Literature DB >> 29343880

Novel Application of Loop-mediated Isothermal Amplification for Rapid Detection of Gene Translocation.

Ibu Matsuzaki1, Hideto Iguchi1, Yurina Mikasa1, Hiromu Morishita1, Katsuya Okuda1, Keita Nakaguchi1, Yuki Mori1, Yoshifumi Iwahashi1, Kenji Warigaya1, Masakazu Fujimoto1, Fumiyoshi Kojima1, Shin-Ichi Murata1.   

Abstract

Identification of fusion genes in cancer is essential for pathological diagnosis and clinical therapy. Although methods for detection of fusion genes, such as fluorescence in situ hybridization (FISH) and real-time polymerase chain reaction (PCR), have been developed in last two decades, these methods are not ideal for detection of these genetic alterations owing to their high cost and time-consuming procedures. In this study, we developed novel application for detection of gene translocations using loop-mediated isothermal amplification (LAMP). We verified the amplified DNA products of echinoderm microtubule-associated protein-like 4 and anaplastic lymphoma kinase (EML4-ALK), synaptotagmin and synovial sarcoma, X breakpoint (SYT-SSX), and immunoglobulin heavy chain gene and B cell leukemia/lymphoma 2 (IgH/BCL2) by real-time PCR, agarose-gel electrophoresis, and the naked eye after the LAMP procedure. Fusion genes were detected in samples diluted 103 times within 60 min. Because of the advantages of rapid amplification, simple operation, and easy detection without requiring sophisticated equipment or technical skill, LAMP may have potential applications as an on-site analytical approach in hospitals for pathological diagnosis and decision making regarding appropriate therapeutic approachs.

Entities:  

Keywords:  X breakpoint; echinoderm microtubule-associated protein-like 4 and anaplastic lymphoma kinase; synaptotagmin and synovial sarcoma; gene translocation; immunoglobulin heavy chain gene and B cell leukemia/lymphoma 2; loop-mediated isothermal amplification

Year:  2017        PMID: 29343880      PMCID: PMC5765217          DOI: 10.1267/ahc.17024

Source DB:  PubMed          Journal:  Acta Histochem Cytochem        ISSN: 0044-5991            Impact factor:   1.938


Introduction

Identification of specific genomic aberrations in cancers, including point mutations, chromosomal translocations, amplifications, and deletions, is important for pathological diagnosis and establishment of therapeutic approaches. The first report of a specific translocation in human neoplasia was the t(9;22)(q34;q11) rearrangement involving the ABL1 and BCR genes; this fusion yields the Philadelphia chromosome [21]. Fusion genes have been reported in not only hematologic malignancies but also solid tumors [17]. Methods to detect fusion genes are based on fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR), and sequencing. However, these methods are time consuming, expensive, and technically difficult. Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification assay that can be used as an alternative to PCR. This method involves autocycling strand displacement DNA synthesis performed by Bst DNA polymerase. LAMP assays typically use four primers, including two inner primers and two outer primers, which recognize six different regions within the target DNA (Fig. 1). This method has been widely applied in various fields. Commercial kits using LAMP have been developed, some of which have been adopted for routine identification and surveillance of pathogens, including viruses [14], bacteria [27], fungi [19], and protozoa [3]. Additionally, LAMP is a low-cost, high-specificity, efficient, simple, rapid methodology [11].
Fig. 1.

Schematic representation of detection of fusion genes by LAMP assays. A: cDNA from cells lacking a fusion gene cannot react in LAMP assays. B: cDNA from cells having a fusion gene can be analyzed by LAMP assays. The inner primers FIP (BIP) were composed of F1c (B1c) and F2 (B2). The outer primers were F3 and B3. Because dumbbell-like structures cause cyclic reactions, the LAMP reaction synthesizes various products of different sizes. The schematic shows a case of detection of the IgH/BCL2 fusion gene.

We previously reported novel methodology for rapid detection of KRAS mutations using artificial DNAs: peptide nucleic acid (PNA)- and locked nucleic acid (LNA)-mediated LAMP [9]. In this study, we developed a novel application of LAMP for detection of fusion genes. We assessed the EML4-ALK fusion gene, originating from the chromosomal inversion inv(2)(p21;p23), which is associated with non-small cell lung cancer (NSCLC); the SYT-SSX fusion gene, originating from the t(X;18)(p11.2;q11.2) translocation found in human synovial sarcoma; and the IgH/BCL2 fusion gene, originating from the t(14;18)(q32;q21) translocation, a hallmark of follicular lymphoma found in 20–30% of de novo diffuse large B-cell lymphoma.

Materials and Methods

Cell lines

We used 10 human cancer cell lines: H2228, HS-SY-II (HS), TK, HuH-7 (HuH), KTC-1 (KTC), BxPC-3-Luc#2 (Bx), QGP-1 (QGP), HT1197 (HT), RT4, and MCF10A. Details of the cell lines are shown in Table 1. H2228, HS, and TK cells contained the fusion genes EML4-ALK variant 3a, SYT-SSX1, and IgH/BCL2, respectively. We used other cell lines as controls. All cell lines were cultured with appropriate media, according to the manufacturer’s instructions, in a standard humidified incubator at 37°C in an atmosphere containing 5% CO2.
Table 1. 

List of cell lines

Cell lineOriginFusion geneProvider
H2228Pulmonary adenocarcinomaEML4-ALK v3aATCC
HS-SY-II (HS)Synovial sarcomaSYT-SSX1NBRP
TKB-cell lymphomaIgH/BCL2JCRB Cell Bank
HuH-7 (HuH)Hepatocellular carcinomacontrolNBRP
KTC-1 (KTC)Papillary thyroid carcinomacontrolDr. Kurebayashi [13]
BxPC-3-Luc#2 (Bx)Pancreatic adenocarcinomacontrolJCRB Cell Bank
QGP-1 (QGP)Pancreatic adenocarcinomacontrolJCRB Cell Bank
HT1197 (HT)Urothelial carcinomacontrolDS Pharma Biomedical
RT4Urothelial papillomacontrolDS Pharma Biomedical
MCF10A (MCF)Breast epithelial cellcontrolATCC

ATCC: American Type Culture Collection (USA). NBRP: National Bio-Resource Project of the MEXT (Japan). JCRB Cell Bank: Japanese Collection of Research Bioresources Cell Bank (Japan). Dr. Kurebayashi at Kawasaki Medical School (Japan).

FISH analysis

FISH was performed using an EML4-ALK fusion FISH probe (Kreatech, Leica Biosystems, Nussloch, Germany), SYT-SSX break-apart FISH probe (Abbott Molecular, Des Plaines, IL, USA), or IgH/BCL2 fusion FISH probe (Kreatech, Leica Biosystems) following the manufacturers’ instructions. Results were analyzed using a fluorescent microscope (Olympus, Tokyo, Japan) with Metamorph imaging system software (Molecular Devices, Eugene, OR, USA).

Real-time PCR

Total RNA was isolated from cell lines using TRIzol Reagent (Thermo Fisher Scientific). cDNA was synthesized from 2 μg total RNA using the GoScript Reverse Transcription System (Promega, Madison, WI, USA). Primers used for EML4-ALK and SYT-SSX fusion genes were synthesized according to previous reports [1, 30]. Primers for IgH/BCL2 fusion genes were designed using the NCBI Primer-Blast Tool (http://www.ncbi.nlm.nih. gov/tools/primer-blast/). Real-time PCR amplification was performed with a CFX96 C1000 thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) using the following components: 400 nM of each primer (Table 2), 200 μM dNTPs, 0.0325 U/μL Go Taq DNA Polymerase (Promega), 1× SYBR Green I (Sigma, St. Louis, MO, USA), and 1.6 μL synthesized cDNA diluted 100–103-fold.
Table 2. 

Sets of PCR and LAMP primers

PrimersSequence (5'-3')
PCR primers
 EML4-ALK (F)GCATAAAGATGTCATCATCAACCAAG
 EML4-ALK (R)CGGAGCTTGCTCAGCTTGTA
 SYT-SSX1 (F)AGACCAACACAGCCTGGACCAC
 SYT-SSX1 (R)ACACTCCCTTCGAATCATTTTCG
 IgH/BCL2 (F)CAGATGGCAAATGACCAGCA
 IgH/BCL2 (R)CGGGAGGGTCTGTGTTGAAA
 GAPDH (F)GAGTCAACGGATTTGGTCGT
 GAPDH (R)AATGAAGGGGTCATTGATGG
LAMP primers
 EML4-ALK (FIP)TCCATCTGCATGGCTTGCAG-AAAGATGTCATCATCAACCAA
 EML4-ALK (BIP)GCAGAGCCCTGAGTACAAGC-TTGGGGTTGTAGTCGGTC
 EML4-ALK (F3)TTACCAAAACTGCAGACAAG
 EML4-ALK (B3)TTGCCAGCAAAGCAGTAG
 SYT-SSX1 (FIP)TGGTGGTCCAGGCTGTGTTG-AACTACCCACAGGGACAAGG
 SYT-SSX1 (BIP)ACCAGATCATGCCCAAGAAGCC-CCAGATGCTTCTGACACTCC
 SYT-SSX1 (F3)GGTCCAGGTCCTCAGTATCC
 SYT-SSX1 (B3)TGCAGTTGTTTCCCATCGTT
 IgH/BCL2 (FIP)TGAATCTCATGGGTTTAACCA-CTGGGA ATTCCCGATT TAATTC
 IgH/BCL2 (BIP)AGATGGCAAATGACCAGCA-GGCCACGTAAAGCAACTCTCT
 IgH/BCL2 (F3)CTTGTTTCTTGA AGGTTTCCTCG
 IgH/BCL2 (B3)CGGGAGGGTCTGTGTTGAAA
Real-time PCR cycling conditions were as follows: 95°C for 3 min; followed by 45 cycles of 95°C for 10 sec, annealing of primers for 20 sec at annealing temperatures of 60°C for EML4-ALK and SYT-SSX or 56.3°C for IgH/BCL2, and 72°C for 30 sec; followed by a melting curve from 60 to 95°C. Each measurement was performed with three replicates. Data analysis was carried out with CFX Manager software (Bio-Rad Laboratories).

LAMP assay

For LAMP primer design, we used PrimerExplorer V5 software (Eiken Chemical, Japan) and added slight modifications for LAMP reaction optimization. LAMP assays were carried out using 0.2 μM for each outer primer (F3 and B3), 1.6 μM for each inner primer (FIP and BIP; Table 2), 1.4 mM dNTP mixture (Nippon Gene, Tokyo, Japan), 8 U Bst DNA polymerase (Nippon Gene), and 1.6 μL synthesized cDNA diluted 100–103-fold. The total volume of each LAMP reaction was 20 μL. LAMP products were detected using a real-time PCR instrument (CFX96; Bio-Rad Laboratories), by agarose gel electrophoresis, or by the naked eye. When LAMP products were detected using real-time PCR equipment, 6.25 nM YO-PRO-1 (Thermo Fisher Scientific) was added to the mixture before the LAMP reaction. To detect LAMP products by agarose gel electrophoresis, LAMP products were separated by electrophoresis on 1.5% agarose gels and visualized using a Blue/Green LED illuminator (NIPPON Genetics, Tokyo, Japan) with Red Green Direct (NIPPON Genetics). For detection by the naked eye, we added a fluorescent detection reagent (Eiken Chemical) to the samples, and the LAMP products were then observed by the naked eye under UV light after reaction for 50 min. The reaction temperatures were 64.7°C for SYT-SSX and 63.2°C for EML4-ALK and IgH/BCL2, followed by incubation at 95°C for 5 min for deactivation of Bst DNA polymerase.

Results

Detection of fusion genes by FISH and real-time PCR

We confirmed the presence of the EML4-ALK, SYT-SSX, and IgH/BCL2 fusion genes in various cell lines by FISH and real-time PCR (Figs. 2 and 3). The EML4-ALK rearrangement was detected in H2228 cells (Figs. 2A and 3A), the SYT-SSX fusion gene was found in HS cells (Figs. 2C and 3B), and the IgH/BCL2 fusion gene was detected in TK cells by FISH and real-time PCR (Figs. 2E and 3C). No other cell lines contained these fusion genes. Each real-time PCR product was checked by melting curve analysis (data not shown).
Fig. 2.

Detection of gene rearrangements with FISH. A: The EML4-ALK fusion gene in H2228 cells. The arrows indicate the merged red signal (telomeric side of ALK) and green signal (telomeric side of EML4) as a yellow signal. C: SYT-SSX FISH using break-apart probes was positive in HS cells. Arrows indicating split orange and green signals showed the rearrangement of SYT-SSX. E: IgH/BCL2 FISH-positive results in TK cells. Arrows indicate the merged red signal (BCL2) and green signal (IgH) as a yellow signal. B, D, and F: EML4-ALK FISH-negative (B), SYT-SSX FISH-negative (D) and IgH/BCL2 FISH-negative (F) results in HuH cells. Original magnification: 600×.

Fig. 3.

Detection of fusion genes using real-time PCR. Amplification curves obtained from real-time PCR assays for EML4-ALK (A), SYT-SSX (B), and IgH/BCL2 (C). H2228 cells (A), HS cells (B), and TK cells (C) were diluted from 100- to 103-fold.

Detection of fusion genes by LAMP

LAMP products were detected using real-time PCR equipment, agarose gel electrophoresis, and visualization by the naked eye (Fig. 4). LAMP products were produced in samples obtained from cell lines in which rearrangements were detected by real-time PCR and FISH; H2228 cells harbored EML4-ALK, HS cells harbored SYT-SSX, and TK cells harbored IgH/BCL2. Because LAMP assay yielded products of various sizes, the LAMP products appeared as a ladder-like pattern by gel electrophoresis. When a fluorescent detection reagent containing calcein and magnesium ions reacted with LAMP products containing a pyrophosphate ion, the product could be detected by the naked eye. LAMP products were not determined in other cell lines. For each LAMP assay, reaction temperatures ranging from 61°C to 65°C yielded similar results (data not shown). We selected a faster and more sensitive reaction temperature for detection of each fusion gene. These results from the LAMP assay were similar to the results from FISH and PCR assays.
Fig. 4.

Specificity of the LAMP assay. LAMP assays for EML4-ALK (A–C), SYT-SSX (D–F), and IgH/BCL2 (G–I). LAMP products were detected using real-time PCR equipment (A, D, G), agarose gel electrophoresis (B, E, H), and the naked eye (C, F, I). M: size marker, NC: negative control without cDNA.

Comparison of the sensitivity of fusion gene detection by real-time PCR and LAMP

Sensitivity assays for detecting the EML4-ALK rearrangement in cDNA from H2228 cells were performed using real-time PCR and LAMP. The detection limit by real-time PCR was 102-fold diluted cDNA (Fig. 3A), whereas that of LAMP detection was 103-fold diluted cDNA (Fig. 5A). Analysis of the SYT-SSX fusion gene showed that the detection sensitivity was similar to that of EML4-ALK (Figs. 3B and 5B). Notably, the IgH/BCL2 fusion gene could be identified only in 10-fold diluted cDNA from TK cells by real-time PCR (Fig. 3C), but was detectable in 103-fold diluted cDNA by LAMP (Fig. 5C).
Fig. 5.

Sensitivity of the LAMP assay. LAMP assays for EML4-ALK (A), SYT-SSX (B), and IgH/BCL2 (C). H2228 cells (A), HS cells (B), and TK cells (C) were diluted from 100 to 103-fold.

Discussion

Genomic aberrations occur in many cancers [6, 26] and lead to changes in protein expression. Genomic aberrations and abnormal protein expression are useful for pathological diagnosis. Moreover, molecular targeted therapies that target abnormal proteins resulting from gene mutations in cancer cells have become popular in recent clinical strategies for the management of cancers. For example, among patients with colorectal tumors having mutated epidermal growth factor receptor (EGFR), some with mutated KRAS did not benefit from cetuximab, whereas others with wild-type KRAS did benefit from cetuximab [10]. Thus, detection of genomic aberrations may be useful for clinical treatment as well as pathological diagnosis. LAMP is a method for amplifying DNA under isothermal conditions [20]. LAMP can also be applied to target RNA by adding reverse transcriptase in the reaction (RT-LAMP). For example, using AMV reverse transcriptase, LAMP can be carried out under the same conditions as for DNA amplification and has therefore been developed for use in the detection of various pathogens, including RNA viruses [18]. One of the clinical applications of RT-LAMP is the one-step nucleic acid amplification (OSNA) method for the detection of sentinel lymph node metastasis [28]. Based on the advantage of high sensitivity of OSNA assays, these assays have already been used in the clinical setting for the diagnosis of lymph node metastases in breast cancer, colorectal cancer, and gastric cancer in Japan [7, 12, 31]. Previously, we developed a novel methodology for rapid detection of KRAS mutations using artificial DNAs and the LAMP method [9]. In this novel method, we applied two types of artificial DNAs: PNAs and LNAs. The PNA-LNA-mediated LAMP method was able to detect KRAS mutations within a shorter time and with more accuracy than the other conventional methods, including direct sequencing assays and PNA-clamp PCR. Furthermore, the LAMP-based method did not require specialized equipment [9]. There are many genetic fusions in various human malignancies. Approximately 3–7% of patients with lung adenocarcinoma have the EML4-ALK fusion oncogene [8, 22, 23]. More than 95% of patients with synovial sarcoma have the translocation t(X;18)(p11;q11), which involves the gene on chromosome 18q11 and almost always the , SSX2, or SSX4 gene on chromosome Xp11. The translocation results in a chimeric transcriptional activator protein [15, 16, 25]. Eighty-five percent of follicular lymphomas and 20–30% of diffuse B-cell lymphomas contain the t(14;18) translocation. This rearrangement involves a translocation of the BCL2 locus at chromosome segment 18q21 and the immunoglobulin heavy chain locus at 14q32, resulting in deregulated expression of Bcl-2 [2, 4, 5, 29]. These fusion genes are generally detected by PCR or FISH. However, the instruments required to perform these assays are expensive. In contrast, LAMP assays can be carried out under isothermal conditions, and LAMP products can be observed with the naked eye under UV light. Therefore, LAMP assays do not require special instruments. In this study, we demonstrated a novel application of the LAMP method, i.e., highly sensitive detection of fusion genes, without the need for any additional materials or equipment, including artificial DNA. Therefore, this method is more cost-effective than both conventional PCR methods and FISH assays. Additionally, this method is highly sensitive, with a detection limit of almost 10−3, and is quick, yielding results within 1 hr. Thus, this method is comparable to PNA/LNA-mediated LAMP. Based on our previous report and current results, LAMP can detect not only gene expression and point mutations but also fusion genes in cancer. We expect that this highly specific, rapid, and cost-effective method will be applicable to clinical samples, such as biopsy, surgical tissue, and cytology samples, to be assessed by on-site analysis in hospitals. Similar to our study, Spinelli et al. found that LAMP was a useful method for detecting gene translocations in acute promyelocytic leukemia [24]. Our study and the study by Spinelli et al. demonstrated that the LAMP method can be widely applied in clinical cytogenetic analysis of various tumors as well as hematopoietic disease. Furthermore, we will be able to detect fusion variants as SYT-SSX1, SYT-SSX2, and SYT-SSX4 at the same time in different tubes using the same cDNA. We believe that we can further improve the diagnostic accuracy for pathological diagnosis and facilitate appropriate decision making for therapeutic purposes in the clinical setting. In summary, we established a new application of LAMP assays for the detection of fusion genes. This method detected cDNA diluted to 103-fold and was more specific, rapid, and practical than previous methods, including real-time PCR. In our future studies, we will detect fusion genes from clinical samples using this method; subsequently, LAMP assays may be shown to be applicable for pathological diagnosis and on-site decision making regarding clinical therapies at hospitals.
  30 in total

1.  Loop-mediated isothermal amplification of DNA.

Authors:  T Notomi; H Okayama; H Masubuchi; T Yonekawa; K Watanabe; N Amino; T Hase
Journal:  Nucleic Acids Res       Date:  2000-06-15       Impact factor: 16.971

Review 2.  Fusions of the SYT and SSX genes in synovial sarcoma.

Authors:  M Ladanyi
Journal:  Oncogene       Date:  2001-09-10       Impact factor: 9.867

Review 3.  Oncogenic drivers, targeted therapies, and acquired resistance in non-small-cell lung cancer.

Authors:  Arjan Gower; Yisong Wang; Giuseppe Giaccone
Journal:  J Mol Med (Berl)       Date:  2014-05-23       Impact factor: 4.599

4.  Loop-mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Salmonella Typhimurium from pork.

Authors:  Chayapa Techathuvanan; Frances Ann Draughon; Doris Helen D'Souza
Journal:  J Food Sci       Date:  2010-04       Impact factor: 3.167

5.  Sentinel lymph node analysis in breast cancer: contribution of one-step nucleic acid amplification (OSNA).

Authors:  Florence Godey; Jean Leveque; Patrick Tas; Gwenola Gandon; Philippe Poree; Habiba Mesbah; Vincent Lavoue; Véronique Quillien; Cécile Bendavid Athias
Journal:  Breast Cancer Res Treat       Date:  2011-10-13       Impact factor: 4.872

6.  The prognostic impact of SYT-SSX fusion type and histological grade in pediatric patients with synovial sarcoma treated according to the CWS (Cooperative Weichteilsarkom Studie) trials.

Authors:  Sabine Stegmaier; Ivo Leuschner; Christopher Poremba; Ruth Ladenstein; Bernarda Kazanowska; Gustaf Ljungman; Monika Scheer; Bernd Blank; Stefan Bielack; Thomas Klingebiel; Ewa Koscielniak
Journal:  Pediatr Blood Cancer       Date:  2016-09-13       Impact factor: 3.167

Review 7.  The impact of translocations and gene fusions on cancer causation.

Authors:  Felix Mitelman; Bertil Johansson; Fredrik Mertens
Journal:  Nat Rev Cancer       Date:  2007-03-15       Impact factor: 60.716

Review 8.  The cancer genome.

Authors:  Michael R Stratton; Peter J Campbell; P Andrew Futreal
Journal:  Nature       Date:  2009-04-09       Impact factor: 49.962

9.  Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of Leishmania infantum in canine leishmaniasis based on cysteine protease B genes.

Authors:  Melek Chaouch; Moez Mhadhbi; Emily R Adams; Gerard J Schoone; Sassi Limam; Zyneb Gharbi; Mohamed Aziz Darghouth; Ikram Guizani; Souha BenAbderrazak
Journal:  Vet Parasitol       Date:  2013-08-03       Impact factor: 2.738

10.  Development and application of loop-mediated isothermal amplification (LAMP) for detection of Plasmopara viticola.

Authors:  Xiangjiu Kong; Wentao Qin; Xiaoqing Huang; Fanfang Kong; Cor D Schoen; Jie Feng; Zhongyue Wang; Hao Zhang
Journal:  Sci Rep       Date:  2016-07-01       Impact factor: 4.379

View more
  1 in total

Review 1.  Loop Mediated Isothermal Amplification: A Promising Tool for Screening Genetic Mutations.

Authors:  Arjuna Srividya; Biswajit Maiti; Anirban Chakraborty; Gunimala Chakraborty
Journal:  Mol Diagn Ther       Date:  2019-12       Impact factor: 4.074

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.