs: neuroendocrine tumours; Pd: poorly-differentiated; Wd: well-differentiated; Si-NETs: small intestine neuroendocrine tumours; TILs: tumour infiltrating lymphocytes; PD-1: Programmed cell death protein 1; PD-L1: Programmed death-ligand 1; n: number of patients; TC: typical carcinoid; AC: atypical carcinoid.
Immunohistochemistry scoring system and primers and probes employed for RT-qPCR
| Target | IHC (scoring system) | IHC Antibodies employed | Primers and probes (RT-qPCR) |
|---|---|---|---|
| PD-1 | Focal (isolated, <5% of TILs); Moderate (5-50% of TILs); Severe (>50% of TILs) | 1:25, clone NAT105; Cell Marque® | ccgcacgagggacaatag |
| PD-L1 | Scored at 5% intervals. Specimens with ≥5% membranous expression were considered “positive” | 1:200, clone E1L3N; Cell Signaling Technology® | ctactggcatttgctgaacg |
| PD-L2 | Scored at 5% intervals. Specimens with ≥5% membranous expression were considered “positive” | MAB1224 by R&D Systems® | aaagagggaagtgaacagtgct |
| CD3, CD4, CD8, CD20, CD68 | Semi-quantitative score: None (no immune infiltrates); Focal (mostly perivascular infiltrate with some intratumoural extension); Moderate (prominent extension of immune infiltrates away from perivascular areas and amongst tumour cells); Severe (immune infiltrates obscuring the tumour) | CD3: 1:400; rabbit polyclonal, Dako® | n/a |
| GAPDH (house-keeping gene) | n/a | n/a | agccacatcgctcagacac |
| SDHA (house-keeping gene) | n/a | n/a | cctgtcctatgtggacgttg |
IHC: immunohistochemistry; RT-qPCR: reverse transcription quantitative polymerase chain reaction; n/a applicable; TILs: tumour infiltrating lymphocytes; PD-1: Programmed cell death protein 1; PD-L1: Programmed death-ligand 1; PD-L2: Programmed death-ligand 2.