Risk factors associated with E. coli causing neonatal calf diarrhea.

Calf diarrhea is one of the major health challenges in cattle herds. The bacteriological examination of fecal samples collected from apparently healthy and diarrheic calves' revealed isolation of 26 E. coli isolates out of 56 calves with an incidence of 46.4%. Serogroups O1, O26, O44, O55, O115, O119, O125, O146, and O151 were identified from the collected fecal samples. Using PCR all isolates was positive for ompA gene species specific for E. coli. While stx1 and eaeA genes detected with incidence of 3.8 and 19.2% respectively from the isolates. The presence of stx2 gene was negative in the fecal isolates. Among colostrum samples 4 E. coli isolates were detected and serogrouped to O26, O55 and O119. They were negative for eaeA, stx1 and stx2 except strain number 4 (O55) was positive for stx1. E. coli strains were sensitive to norfloxacin (80.7%) and resistant to ampicillin and cefotaxime (100% each). Based on our findings, there was no association between occurrence of E. coli and age of calf (2-14 days), while bottle feeding calf colostrum may be a source of E. coli contamination.

Introduction

The occurrence of risk for calf diarrhea and mortality has been reported by Windeyer et al., 2014. Enterotoxigenic E. coli was isolated from diarrheic calves by many authors worldwide (Dereje, 2012, Masud et al., 2012). Calf diarrhea is result from multifactorial: incorrect management of calves; feeding, age, and animal breed were the most important risk factors of death rate (Muluken et al., 2017). Ashenafi and Tesfaye (2016) isolated Escherichia coli from diarrheic calves, and determined risk factors associated with its isolation. They concluded that younger age and low colostrum feeding were significantly associated with E. coli isolation. The occurrence of E. coli was lower in the milk stored and transported in stainless steel containers (Nigatu et al., 2017). Awosile and Smith (2017) recorded that shedding of cephalosporin-resistant E. coli may be caused by waste milk feeding in calves. Benavides et al. (2018) detected extended spectrum betalactamase producing Escherichia coli in bats and domestic animals. A strategy to control calf mortality must start with a confirmed diagnosis of the causative agents and study the risk factors associated with diarrhea. The present investigation was aimed to study occurrence of E. coli and the risk factors associated with diarrhea in dairy farms.

Materials and methods

Animals for sampling

This study was conducted in 3 dairy farms in El-Fayoum governorate from November 2015 to April 2016 to estimate the prevalence of E. coli from calf's scours up to 3 months of age and assessment of risk factors associated with calf diarrhea as well as antimicrobial sensitivity testing. A total of 56 fecal samples were collected from 26 calves suffering from diarrhea and 30 apparently healthy calves in contact with diseased animals selected from different private farms in El-Fayoum farms. As well as 33 colostrum samples were collected from farm number 3 (had high number of diarrheic calves). Samples were collected under complete aseptic condition and transported in ice box as soon as possible to the lab to detect E. coli.

Identification of E. coli isolates

Isolation and identification of E. coli among the collected samples were confirmed on the basis of their morphology, cultural and biochemical tests using standard bacteriological procedures described by Quinn et al., 2002, Murrary et al., 2003. Serological identification of E. coli isolates was conducted at Serology Unit, Animal Health Research Institute, Dokki using polyvalent group specific antisera and Monovalent group specific antisera (Mast assuretm pathogenic Escherichia coli “O” antisera).

Procedure for PCR

Extraction of DNA was carried out according to QIAamp DNA mini kit instructions.

Specific sequence oligonucleotide primers were used to amplify a specific product as shown in Table 1. Agarose gel electrophoreses was prepared according to Sambrook et al. (1989) and the data was analyzed through computer software.

Table 1

Oligonucleotide primers sequences.

Reference	Amplified product	Primer sequence5′–3′	Genes
Ewers et al. (2007)	919 bp	AGCTATCGCGATTGCAGTG	ompA
		GGTGTTGCCAGTAACCGG
Bisi-Johnson et al. (2011)	248 bp	ATG CTT AGT GCT GGT TTA GG	eaeA
		GCC TTC ATC ATT TCG CTT TC
Dipineto et al. (2006)	614 bp	ACACTGGATGATCTCAGTGG	stx1
		CTGAATCCCCCTCCATTATG
	779 bp	CCATGACAACGGACAGCAGTT	stx2
		CCTGTCAACTGAGCAGCACTTTG

Management of risk factors among the investigated farms

The risk assessment of the farms was generated through a questionnaire and direct observations. The questionnaire was investigated the following:

Herd size, vaccination, calf separation, usage of antibiotics to treat diarrhea, calf separation, calf mortality, diarrhea color, diarrhea duration, presence of calving stable, cleaning and disinfecting calving stable after calving, use of calving stable for animals, cleaning and disinfecting of obstetric material, cleaning and disinfecting of hands, cleaning and disinfecting rear of cows, immediate separating calf from cow after calving, cleaning and disinfecting of calf box after each calf, contact between weaned and un weaned calves, herd clothes are being used for visitors, use of one bucket per calf, milk type.

Antibiogram sensitivity test of E. coli

Antibacterial susceptibility testing of the isolates was carried out by Kirby-Bauer disk diffusion assay using standard procedures of National committee for clinical laboratory Standard (1998). Ampicillin (AM 10 µg), cefotaxime (CTX 30 µg), clindamycin (DA 2 µg), gentamicin (CN 10 µg), kanamycin (K 30 µg), neomycin (N 30 µg), norfloxacin (NOR 10 µg) and trimethoprim-sulfamethoxazole (STX 25 µg) discs from Oxoid were used. Results were recorded and compared with the interpretation of zone of inhibition in agar diffusion method according to CLSI (2017).

Results

Occurrence of E. coli among the examined farms

Fecal samples were obtained from 30 clinically healthy calves and 26 calves had signs of diarrhea at the time of sampling. The animal population comprised 65.2% males and 34.7 females. 14.3% of calves were between 1 and 14 days of age, 28.6% between 15 and 28 days of age, and 57.1% older than 28 days of age. The occurrence of diarrhea varied markedly between herds, age of occurrence and month of birth.

Among the examined fecal samples 26 E. coli isolates were identified and serogrouped to O1, O26, O44, O55, O115, O119, O125, O146 and O151 Table 2.

Table 2

Occurrence of E. coli in different farms samples.

Farm No	Status of animals	No of the examined samples	E. coli positive samples		Serogroups
		No	NO	%
Farm 1(20 calves)	App. healthy	10	3	30	O125 and O55
	Diseased	10	1	10
Farm 2(12 calves)	App. healthy	8	4	50	O26, O115, and O146
	Diseased	4	2	50
Farm 3(24 calves)	App. healthy	12	7	58	O119, O151, O1 and O44
	Diseased	12	9	75
Total (56 calves)		56	26	466

Antimicrobial sensitivity test among E. coli isolates recovered from calves

Table 3 recorded that all isolates (100%) were resistant to ampicillin and cefotaxime while 76.9% were sensitive to norfloxacin & gentamicin (each).

Table 3

Results of antimicrobial sensitivity test among E. coli isolates recovered from calves.

Antimicrobial group	Antimicrobial agent	S		I		R
		n	%	n	%	n	%
Penicillin	Ampicillin	–	–	–	–	26	100
Aminoglycosides	GentamicinKanamycinNeomycin	20,121	76.946.23.8	1113	3.83.850	51,312	19.25046.2
Cephalosporins	Cefotaxime	–	–	–	–	26	100
Lincosamide	Clindamycin	1	3.85	1	3.85	24	92.3
Quinolone	Norfloxacin	20	76.9	1	3.8	5	19.2
Sulfonamides	Trimethoprim-Sulfamethoxazole	8	30.8	2	7.7	16	61.5

Virulence factors among E. coli isolated:

Among fecal samples

The isolates were examined using multiplex PCR to detect ompA, stx1 and stx2 genes. All 26 isolates were positive for ompA gene species specific for E. coli (100%). Only one isolate had stx1 gene 1 (3.8%). No isolate had stx2 gene. Among eaeA, attaching and effacing gene, 5 E. coli isolates (19.2%) had eaeA gene as shown in Fig. 1, Fig. 2.

Fig. 1

Agarose gel electrophoresis showing amplification of 919 bp fragments for ompA gene from all E.coli isolates and amplification of 614 bp fragments for stx1 gene among strain number 2 isolated from apparently healthy calf from farm number 1 in comparison with DNA marker (QIAGEN).

Fig. 2

Agarose gel electrophoresis showing amplification of 248 bp fragments for eaeA gene among strain number 2 isolated from apparently healthy calf from farm number 1 and strains number 4 and 7 isolated from diarrheic calves from number 2 and strains number, 8 and 14 isolated from diarrheic calves from frame number 3 in comparison with DNA marker (QIAGEN).

Among colostrum samples

Four colostrum samples were positive for E. coli and serogroups O26, O55 and O119. All were positive for ompA gene species specific for E. coli and negative for eaeA, stx1 and stx2 except strain number 4 (O55) was positive for stx1 as shown in Fig. 3.

Fig. 3

Result of eaeA gene (a) and ompA str1 & 2 genes (b) among the colostrum isolates.

Investigate risk factors

Risk factors associated with calf diarrhea Table 4 include age, management, larger herd size was associated with an increased incidence of E. coli causing calf diarrhea.

Table 4

The collected data among the study area (Questionnaire).

Independent variable	Farm1	Farm 2	Farm 3
Farm type	Dairy	Dairy	Dairy – meat
Herd size	240	800	240 – 200
No. of calves	40	150	35
Vaccination	FMD-LSD-IBR-Rota – E. coli Para Influenza – Corona – Clostridium – Pasteurella-		FMD – LSD (pox) – Clostridium
Usage of antibiotics to treat diarrhea	Use rehydration solution orally + Marbocyl injection.	Marbocyl Gentamicin Clamoxyl	Flagyl – florfenicol Streptomycin Gentamicin
Calf mortality	No	Yes	Yes
Diarrhea form	Soft	Soft – watery	Soft – watery
Diarrhea color	Mostly yellow , a little green	Mostly yellow	Mostly yellow
Age of diarrheic calves	2–14 day	2–7 day	2–12 day
Diarrhea duration	1–2 days	1–2 days	1–2 days
Presence of calving stable	Yes	No (close up)	Yes
Cleaning and disinfecting calving stable after calving	Yes	Yes (close up)	Yes
Use of calving stable for animals	Yes	Yes (close up)	No
Cleaning and disinfecting of obstetric material	Yes	Yes	Yes
Cleaning and disinfecting of hands	Yes	Yes	Yes
Cleaning and disinfecting rear of cows	Yes	Yes	eYes
Immediate separating calf from cow after calving	Yes	Yes	No
Cleaning and disinfecting of calf box after each calf	Yes	Yes	Yes
Contact between weaned and un weaned calves	No	No	yes
Clothes are being used for visitors	Yes	No	No
Use of one bucket per calf	Yes	Yes	No
Milk type	Yes	Yes	Bottle hand colostrum
Incidence of E. coli in feces	20%	50%	66%

Discussion

Colibacillosis is an important diseased in newborn calf. Our target is to study the risk factors associated with E. coli among diarrheic calves. The occurrence of E. coli in this study, 26 (46.4%) out of 56 fecal samples is higher than the reports of Masud et al. (2012) 22 (44%), Dereje (2012) 25 (43.1%) and lower than Paul et al. (2010) 76 (76%). This high and low occurrence of E. coli may be due to the difference in study area, age of calves, farm size, and sample size, managements, and hygiene measurements.

Serological test showed the identification of serogroups O1, O26, O44, O55, O115, O119, O125, O146 and O151. Mosaad et al. (2008) reported the percentage of E. coli in diarrheic Frisian calves was 48.4% non O157.

The virulence factors produced by E. coli strains in the examined farms were investigated. The 26 E. coli isolated from the fecal samples ompA, stx1, stx2 and eaeA genes were found with incidence of 100, 3.8, 0 and 19.2% respectively. Among 4 E. coli isolated from colostrum samples only one strain had stx1. It is clear that stx1 was found in 1 isolate (3.8%); while higher percentage 12.7% and 16.1% were recorded by Leomil et al. (2003) and by Salvadori et al. (2003) respectively.

There are association between eaeA gene and the capacity of the E. coli strains to cause human illness (Boerlin et al., 1999). Leomil et al. (2003) reported a frequency of eae carriage of 41.0%, in STEC isolates from calves. Among diarrheic calves shiga toxin producing E. coli had stx genes along with the eae gene (Weiler et al., 1996). Prevalence of STEC in diarrheic claves was 26.3% (41 isolates) and stx1 gene was the most prevalent variant among the isolates (Taghadosi et al., 2018)

From the questionnaire survey, it was clear that E. coli was significantly higher in calves at 2–14 days old. Yeshiwas and Fentahun (2017) concluded that E. coli is one of the most common diseases of newborn calves (9–10 days of age) characterized by watery diarrhea and the affected calves die within 2–3 days. Temesgen, 2004, Dereje, 2012 reported that calves aged between 0–30 days were at great risk of diarrhea and risk decreases with age. Calf diarrhea was apparently higher in medium and large sized dairy farms than small dairy farms (Yeshiwas and Fentahun, 2017).

The questionnaire survey indicated that the prevalence of E. coli was found high in hand (bottle) feeding method colostrum. During bottle fed the colostrums might be contaminated with many environmental pathogens due to careless management systems. The prevalence of E. coli was higher in calf pens having bedding material than without bedding material and in hand feeding source of colostrum than suckling also feeders of colostrum > 24 h than before 6 h (Temesgen, 2004, Amoki, 2001). Milk samples transported under poor hygienic conditions may lead to high health risk to the consumers (Nigatu et al., 2017). The occurrence of E. coli is high in muddy or wet livestock floor (Yeshiwas and Fentahun, 2017).

We concluded that although colostrum feeding to calves is economically benefited it had the risk of dissemination of Escherichia coli to newborn calves.

Mostly diarrheic calves did not receive appropriate treatments (Aggernesh, 2010, Dereje, 2012). Unfortunately, the usage of antibacterial agents for disease prevention and growth promotion of animals has been a widespread habit on our farms. This could result the increase of STEC strain's multidrug resistance population and, contamination of animal food products (Zhao et al., 2001).

To establish the antimicrobial resistance profile, the susceptibility of the isolates to a panel of eight antibacterial agents was determined. The eight antibacterial agents included in this study are ampicillin, cefotaxime, clindamycin, gentamicin, kanamycin, neomycin, norfloxacin and sulphonamid-trimethoprim. These drugs were chosen because they are extensively used in Egypt. Nigatu et al. (2017) recorded that E. coli were resistant to kanamycin streptomycin and tetracycline.

In our study 100% of isolates tested were resistant to more than one of the drugs tested. Ampicillin, cefotaxime and clindamycin showed the highest rates of resistance, 100%, 100% and 92.3% respectively followed by kanamycin (50%), in agreement with Lazaro et al. (1994). The isolates were susceptible to norfloxacin and gentamicin (76.9% each) and less susceptible to kanamycin (46.2%).

The antibiogram study of Yeshiwas and Fentahun (2017) revealed that the E. coli isolates were highly sensitive to tetracycline, sulfamethoxazole, chloramphenicol, streptomycin, oxacillin; less sensitive to amoxicillin, ceftazidime, nitrofurantoin, kanamycin and resistance to cefotaxime, vancomycin.

The high prevalence of antimicrobial resistance in E. coli is due to uncontrolled human and veterinary use of these antimicrobials in Egypt.

E. coli as a leading health problem in the present study suggests the significance of poor hygiene measurements among farms number 2 and 3. Further study should be carried out on large number of animals to investigate microbial causes of calf diarrhea and control measures.