Literature DB >> 29564067

Serogroups, subtypes and virulence factors of shiga toxin-producing Escherichia coli isolated from human, calves and goats in Kerman, Iran.

Rohollah Taghadosi1, Mohammad Reza Shakibaie1, Hesam Alizade2, Hossein Hosseini-Nave1, Asma Askari3, Reza Ghanbarpour3.   

Abstract

AIM: The present study was conducted to detect the occurrence, serogroups, virulence genes and phylogenetic relationship of shiga toxin-producing Escherichia coli (STEC) in human, clave and goat in Kerman (southeast of Iran).
BACKGROUND: STEC have emerged as the important foodborne zoonotic pathogens causing human gastrointestinal disease and confirming the risk to public health.
METHODS: A total of 671 fecal samples were collected from diarrheic patients (n=395) and healthy calves (n=156) and goats (n=120) and screened for the presence of stx gene. Furthermore, the prevalence of stx1 and stx2 variants, serotypes (O157, O145, O103, O26, O111, O91, O128, and O45), phylogenetic groups and the presence of ehxA, eae, hylA, iha and saa virulence genes were studied.
RESULTS: Prevalence of STEC in human diarrheic isolates was 1.3% (5 isolates), in claves was 26.3% (41 isolates) and in goats was 27.5% (33 isolates). stx1 gene was the most prevalent variant and detected in 75 isolates. Furthermore, stx1c was the most predominant stx subtype, found in 56 isolates. The ehxA identified in 36 (45.6%) isolates, followed by iha 5 (6.3%), eaeA 4 (5.1%), hlyA 2 (2.5%) and saa 2 (2.5%). Most of the isolates belonged to phylogroup B1. Only two O26 and one O91 isolates were detected in our study.
CONCLUSION: Our results show that STEC strains were widespread among healthy domestic animals in the southeast of Iran.

Entities:  

Keywords:  Shiga toxin-producing E. coli; serogroup; virulence factors

Year:  2018        PMID: 29564067      PMCID: PMC5849120     

Source DB:  PubMed          Journal:  Gastroenterol Hepatol Bed Bench        ISSN: 2008-2258


Introduction

Shiga toxin-producing by Escherichia coli (STEC) is an important enteric pathogen, has been reported in several outbreaks with clinical manifestations including mild diarrhea, hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS) (1, 2). The disease in human is primarily a food-borne infection. Although STEC strains have been isolated from other animals such as goats, sheep, swine, wild animals and humans, cattles are the major source of food contamination (3). The ability of STEC strains to cause human disease is mainly due to the production of shiga-like toxins (stx) which are classified into two closely related subgroups, stx1 and stx2 (encoded by the stx1 and stx2 genes). Stx1 is a homologous group with only three variants (stx1a, stx1c, and stx1d), while stx2 is a more heterogeneous group and is comprised of several subtypes (stx2a, stx2b, stx2c, stx2d, stx2e, stx2f and stx2g) (4, 5). STEC strains producing stx2a, stx2c, or stx2d subtypes are more associated with HC and HUS in humans. In contrast, stx2b, stx2e, stx2f and stx2g are related to animal infections (6). Additional factors that contribute to virulence have also been described, including intimin (encoded by the eae gene), involved in the attachment of E. coli to the enterocyte, plasmid-encoded enterohemolysin (encoded by ehxA gene) which acts as a pore-forming cytolysin, alpha-hemolysin (encoded by the hlyA gene), IrgA homologue adhesin (iha) which is a STEC adherence-conferring molecule and Saa which is an autoagglutinating adhesin produced by LEE-negative STEC (3, 7-9). Epidemiologic investigations demonstrated that O157 is the main cause of HC and HUS in human; however, additional serogroups that have been reported in human clinical cases are O26, O45, O91, O103, O111, O128 and O145, and others in recent years (10, 11). E. coli can also be assigned to one of the four major phylogenetic groups (A, B1, B2 and D) based on the presence or absence of chuA, yjaA and TspE4.C2 (12). Bearing in mind the importance of E. coli as food-borne pathogens, as vehicle of human disease, the objectives of this study were to investigate the distribution of subtypes, serotypes, virulence factors and phylogenetic groups among STEC strains from healthy domestic animals (calves and goats) and patients with diarrhea in Kerman, southeast of Iran.

Methods

Specimen collection and microbiological processing In a prospective study, from October 2014 to November 2015, a total of 671 fecal samples were collected from diarrheic patients (n=395) and fecal healthy calves (n=156) and goats (n=120). The human samples were related to both male (n=215) and female (n=180). Their age ranged from <5 years old (n=107), 5 to 15 years old (n=146), 15 to 40 years old (n=75) and 40 to 90 years old (n=67). The human isolates obtained from the rectal swab of the patient with diarrhea referred to Afzalipour and Payambar-Azam hospitals. All animal samples were collected by veterinarians from School of Veterinary Medicine, Shahid Bahonar University, Kerman, Iran. All samples were placed into Amies medium (Becton Dickinson, BBL, and USA) and were sent out to the laboratory in ice-cooled containers. The samples were taken to the microbiology laboratory, Kerman University of Medical Sciences and identified as E. coli by biochemical characteristics and conventional diagnostic tests (13). All strains were stored at −70°C in Trypticase Soy broth (Difco Laboratories, Detroit, Mich.) containing 30% glycerol for further study. Detection of STEC strains For the detection of stx gene, DNA template was obtained by boiling method (14). Presence of stx gene in the selected E. coli colonies was verified by PCR method (15). In addition, stx-positive isolates were examined for the presence of stx1 and stx2 genes by using duplex-PCR (16). A positive control for PCR was E. coli Sakai (stx1+/stx2+/eaeA+). The E. coli strain MG1655 was used as a negative control for virulence genes. Details of the primers and the length of the expected amplification product are listed in Table 1.
Table 1.

Oligonucleotide Primers Used in this Study

ReferencesAnnealing temp (°C)Size (bp)Primer sequence (5’-3’)Target gene
1555518GAGCGAAATAATTTATATGTGTGATGATGGCAATTCAGTAT stx
1658180TAAATCGCCATTCGTTGACTACAGAACGCCCACTGAGATCATC stx 1
1660255GGCACTGTCTGAAACTGCTCCTCGCCAGTTATCTGACATTCTG stx 2
1857219CACGTTACAGCGTGTTGCACGCCCACTGAGATCATCC stx 1a
1754498TTTTCACATGTTACCTTTCCTCATAGAAGGAAACTCATTAGG stx 1c
1857192CTTTTCAGTTAATGCGATTGCTAACCCCATGATATCGACTGC stx 1d
1855969AGATATCGACCCCTCTTGAAGTCAACCTTCACTGTAAATG stx 2a
1960251AAATATGAAGAAGATATTTGTAGCGGCCAGCAAATCCTGAACCTGACG stx 2b
1755124GCGGTTTTATTTGCATTAGTAGTACTCTTTTCCGGCCACT stx 2c
1758175GGTAAAATTGAGTTCTCTAAGTATCAGCAAATCCTGAACCTGACG stx 2d
1756267ATGAAGAAGATGTTTATAGCGTCAGTTAAACTTCACCTGGGC stx 2e
1960424TGGGCGTCATTCACTGGTTGTAATGGCCGCCCTGTCTCC stx 2f
1962573CACCGGGTAGTTATATTTCTGTGGATATCGATGGCAATTCAGAATAACCGCT stx 2g
1259279GACGAACCAACGGTCAGGATTGCCGCCAGTACCAAAGACA chuA
1259211TGAAGTGTCAGGAGACGCTGATGGAGAATGCGTTCCTCAAC YjaA
1259152CTGGCG AAAGACTGTATCATCGCGCCAACAAAGTATTA CGTspE4.C2
24611551GGTGCAGCAGAAAAAGTTGTAGTCTCGCCTGATAGTGTTTGGTA ehxA
21611177AACAAGGATAAGCACTGTTCTGGCTACCATATAAGCGGTCATTCCCGTCA hylA
2357119CGTGATGAACAGGCTATTGCATGGACATGCCTGTGGCAAC saa
2357827CTGGCGGAGGCTCTGAGATCATCCTTAAGCTCCCGCGGCTGA iha
22651087CAGGTCGTCGTGTCTGCTAAATCAGCGTGGTTGGATCAACCT eaeA
2058259CGGACATCCATGTGATATGGTTGCCTATGTACAGCTAATCCO157
2058609CCATCAACAGATTTAGGAGTGTTTCTACCGCGAATCTATCO145
2058406TAGAGAAATTATCAAGTTAGTTCCATAGTTATGAACATCTTGTTTAGCO111
2058291GCTGACCTTCATGATCTGTTGATAATTTAACCCGTAGAATCGCTGCO91
2058289GCTTTCTGCCGATATTTGGCCCGACGGACTGATGCCGGTGATTO128
2058527CCGGGTTTCGATTTGTGAAGGTTGCACAACAGCCACTACTAGGCAGAAO45
2058321TTGGAGCGTTAACTGGACCTGCTCCCGAGCACGTATAAGO103
2058423CAGAATGGTTATGCTACTGTCTTACATTTGTTTTCGGCATCO26
Identification of subtype genes We used PCR method for determination of stx1 and stx2 subtypes. PCR for detection of stx1a, stx1c, stx1d, stx2a, stx2b, stx2c, stx2d, stx2e, stx2f and stx2g subtypes was carried out by methods described previously (17-19) (Table 1). Identification of serogroup genes Furthermore, PCR assay was used for the identification of O157, O145, O103, O26, O111, O91, O128 and O45 as described by Hemmatinezhad et al. (20) (Table 1). Identification of virulence genes The presence of following virulence genes ehxA, eae, hylA, iha and saa were detected by PCR assay (21-24) (Table 1). Determination of STEC strains phylogenetic groups Strains assigned to one of the four main phylogenetic group of E. coli (A, B1, B2 and D) by using a PCR-based method as described previously (12). The genomic DNA of bacterial strains amplified by triplex-PCR using primers targeted at three markers, chuA, yjaA and TspE4.C2. Oligonucleotide Primers Used in this Study Statistical analysis SPSS version 15.0 software for Windows (SPSS Inc., Chicago) was used for statistical analysis. P values of less than 0.05 were considered to be significant.

Results

Among 671 E. coli isolates isolated from healthy farm calves, goats and patients with sign of diarrhea, 79 strains were positive for the presence of stx gene and identified as STEC. Among STEC strains 41 strains were positive in claves, 33 strains in goats and 5 strains in human samples. Our results showed that 54 (68.4%) of the strains carried stx1 only, 4 (5.1%) contained stx2 only, and 21 (26.6%) possessed both stx1 and stx2. Two stx1 subtypes (stx1a and stx1c) and four stx2 subtypes (stx2a, stx2b, stx2c and stx2d) were detected with a total of 13 different stx1 and stx2 subtypes combinations as shown in Table 2. Among the subtypes, stx1c was detected in 56 strains, followed by stx1a (25 strains), stx2b (20 strains), stx2c (19 strains) and stx2a (1 strain). In addition, stx2d (11 strains) was detected only in combination with other stx genes (Table 2). There was no correlation between stx subtypes and animal sources (P≤0.05).
Table 2

Summary of stx subtyping in 79 non O157-STEC strains isolated from calves, goats and human fecal samples

No (%) of strainssource
stx subtype
humanscalvesgoats stx 1a stx 1c stx 2a stx 2b stx 2c stx 2d
35 (44.3)22013-+----
16 (20.3)169+-----
8 (10.1)044-+-+++
5 (6.3)050-+-++-
5 (6.3)023++----
2 (2.5)200---+--
2 (2.5)020++-+++
1 (1.3)001+---+-
1 (1.3)010-+-+--
1 (1.3)001+-+---
1 (1.3)001---++-
1 (1.3)010---+++
1 (1.3)001----+-
Total= 795413325561201911

No = Number of non O157-STEC strains, % = percent of non O157-STEC strains; ‒ = negative, + = positive.

Summary of stx subtyping in 79 non O157-STEC strains isolated from calves, goats and human fecal samples No = Number of non O157-STEC strains, % = percent of non O157-STEC strains; ‒ = negative, + = positive. Distribution of STEC in phylogenetic groups from calves, goats and human fecal samples NO = Number of STEC strains isolated from calves, goats and human fecal samples, % = percent of STEC strains isolated from calves, goats and human fecal samples The STEC strains were further tested for five putative virulence factors, including eaeA, hlyA, iha, ehxA and saa. Out of 79 strains, 49 (62%) carried at least one virulence gene tested. The ehxA was detected in 36 (45.6%), eaeA in 4 (5.1%), iha in 5 (6.3%), hlyA in 2 (2.5%) and saa in 2 (2.5%) of the isolates. Phylogroup B1 was the most prevalent (62/79; 78.5%) among the STEC strains, followed by phylogroups A (12/79; 15.2%) and D (5/79; 6.3%). As shown in Table 3, all isolates of human origin belonged to the D Phylogroup. In this study, phylogenetic group B2 was not detected in STEC strains.
Table 3

Distribution of STEC in phylogenetic groups from calves, goats and human fecal samples

Phylogenetic groupNo. (%) of STEC strains isolated from
Total
humanscalvesgoats
A0 (0)6 (14.6)6 (18.2)12 (15.2)
B10 (0)35 (85.4)27 (81.8)62 (78.5)
B20 (0)0 (0)0 (0)0 (0)
D5 (100)0 (0)0 (0)5 (6.3)

NO = Number of STEC strains isolated from calves, goats and human fecal samples, % = percent of STEC strains isolated from calves, goats and human fecal samples

Serogroup analysis showed that none of the isolates belonged to O45, O103, O111, O128, O145 and O157 serogroups, while O26 and O91 were detected in two (clave and goat) and one (clave) isolate, respectively.

Discussion

STEC can be found in various food sources, transmission of this pathotype from undercooked or unpasteurized animal products to human is problematic (1, 10). It is estimated that STEC to cause more than 265,000 illnesses each year in the USA, with more than 3,600 hospitalizations and 30 deaths (25). In the present study, STEC strains were isolated just from 1.2% of patients with diarrhea which was consistent with previous studies (26-28). According to a survey, high variability of genes-encoding stx was detected in the E. coli isolates in HIV and thalassemia patients in Kerman, south-east of Iran. Among E. coli isolates from faecal samples, 30.8% isolates were positive for stx genes (34). However, 26.8% of E. coli isolated from goats and calves carried at least one of the stx genes. This frequency was, lower compared to reports from Spain and Brazil (37% and 44%) (29, 30), but higher from results reported in Iran (8.5%) (31). Another study from West Azerbaijan province in Iran revealed that 21.92% of the E. coli isolates recovered from fecal healthy calves harbored stx genes (32). These variations may likely be due to geographical and climatic conditions and differences in the natural intestinal flora present in animal’s gastrointestinal tract (33). In STEC strains characterized in this study, stx1 was the most common stx gene identified, a result which is similar to previous reports (31, 34). In contrast, some studies have detected stx2 as a dominant stx gene in fecal samples of animals (35, 36). Although, this variant mainly found in strains isolated from healthy human carriers and most likely does not cause severe diseases in human (36). In the present study, stx1c was the predominant variant among the STEC strains isolated. Stx1c Subtype has also frequently been reported in previous studies (5, 37). However, stx1c-encoding strains are associated with asymptomatic human carriage or mild illness (38). Stx2c and stx2d are associated with HUS. However, they are less toxic on Vero cells compared to stx2a. STEC strains with stx2a are associated with several clinical symptoms, such as HUS and HC (39). Stephan and Hoelzle suggested that stx2b was not associated with severe human diseases, because most strains carrying stx2b were isolated from healthy human carriers (40). In the present study, two strains carrying only stx2b were isolated from human and it was possible that these two STEC strains were not the main causative agent of diarrhea. In this study, two strains isolated from calves carried 5 subtypes of stx1a, stx1c, stx2b, stx2c, stx2d simultaneously. The combination of five stx genes in one isolate had not been previously reported. In the study of Bertin et al. strains with a combination of stx1 and/or stx2 subtypes were found to be more toxic toward Vero cells than other strains (41). In our study, other stx2 subtypes such as stx2e, stx2f and stx2g were not found. These subtypes are related to animal infections (42). In addition, we studied the distribution of eight important serotypes in the above isolates which associated more frequently with HUS and HC. None of the isolates belonged to O45, O103, O111, O128, O145 and O157 serogroups, while O26 and O91 were detected in two and one isolates respectively. This finding is in agreement with the failure to find these serotypes in yaks and cattle (8, 43). It seems that in some regions, ruminants are not important reservoirs for the outbreak isolates. Although, human infections with stx-producing E. coli O26 is uncommon and has resulted in less severe illness, but is a major cause of HUS in Europe continent (44). In this study, only four strains contained eaeA gene; however, none of the isolates carried the stx2 subtypes. The low frequency of the eaeA gene found in the present study may be related to the low frequency of certain serogroups, as it has been reported that the presence of the eaeA gene is associated with specific O serogroups of STEC, such as the O157, O145, O103, O26, and O111 (33). Since the majority of the STEC strains lacked eaeA gene, we investigated other factors associated with adherence including iha and saa. These two virulence factors have been reported to be highly important for pathogenicity of eae-negative STEC strains (8). Only 2.5% and 6.35% of strains were positive for saa and iha respectively. It is possible that other virulence factors, that were not investigated in the present study like lpfa and paa play important role in the adherence of STEC strains. Also, we detected ehxA and hlyA genes in 45.6% and 2.5% of strains respectively. Overall, the frequency of virulence factors in STEC isolates was lower than that observed in other studies (8, 45). Carriage of stx gene positive E. coli isolates in the gastrointestinal tract of healthy ruminants proposes that these are transient commensal bacteria in these animals and the virulence genes of these isolates were either not or very poorly expressed (32). Investigation on STEC phylogroups indicated that majority of commensal and diarrhogenic strains are belonged to group B1 and A, while extra intestinal E. coli strains belong mainly to group B2 and D (46). In this study, phylogenetic group B2 were not detected in STEC isolates, which was consistent to previous study (46). However, like in many studies, phylogenetic group B1 was predominant among isolates from animals (47, 48). All of the human strains belonged to phylogenetic group D2, while it was not found in strains isolated from animals. In conclusion, although STEC strains were widespread among healthy domestic animals in the southeast of Iran, prevalence of STEC in patient with diarrhea was low and most of the STEC strains did not belong to O serogroups that are commonly associated with severe disease in humans. Furthermore, these strains were mainly belonged to phylogenetic group B1. These facts together with the high prevalence of stx1c, stx2b, stx2c subtypes and low prevalence of stx2a, suggest that most of STEC in Iranian calves and goats may not pose a serious public health concern.
  40 in total

1.  Rapid and simple determination of the Escherichia coli phylogenetic group.

Authors:  O Clermont; S Bonacorsi; E Bingen
Journal:  Appl Environ Microbiol       Date:  2000-10       Impact factor: 4.792

2.  Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine.

Authors:  Toni A Chapman; Xi-Yang Wu; Idris Barchia; Karl A Bettelheim; Steven Driesen; Darren Trott; Mark Wilson; James J-C Chin
Journal:  Appl Environ Microbiol       Date:  2006-07       Impact factor: 4.792

3.  Stx2 subtyping of Shiga toxin-producing Escherichia coli isolated from cattle in France: detection of a new Stx2 subtype and correlation with additional virulence factors.

Authors:  Y Bertin; K Boukhors; N Pradel; V Livrelli; C Martin
Journal:  J Clin Microbiol       Date:  2001-09       Impact factor: 5.948

4.  Characterization of shiga toxin type 2 variant B-subunit in Escherichia coli strains from asymptomatic human carriers by PCR-RFLP.

Authors:  R Stephan; L E Hoelzle
Journal:  Lett Appl Microbiol       Date:  2000-08       Impact factor: 2.858

5.  Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx(1c)) in Escherichia coli strains isolated from humans.

Authors:  Wenlan Zhang; Martina Bielaszewska; Thorsten Kuczius; Helge Karch
Journal:  J Clin Microbiol       Date:  2002-04       Impact factor: 5.948

6.  Prevalence and genetic profiles of Shiga toxin-producing Escherichia coli strains isolated from buffaloes, cattle, and goats in central Vietnam.

Authors:  Hung Vu-Khac; Nancy A Cornick
Journal:  Vet Microbiol       Date:  2007-07-28       Impact factor: 3.293

7.  Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination.

Authors:  Camila Carlos; Mathias M Pires; Nancy C Stoppe; Elayse M Hachich; Maria I Z Sato; Tânia A T Gomes; Luiz A Amaral; Laura M M Ottoboni
Journal:  BMC Microbiol       Date:  2010-06-01       Impact factor: 3.605

8.  Escherichia coli O157:H7 and non-O157 Shiga toxin-producing E. coli in healthy cattle, sheep and swine herds in Northern Spain.

Authors:  B Oporto; J I Esteban; G Aduriz; R A Juste; A Hurtado
Journal:  Zoonoses Public Health       Date:  2008       Impact factor: 2.702

9.  Shiga toxin-producing Escherichia coli (STEC) isolated from healthy dairy cattle in southern Brazil.

Authors:  Cecília N Moreira; Murilo A Pereira; Claudiomar S Brod; Dália P Rodrigues; José B Carvalhal; José A G Aleixo
Journal:  Vet Microbiol       Date:  2003-05-29       Impact factor: 3.293

10.  Relationship between phylogenetic groups, genotypic clusters, and virulence gene profiles of Escherichia coli strains from diverse human and animal sources.

Authors:  Satoshi Ishii; Katriya P Meyer; Michael J Sadowsky
Journal:  Appl Environ Microbiol       Date:  2007-07-20       Impact factor: 4.792

View more
  6 in total

1.  Prevalence and antibiotic resistance profile of Shiga toxin-producing Escherichia coli isolated from diarrheal samples.

Authors:  Farzad Esavand Heydari; Mojtaba Bonyadian; Hamdallah Moshtaghi; Masoud Sami
Journal:  Iran J Microbiol       Date:  2020-08

2.  Risk factors associated with E. coli causing neonatal calf diarrhea.

Authors:  Safaa Abd El-Moneim Mohammed; Sherif Abd El-Moneimb Marouf; Ahmed M Erfana; Jakeen Kamal Abd El-Haleem El-Jakee; Ashgan M Hessain; Turki M Dawoud; Saleh A Kabli; Ihab M Moussa
Journal:  Saudi J Biol Sci       Date:  2018-07-20       Impact factor: 4.219

3.  High Prevalence and Persistence of Escherichia coli Strains Producing Shiga Toxin Subtype 2k in Goat Herds.

Authors:  Xi Yang; Qian Liu; Xiangning Bai; Bin Hu; Deshui Jiang; Hongbo Jiao; Liangmei Lu; Ruyue Fan; Peibin Hou; Andreas Matussek; Yanwen Xiong
Journal:  Microbiol Spectr       Date:  2022-08-08

4.  Molecular identification of diarrheagenic Escherichia coli pathotypes and their antibiotic resistance patterns among diarrheic children and in contact calves in Bahir Dar city, Northwest Ethiopia.

Authors:  Mequanint Addisu Belete; Tiliksew Bialfew Demlie; Wagaw Sendeku Chekole; Tesfaye Sisay Tessema
Journal:  PLoS One       Date:  2022-09-28       Impact factor: 3.752

5.  Age related differences in phylogenetic diversity, prevalence of Shiga toxins, Intimin, Hemolysin genes and select serogroups of Escherichia. coli from pastured meat goats detected in a longitudinal cohort study.

Authors:  Eunice Ndegwa; Aber Alahmde; Chyer Kim; Paul Kaseloo; Dahlia O'Brien
Journal:  BMC Vet Res       Date:  2020-07-30       Impact factor: 2.741

6.  Molecular characterization of pathogenic Escherichia coli isolated from diarrheic and in-contact cattle and buffalo calves.

Authors:  Walid S Awad; Amr A El-Sayed; Faten F Mohammed; Noha M Bakry; Nadra-Elwgoud M I Abdou; Mohamed S Kamel
Journal:  Trop Anim Health Prod       Date:  2020-07-10       Impact factor: 1.893

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.