Literature DB >> 29226140

Prevalence of Helicobacter pylori vacA Genotypes and cagA Gene in Dental Plaque of Asymptomatic Mexican Children.

Alejandra Mendoza-Cantú1, Víctor Hugo Urrutia-Baca2, Cynthia Sofía Urbina-Ríos2, Myriam Angélica De la Garza-Ramos3, Martha Elena García-Martínez1, Hilda H H Torre-Martínez4.   

Abstract

The variability in Helicobacter pylori vacA and cagA genes has been related to the progression of the gastrointestinal disease; also the presence of H. pylori in the oral cavity has been associated with periodontal disease in adults, but, in children without dyspeptic symptoms, little is known about this. We evaluated the prevalence of H. pylori and the presence of vacA/cagA genotypes in the oral cavity of Mexican children without dyspeptic symptoms. The gingival status was measured, and dental plaque samples (n = 100) were taken. 38% of children were positive for H. pylori 16S rRNA gene by qPCR. A significant association between H. pylori oral infection and gingival status was observed (P < 0.001). In 34.6% (9/26) of mild gingivitis cases, s1m2 genotype was found, while s1m1 was typed in 50% (3/6) of moderate gingivitis. The cagA prevalence among H. pylori-positive children was 80.8% (21/26), 83.3% (5/6), and 16.7% (1/6) of cases of mild gingivitis, moderate gingivitis, and nongingivitis, respectively (P < 0.001). The s1m1/cagA+ combinational genotype was the most detected in children with gingivitis. Our results suggest that the prevalence of H. pylori and detection of vacA/cagA genotypes-associated gastrointestinal disease in the oral cavity could be related to the progression of gingivitis in asymptomatic children.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29226140      PMCID: PMC5687131          DOI: 10.1155/2017/4923640

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Helicobacter pylori is a Gram-negative species which colonizes gastric mucosa in humans [1]. H. pylori infection is associated with gastrointestinal tract diseases including chronic gastritis, peptic ulcer, mucosa-associated lymphoproliferative disorders, and gastric cancer [2-4]. The global prevalence of H. pylori infection is more than 50%. This prevalence may vary significantly within and among countries, according to geography, ethnicity, age, and socioeconomic factors [5, 6]. It has been reported that H. pylori infection rate is up to 70% in developing countries, while the rates in developed countries and regions, such as Australia and Western Europe, are only 25% and 28%, respectively [7]. Socioeconomic factors also explain a significant proportion of the difference in H. pylori prevalence. In the third National Health and Nutrition Examination Survey conducted in the United States, a 25% prevalence of H. pylori infection was found in children and young adults between 6 and 19 years. In the American population, prevalence was 42%; prevalence was higher in children of a low socioeconomic status, in those whose mothers had a lower education level, and in those living in crowded conditions [8]. O'Rourke et al. evaluated the H. pylori infection in Mexican and American children living on both sides of the Rio Grande (a river that is dividing both countries); a slightly higher prevalence was observed in Mexicans compared to Americans [9]. In a similar study by Goodman et al. they found a seroprevalence of 74% and 56% of Mexican and American women, respectively [10]. The relationship between socioeconomic status and H. pylori infection has been reported too in countries such as Bolivia [11]. Epidemiologic studies have shown evidence that most infections are acquired in childhood, but the specific age of acquisition and the factors associated with its persistence are not clear [12]. In developing countries, 70 to 90% of the population become infected during childhood; in developed countries, a smaller percentage (~10%) of children become infected, and the prevalence of infection increases with age [10]. In Mexico, a seroepidemiological national survey in 1998 found a national prevalence of 66% in the general population, 20% in children younger than one year, 50% in children younger than ten years, and 70% in adults younger than 20 years. There were differences in prevalence, depending on the economic development of the regions (86.1% prevalence in southeastern Mexico, 47.1% in the northeast) [13]. H. pylori infection mainly spreads through consumption of contaminated food and drinks or is transmitted orally. Several studies have evaluated the oral cavity, and H. pylori has been detected in dental plaque and saliva [14-16]. It is known that the presence of H. pylori in the oral cavity is one of the main causes of the reappearance of gastric H. pylori infection and that treatment of oral infection significantly increases eradication of H. pylori infection in the stomach [17]. Nevertheless, the role of dental plaque as an extragastric reservoir in H. pylori transmission is controversial [18-20]. Also, the oral H. pylori infection has been related to oral cavity problems, like gingivitis, periodontitis [21, 22], and recurrent aphthous stomatitis (RAS) [23]. Nisha et al. showed a highly significant association was found between periodontal disease and colonization of H. pylori in dental plaque [24]. H. pylori has many virulence factors that allow establishment, colonization, and damage to the gastric epithelium. An important virulence factor secreted by H. pylori is VacA cytotoxin, which induces vacuolization and cell death in epithelial cells. The encoding vacA gene is present in all H. pylori strains, but it is polymorphic, comprising variable signal regions (type s1 or s2) and midregions (type m1 or m2) [3, 26]. Strains with alleles s1/m1 secrete an active toxin that is associated with the development of peptic ulcers and gastric cancer; also, this region was recently described as a determining factor in cytotoxicity and development of gastric disorders [27]. Some strains of H. pylori produce the CagA cytotoxin, as part of the cag pathogenicity island (PAI), a region of 40 kb DNA encoding about 31 genes that make up a type IV secretion system, which allows the release of oncoprotein CagA directly to the cytosol of gastric epithelial cells [28]. Upon release, CagA leads to dephosphorylation of cellular proteins, changes in morphology, increased cell proliferation, chronic inflammation, and carcinogenesis processes [29]. It is reported that individuals infected with cagA-positive and certain cagA alleles (e.g., cagA1a) have a higher risk of developing the peptic ulcer and gastric cancer [30]. Recently, some studies have evaluated the prevalence of H. pylori cagA and vacA genes in saliva and dental plaque [31-33], but its frequency has not been extensively studied in Mexico. In this study, we evaluated the prevalence of H. pylori and the presence of vacA genotypes and cagA gene in dental plaque of Mexican children without dyspeptic symptoms.

2. Materials and Methods

2.1. Patients

From November to December 2015, one hundred Mexican children (from 3 to 16 years old) from the Back2Back nonprofit organization at Monterrey city, Nuevo León, Mexico, were selected to participate in this study. The exclusion criteria were as follows: (1) current history of antibiotic usage or during the previous two months, (2) systemic disease, (3) dyspeptic symptoms, and (4) history of gastrointestinal diseases. Before selection, the informed consent form was obtained from guardians and authorities, who declared the willingness of children to allow the use of the samples and anonymous data for research purposes, and also this study was approved by The Research Bioethics Committee in Dental Science College at Universidad Autónoma de Nuevo León (UANL).

2.2. Measurement of Gingivitis

The modified gingival index (MGI), defined by Lobene et al., is a noninvasive method (no probing) [34]. The MGI was used to assess gingival inflammation in participants, as follows: (0) normal (no inflammation), (1) mild inflammation (slight change in color, little change in texture) of any portion of the gingival unit, (2) mild inflammation of the entire gingival unit, (3) moderate inflammation (moderate glazing, redness, edema, and/or hypertrophy) of the entire gingival unit, and (4) severe inflammation (marked redness and edema/hypertrophy, spontaneous bleeding, or ulceration) of the gingival unit. The clinical examination was performed by the same observer.

2.3. Sample Collection

Dental plaque was collected with a sterile bamboo skewer by a downward scrape against the vestibular surface (supragingival) of the superior first molar. After that, the sample was suspended in 1.5 ml of trypticase soy broth (TS; Becton Dickinson, Franklin Lakes, NJ) supplemented with 30% (w/v) glycerol for the maintenance of microbial viability and then storage at −70°C, until use.

2.4. DNA Extraction

Dental plaque samples were centrifuged at 12,000 ×g for 2 min, then washed with 0.01 m Phosphate-Buffered Saline (PBS; 0.1 m, pH 7.4), and suspended in 100 μl Tris-EDTA buffer (TE; 10 mM Tris and 1 mM EDTA, at pH 7.4). For enzymatic cell lysis, 10 μl of lysozyme (10 mg/ml) and 10 μl of Proteinase K (10 mg/ml) were added and incubated at 56°C for 30 min. Total DNA was extracted using a High Pure PCR template preparation kit (Roche Diagnostics, GmbH, Mannheim, Germany) according to the manufacturer's recommendations and the DNA concentration was measured at 260 nm in a spectrophotometer (NanoDrop 8000 UV-Vis; Thermo Scientific, Wilmington, DE). The DNA samples were stored at −20°C, until use.

2.5. Detection of H. pylori and cagA Gene by qPCR

The presence of H. pylori and cagA status were assessed by qPCR using primers/probe for 16s rRNA gene and cagA gene, respectively (Table 1). The qPCR primers/probes were designed by IDT PrimerQuest tool (http://www.idtdna.com/primerquest/), DNA sequences were obtained from the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/), and BLAST search (http://blast.ncbi.nlm.nih.gov/) was performed to check the specificity of the primers/probe sequences. The efficiency of primer pairs and probes was evaluated by performing serial dilutions from 0.1 to 100 ng of DNA, and the value of the slope was obtained by simple linear regression analysis (R2); the primers and probes showed ≥95% efficiency values. The qPCR reactions were performed in a 96-well plates containing 12.5 μL of 2x maxima probe qPCR master mix (Thermo Scientific, Carlsbad, California, USA), 0.3 μM primers mix forward/reverse, 0.2 μM probe, and 100 ng of the DNA sample, in free-nucleases water to a final volume of 25 μL; 100 ng of DNA from H. pylori ATCC 700824 or ATCC43504 strains and nuclease-free water were added as positive and negative control, respectively. The qPCR assay was carried out in a LightCycler 480II thermocycler (Roche, Mannheim, Germany). The thermocycler was programmed with a monocolor hydrolysis probe format (6-FAM, filter combination 465–510) as follows: one denaturalization cycle (95°C, 10 min), thirty-five amplification cycles (95°C, 10 s, 4°C/s ramp rate; 55°C, 15 s, 2°C/s ramp rate; 72°C, 15 s, 4°C/s quantification analysis ramp rate), one melting cycle (95°C, 5 s, 4°C/s ramp rate; 65°C, 1 min, 2.2°C/s ramp rate, 97°C with a 5°C continuous acquisition), and one cooling cycle (40°C, 10 s, 1.5°C/s ramp rate).
Table 1

PCR primers and probes used for detection and genotyping of H. pylori.

Gen5′-3′ sequenceProduct size(bp)Reference
16S rRNAF: GATAGTCAGTCAGGTGTGAAATCC196In this study
R: GTTTGCTCCCCACGCTTT
Probe: AAAATCCGTAGAGATCAAGAGGA
cagA F: GACCGACTCGATCAAATAGCA113
R: TTAGCTGAAAGCCCTACCTTAC
Probe: AGTGGTTTGGGTGATGTAGGGCAA

vacA s vacA1F: CTGGT(C/T)TAAAGTCGCACCCTTTGTGC s1: 120s2: 150 Koehler et al. [25]
vacA1R: CAATGGCTGGAATGATCACGGTTGT(A/G)
vacA2F: CAAACACACCGCAAAATCAATCGCCC
vacA m1 m1F1: CAACAATCAAGGCACTATCAA(C/T)TA301
m1R1: CCGCATGCTTTAATGTCATCAG
m1F2: TGGTCCGAGGCGGG(A/C)AAGT
m1R2: TCATCAGTATTTCGCACCACAC
vacA m2 m2F1: TTTGGAGC(C/T)CCAGGAAACATTG102
m2R1: C(C/T)ACACGCCCATCTTGGACAA
m2F2: ACCCTAAA(C/T)AGCAACGCAAGC
m2R2: GACAAAAAGATTCATCGTGCCTT

2.6. Detection of H. pylori vacA Alleles

The vacA gene and “s” and “m” region genotyping was performed by nested PCR using a set of oligonucleotides for each gene fragment, as previously described by Koehler et al. [25]. For the signal region (s) detection, vacA1F/vacA1R and vacA2F/vacA1R oligonucleotides were used in the first and the second amplification rounds, respectively. For the middle region 1 (m1) allele detection in the first round m1F1/m1R1 primers were used; for the second round, m1F2 and m1R2 were used. For middle region 2 (m2), m2F1/m2R1 and m2F2/m2R2 primers were employed in the first and the second runs, respectively (Table 1). All the PCR were prepared using 1x NH4 reaction buffer, 3 mM MgCl2, 10 μM of each deoxynucleoside triphosphate, 0.2 μM of each primer, 2.5 units Taq Polymerase (Bioline USA Inc., Taunton, USA), and 200 ng of DNA up to a final volume of 25 μL. The PCR were carried out in MJ Mini Thermal Cycler (Bio-Rad Lab). The PCR program comprised 1 cycle of initial denaturation (95°C, 5 min), 35 cycles of denaturation (95°C, 1 min), annealing (58°C, 1 min) and extension (72°C, 1 min), and 1 cycle of final extension (72°C, 5 min). For the second amplification round, 1 μl DNA template from the first PCR and 0.2 μM of each primer were used. PCR was performed according to the PCR protocol described above. The PCR products were visualized on 8% (v/v) acrylamide gel (Bio-Rad Lab) in Tris-Borate-EDTA buffer (TBE; 40 mM Tris, 45 mM boric acid, 1 mM EDTA, at pH 7.4). The gel was stained with 1 μg/mL of ethidium bromide solution and transferred to ultraviolet transilluminator (Gel Doc XR+ Imager; Bio-Rad Lab). The sizes of the amplicons were estimated by comparison with a DNA size marker (Quick-Load® 2-Log DNA Ladder; New England Biolabs, MA, USA). 120 bp and 150 bp PCR products corresponded to s1 and s2 alleles, respectively, while 301 bp and 102 bp bands corresponded to m1 and m2 alleles, respectively. H. pylori ATCC43504 strain was used as positive control (Figure 1).
Figure 1

Results of the gel electrophoresis for identification of H. pylori vacA alleles and genotypes in dental plaque samples of Mexican children. (a) Detection of s alleles. Lane M, molecular weight marker 0.1 to 10 kb (BioLabs Inc.); lane 1, positive control (DNA from H. pylori ATCC 43504 s1m1 genotype); lanes 2-3, positive control (DNA from gastric biopsy with H. pylori s2m2 genotype); lane 4, negative control (without DNA); lane 5, s2 allele positive (DNA from sample); lane 6, s1 allele positive (DNA from sample); lane 7, s1 and s2 alleles positive (DNA from sample). (b) Detection of m1 allele. Lane M, molecular weight marker 0.1 to 10 kb (BioLabs Inc.); lane 1, positive control (DNA from H. pylori ATCC 43504 s1m1 genotype); lane 2, negative control (without DNA); lane 3, m1 allele negative (DNA from sample); lanes 4–7, m1 allele positive (DNA from sample). (c) Detection of m2 alleles. Lane M, molecular weight marker 0.1 to 10 kb (BioLabs Inc.); lane 1, positive control (DNA from gastric biopsy with H. pylori vacA s2m2 genotype); lane 2, negative control (without DNA); lanes 3 and 7, m2 allele negative (DNA from sample); lanes 4–6, m2 allele positive (DNA from sample).

2.7. Statistical Analysis

The association between H. pylori oral infection and each nominal variable were determined by the Chi-square and Fisher's exact tests; one-way ANOVA tests, post hoc Tukey tests, or Student's t-tests were used for numeric variables. The P < 0.05 value was considered statistically significant. The data were analyzed using SPSS IBM statistics software v22.0.

3. Results

3.1. The History of Participants and H. pylori Detection

This study was designed to determine the frequency of H. pylori cagA and vacA genes in dental plaque of children from the northeastern Mexico. A total of 100 children without gastric clinical manifestations, 50 males and 50 females ranging in age from 3 to 16 years with an average age of 8.95 ± 3.72, were included. Also, the participants were divided according to the gingival clinical presentation, 59 (59.0%) were diagnosed as no inflammation, 35 (35.0%) were diagnosed as mild inflammation, and 6 (6.0%) were regarded as moderate inflammation (Table 2). Among 41 gingivitis cases, 62.1% (22/35) of mild inflammation cases were male, while 83% (5/6) of moderate inflammation cases were female. A significant difference (P < 0.05) was observed between the mean age of patients with moderate inflammation (4.83 ± 2.04 years old) and those who did not present inflammation (9.47 ± 3.42 years old), as shown in Table 3.
Table 2

Prevalence of H. pylori in dental plaque from Mexican children by gender and age and the gingival clinical presentation.

Total N = 100 H. pylori 16S rRNA gene P value
Positive N = 38Negative N = 52
Gender n (%)
Female50 (50.0)17 (44.7)33 (53.2)0.41a
Male50 (50.0)21 (55.3)29(46.8)
Age
Mean (±SD)8.95 (±3.72)8.37 (±4.17)9.31 (±3.4)0.2425b
Age groups n (%)
3–521 (21.0)12 (31.6)9 (14.5)0.084a
6–833 (33.0)10 (26.3)23 (37.1)
9–1114 (14.0)2 (5.3)12 (19.4)
12–1426 (26.0)12 (31.6)14 (22.6)
15-166 (6.0)2 (5.3)4 (6.5)
MGI n (%)
No inflammation59 (59.0)6 (15.8)53 (85.5)<0.001c
Mild inflammation35 (35.0)26 (68.4)9 (14.5)
Moderate inflammation6 (6.0)6 (15.8)0

aChi-square test. bStudent's  t test. cExact Fisher test. MGI: modified gingival index.

Table 3

Distribution of the gingival clinical presentation by gender and age.

Modified gingival index P  value
No inflammationN = 59Mild inflammationN = 35Moderate inflammationN = 6
Gender n (%)
Female32 (54.2)13 (37.1)5 (83.3)0.078a
Male27 (45.8)22 (62.1)1 (16.7)
Age
Mean (±SD)9.47 (±3.42)8.77 (±4.02)4.83 (±2.04)0.012b
Age groups n (%)
3–58 (13.6)10 (28.6)3 (50.0)0.135a
6–822 (37.3)8 (22.9)3 (50.0)
9–1111 (18.6)3 (8.6)0
12–1414 (23.7)12 (34.3)0
15-164 (6.8)2 (5.7)0

aExact Fisher test. bOne-way ANOVA test.

The detection of H. pylori 16S rRNA gene by qPCR revealed that 38% of samples were positive. Among H. pylori-positive children, 55.3% (21/38) and 44.7% (17/38) were male and female, respectively. The mean age of H. pylori-positive individuals was 8.37 ± 4.17 years (Table 2).

3.2. Relationship between the H. pylori Oral Infection and the Gingival Clinical Presentation

A significant association between H. pylori oral detection and gingival status was observed (P < 0.001). 68.4% (26/38) of H. pylori-positive children shown mild inflammation, while 15.8% (6/38) showed no inflammation; all of the cases of moderate inflammation were positive (Table 2).

3.3. Frequency of H. pylori vacA Alleles and Association of Genotypes with the Gingival Clinical Presentation

The vacA allelic variants were determined in patients with dental plaque H. pylori-positive, as shown in Figure 1. The vacA s1 and m1 alleles were most frequent for the signal and middle region, respectively. The vacA s1m2 genotype was the most common among H. pylori-positive patients, with 28.9% (11/38), followed by s1m1 genotypes with 26.3% (10/38) (Table 4). The coinfection of s1m1 with s2m1 was observed in 13.2% (5/38) of H. pylori-positive samples. In 5.3% (2/38) of patients, the s1 allele was detected, but the m region was undetectable (s1m0); the s2 allele was identified in 1 patient, but the m region could not be identified (s2m0).
Table 4

Distribution of vacA genotypes, cagA status, and combinational vacA/cagA genotypes in dental plaque from H. pylori-positive children with gingival clinical presentation.

TotalN = 38 H. pylori-positive
No inflammationN = 6Mild inflammationN = 26Moderate inflammationN = 6
a vacA alleles  n (%)
s131 (81.6)3 (50.0)22 (84.6)6 (100.0)
s210 (26.3)3 (50.0)6 (23.1)1 (16.7)
m124 (63.2)4 (66.7)15 (57.7)5 (83.3)
m216 (42.1)1 (16.7)13 (50.0)2 (33.3)
m03 (7.9)1 (16.7)2 (7.7)0
vacA genotypes
s1m110 (26.3)1 (16.7)6 (23.1)3 (50.0)
s1m211 (28.9)1 (16.7)9 (34.6)1 (16.7)
s2m16 (15.8)3 (50.0)3 (11.5)0
s1m02 (5.3)1 (16.7)1 (3.8)0
s2m01 (2.6)01 (3.8)0
bs1m1/s1m25 (13.2)04 (15.4)1 (16.7)
bs1m1/s2m13 (7.9)02 (7.7)1 (16.7)
cagA  status
 Positive27 (71.1)1 (16.7)21 (80.8)5 (83.3)
 Negative11 (28.9)5 (83.3)5 (19.2)1 (16.7)
vacA/cagA  genotypes
s1m1/cagA+9 (23.7)1 (16.7)5 (19.2)3 (50.0)
s1m1/cagA1 (2.6)01 (3.8)0
s1m2/cagA+5 (13.2)05 (19.2)0
s1m2/cagA5 (13.2)1 (16.7)3 (11.5)1 (16.7)
s2m1/cagA+4 (10.5)04 (15.4)0
s2m1/cagA3 (7.9)3 (50.0)00
s1m1/s1m2/cagA+4 (10.5)03 (11.5)1 (16.7)
s1m1/s2m1/cagA+3 (7.9)02 (7.7)1 (16.7)
s1m1/s2m1/cagA1 (2.6)01 (3.8)0
cUndetermined3 (7.9)1 (16.7)2 (7.7)0

aFrequency and percentages based on H. pylori-positive patients. bCoexistence of genotypes; cvacA genotypes with m0 alleles; m0: nontypeable for middle region.

The prevalence of vacA genotypes and alleles varied with gingival status. The s2m1 genotype was detected in 50% (3/6) of H. pylori-positive children without gingivitis. In 34.6% (9/26) of mild inflammation cases, s1m2 genotype was found, while s1m1 allele combination was typed in 50% (3/6) of moderate inflammation (Table 4). The coinfection of s1m1/s1m2 was observed only in patients with gingivitis (4 and 1 for mild and moderate inflammation, resp.).

3.4. Association between the Presence of H. pylori cagA Gene and Gingival Clinical Presentation

We found that the prevalence of cagA gene was 27% (27/100). In 71.1% (27/38) of H. pylori-positive samples, cagA gene was detected (Table 4). The cagA gene status has shown a significant relationship with gingival status (P < 0.001). Also, the cagA prevalence among H. pylori-positive children was 80.8% (21/26), 83.3% (5/6), and 16.7% (1/6) of cases of mild gingivitis, moderate gingivitis, and nongingivitis, respectively. The combinational s1m1/cagA+ genotype was detected in 23.7% (9/38) of H. pylori-positive children. The same genotypic combination of vacA/cagA was the most frequent in children with gingivitis (5/26 and 3/6 of cases with mild and moderate gingivitis, resp.), while s2m1/cagA− combinational genotype was most prevalent in children without gingivitis (Table 4).

4. Discussion

It has been demonstrated that H. pylori infection is a risk factor for the development of gastric pathologies, including gastric cancer [4]. Several studies of H. pylori prevalence have shown the strong association with sociodemographic and socioeconomic factors where the developing countries are usually the most affected [8, 10–13]. The gastric infection is mainly acquired during the first years of life, where common symptoms are not present. Several studies have concluded that the high frequency of H. pylori could be due to its multiple mechanisms of transmission, where the oral cavity plays a determinant role as a source of transmission to other hosts and a focus for the continuous gastric reinfection after eradication therapy [14]. However, some researchers do not agree with this approach. In this study, the detection of H. pylori and cagA gene was performed by qPCR. The use of TaqMan qPCR probes would allow accurate identification of H. pylori and would prevent the detection in the oral cavity of other microorganisms that are close phylogenetically to H. pylori, as Campylobacter species [35]. Our results show that 38% of dental plaque samples from children were H. pylori-positive. All participants were apparently healthy and did not report any gastric disease at the time of the evaluation (Table 2). Our results agree with those found by Duque et al. and those reported by Mendoza et al., both studies in Mexican school children, but these reports used urea breath test (UBT) for the diagnosis of infection [8, 36]. The agreement would be attributed to the fact that both diagnosis methods (UBT and PCR) have an estimated sensitivity of 75% to 100%. However, PCR has a higher specificity than UBT due to the presence of other urease-producing microorganisms in the stomach [37]. In 2014, Valdez-Gonzalez et al. evaluated the presence of H. pylori in dental plaques of 40 Mexican children using qPCR, and 35% of the samples were positive [16]. Our results are different from those reported by Castro-Muñoz et al.; they studied 162 asymptomatic Mexican children, and 13% of oral swab sample (from inside cheeks) were positive by PCR [15]. This difference may be due to the site from which samples were collected because the detection rates in dental plaques were more than those in other locations of oral cavity [14]. Zheng and Zhou evaluated the detection rate of H. pylori in subgingival and supragingival plaque samples from adults with/without periodontitis, and they observed a higher detection rate in subgingival plaques than that in supragingival plaques (P < 0.05) [22]. In our study, supragingival plaque samples were taken because it is a noninvasive sampling method (not probing) for children. It is possible that the microaerobic conditions and microbial associations in dental plaque could favor the persistence of H. pylori in the oral cavity, constituting an ideal site for sampling in H. pylori oral detection studies. The presence of H. pylori in oral cavity would provide a foundation for a role in H. pylori transmission. Miyabayashi et al. investigated the effect of oral H. pylori on the stomach. The investigators observed that their patients with oral H. pylori were found to be at a significantly higher risk for gastric reinfection after having received adequate treatment. The authors also determined that drugs used for the eradication of the gastric H. pylori did not affect the oral H. pylori [38]. Most published studies have reported the oral cavity (dental plaque and saliva) as a source for subsequent gastric infections or reinfections in the same patient and as a reservoir for oral-oral transmission [19, 39]. However, some authors suggest that H. pylori is a microorganism transitory in the human oral cavity [40]. The mechanism by which H. pylori reaches the oral cavity is unknown. It is possible that the occasional reflux from the gastric reservoir allows colonization of the oral cavity. It is also possible that the reverse is true. Our results indicate a significant frequency of H. pylori in dental plaque of asymptomatic children where the dental plaque would act as a reservoir for oral-oral dispersal to the population. However, our results cannot confirm the bacterial viability of oral H. pylori nor the ability to transmit to other individuals. This subject requires considerably more investigation due to the fact that the involvement of dental plaque in the transmission of H. pylori can be confirmed and that new measures can be tailored toward the prevention of oral spread. It has been demonstrated that exposure to an H. pylori-positive family is a risk factor for persistence of infection in children under five years. Cervantes et al. followed a large cohort of children throughout the first years of life and concluded that when siblings are close in age, the older sibling may be an important source of H. pylori transmission for younger siblings [41]. In our study, we observed that 31.6% of H. pylori-positive subjects corresponded to the groups of age from 3 to 5 years (12/38) and 12 to 14 years (12/38). The children come from a care center for orphans where the coexistence between the older children and the younger ones would have favored the transmission among the children. However, this possibility could not be confirmed in this study. On the other hand, other studies have reported the familial transmission between parents and children [42, 43]. After many years of research, very little is known about the details of the modes of transmission of H. pylori and its propagation pathways. The primary modes of transmission are thought to be fecal-oral and oral-oral, but some indirect evidence has also been published for transmission via drinking water and other environmental sources [44]. Dental plaque harbors at least 400 different bacterial species and forms a biofilm in which organisms are intimately associated with each other and embedded in an exopolymeric matrix (salivary polymers and microbial extracellular products). This biofilm adheres to supragingival and subgingival tooth surfaces [19]. The accumulation of microorganisms and increased concentration of bacterial metabolites in gingiva induces an inflammatory process, called gingivitis. Gingivitis is one of the first clinical manifestations of the periodontal disease [45]. H. pylori oral infection has been related to oral pathologies, including gingivitis/periodontal disease, aphthous stomatitis, and oral cancer [5]. In this study, a significant relationship between the presence of H. pylori in dental plaque and the gingival clinical presentation was found (Table 2). In 1999, in Great Britain, Riggio and Lennon demonstrated the presence of H. pylori in 11/29 (38%) subgingival plaques of patients with chronic periodontitis. They suggested that, in this patient group at least, subgingival plaque may be a reservoir for H. pylori infection [46]. In 2012, Agarwal and Jithendra found that 60% of the samples were H. pylori-positive by PCR in periodontitis group compared to 15% in without-periodontitis group [47]. In Mexico, there are few reports about this association; De la Garza-Ramos et al. found a relationship between the detection of H. pylori in dental plaque and the depth of the periodontal pockets in adults [48]. It is known that certain genotypes of H. pylori are related to the severity of gastric pathology. Rudi et al. found that H. pylori strains of the vacA s1 allele and the cagA gene are more likely to result in peptic ulcer disease [49]. In Mexico, González-Valencia et al. found that vacA s1 and cagA+ strains were more frequent in adults than in children [50]. Another study, conducted by Martínez-Carrillo et al., confirmed that vacA s1m1 genotypes are the most common in patients with gastric ulcer and chronic gastritis [51]. However, Garza-Gonzalez et al. found that the most frequent genotype was s2m2 in H. pylori isolates from the northeastern region of Mexico, but the s1m1 genotype was associated with cagA-positive strains (P < 0.05) [52]. Our results show that the H. pylori strains with the vacA s1m1 and s1m2 genotypes are predominant in dental plaque from Mexican children without dyspeptic symptoms and agree with most of the ones found in Mexican patients with severe gastric pathology [52, 53]. In another study, the most frequent genotype in the oral cavity and gastric mucosa was vacA s1bm1 [54]. Román-Román et al. found that 47/196 (24%) patients were coinfected (saliva and gastric biopsy). H. pylori vacA s1m1 or s1m2 genotypes (either or both) were detected in 41.5% of the patients with chronic gastritis. The s1m1/s1m2 genotypes, alone or together, were found simultaneously in saliva and gastric biopsy from the same patient [32]. These results and others [33] support our findings; however, as far as we know this is the first study of genotyping vacA in oral samples from Mexican children without dyspepsia symptoms. Otherwise, we found that s1m1/s1m2 genotypes alone or together were mostly detected in participants with mild or moderate gingivitis (Table 4). People infected with H. pylori who have a functional cag-PAI have increased mucosal concentrations of IL8, neutrophilic infiltration into the gastric mucosa, and increased risk of developing the gastric ulcer and cancer [29, 55, 56]; however other researchers did not agree to this [31]. Román-Román et al. conducted a study in a population from Southern Mexico, and they observed an association between H. pylori and the s1m1 genotype with gastric cancer, but cagA was not associated with the diagnosis [57]. In our study, the cagA status was related to the gingival clinical presentation in H. pylori-positive children (P < 0.001). The s1m1/cagA+ or s1m2/cagA+ combinational genotypes alone or together were mostly detected in dental plaque of children with mild or moderate gingivitis. It is possible that these genotypes play a role in the development of periodontal disease in asymptomatic people with poor oral hygiene measures.

5. Conclusions

Our results demonstrate that H. pylori oral infection is frequent among asymptomatic Mexican children and that, in one individual, more than one H. pylori strain may exist in dental plaque. The prevalence of H. pylori and detection of some vacA/cagA genotypes-associated gastrointestinal disease in the oral cavity could be related to the progression of gingivitis in children without dyspeptic symptoms.
  54 in total

1.  Identification by PCR of Helicobacter pylori in subgingival plaque of adult periodontitis patients.

Authors:  M P Riggio; A Lennon
Journal:  J Med Microbiol       Date:  1999-03       Impact factor: 2.472

2.  Helicobacter pylori transiently in the mouth may participate in the transmission of infection.

Authors:  Denise G Silva; Eduardo M B Tinoco; Gifone A Rocha; Andreia Maria Camargos Rocha; Juliana B Guerra; Ivan E B Saraiva; Dulciene M M Queiroz
Journal:  Mem Inst Oswaldo Cruz       Date:  2010-08       Impact factor: 2.743

3.  Influence of oral Helicobacter pylori on the success of eradication therapy against gastric Helicobacter pylori.

Authors:  H Miyabayashi; K Furihata; T Shimizu; I Ueno; T Akamatsu
Journal:  Helicobacter       Date:  2000-03       Impact factor: 5.753

4.  Comparison of Helicobacter pylori prevalence in symptomatic patients in northeastern Mexico with the rest of the country: its association with gastrointestinal disease.

Authors:  Francisco Javier Bosques-Padilla; Rolando Tijerina-Menchaca; Guillermo Ignacio Pérez-Pérez; Juan Pablo Flores-Gutiérrez; Elvira Garza-González
Journal:  Arch Med Res       Date:  2003 Jan-Feb       Impact factor: 2.235

5.  Helicobacter pylori infection in pregnant women from a U.S.-Mexico border population.

Authors:  Karen J Goodman; Kathleen O'Rourke; R Sue Day; Constance Wang; Thomas Redlinger; Armando Campos; Jose Manuel de la Rosa
Journal:  J Immigr Health       Date:  2003-07

6.  Prevalence of virulence-associated genotypes of Helicobacter pylori and correlation with severity of gastric pathology in patients from western Sicily, Italy.

Authors:  A Chiarini; C Calà; C Bonura; A Gullo; G Giuliana; S Peralta; F D'Arpa; A Giammanco
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2008-10-29       Impact factor: 3.267

7.  Functional association between the Helicobacter pylori virulence factors VacA and CagA.

Authors:  Richard H Argent; Rachael J Thomas; Darren P Letley; Michael G Rittig; Kim R Hardie; John C Atherton
Journal:  J Med Microbiol       Date:  2008-02       Impact factor: 2.472

8.  Characterisation of Helicobacter pylori isolates from the north-eastern region of Mexico.

Authors:  E Garza-Gonzalez; F J Bosques-Padilla; R Tijerina-Menchaca; G I Perez-Perez
Journal:  Clin Microbiol Infect       Date:  2004-01       Impact factor: 8.067

9.  Infection with CagA+ Helicobacter pylori strains as a possible predictor of risk in the development of gastric adenocarcinoma in Mexico.

Authors:  J Torres; G I Pérez-Pérez; Y Leal-Herrera; O Muñoz
Journal:  Int J Cancer       Date:  1998-10-29       Impact factor: 7.396

10.  Helicobacter pylori genotyping in gastric adenocarcinoma and MALT lymphoma by multiplex PCR analyses of paraffin wax embedded tissues.

Authors:  C I Koehler; M B Mues; H P Dienes; J Kriegsmann; P Schirmacher; M Odenthal
Journal:  Mol Pathol       Date:  2003-02
View more
  4 in total

1.  Comparing the prevalence of Helicobacter pylori and virulence factors cagA, vacA, and dupA in supra-gingival dental plaques of children with and without dental caries: a case-control study.

Authors:  Aida Mehdipour; Parisa Chaboki; Farzaneh Rasouli Asl; Mohammad Aghaali; Negar Sharifinejad; Saeed Shams
Journal:  BMC Oral Health       Date:  2022-05-09       Impact factor: 3.747

2.  Molecular detection of Helicobacter pylori based on the presence of cagA and vacA virulence genes in dental plaque from patients with periodontitis.

Authors:  Carlos Eduardo Flores-Treviño; Víctor Hugo Urrutia-Baca; Ricardo Gómez-Flores; Myriam Angélica De La Garza-Ramos; María Marisela Sánchez-Chaparro; Mario Alberto Garza-Elizondo
Journal:  J Dent Sci       Date:  2019-03-27       Impact factor: 2.080

3.  Helicobacter pylori prevalence in healthy Mexican children: comparison between two non-invasive methods.

Authors:  Verónica I Martínez-Santos; Manuel Hernández Catalán; Luis Octavio Ojeda Salazar; Octavio Andrei Orozco Gómez; Sandra Ines Lorenzo; Rayver Santos Gómez; Norma S Romero-Castro; Roxana Reyes Ríos; Dinorah Nashely Martinez Carrillo; Gloria Fernández-Tilapa
Journal:  PeerJ       Date:  2021-06-28       Impact factor: 2.984

4.  Helicobacter pylori vacA, cagA and iceA genotypes in dyspeptic patients from southwestern region, Saudi Arabia: distribution and association with clinical outcomes and histopathological changes.

Authors:  Mohammed Akeel; Atef Shehata; Ahmed Elhafey; Erwa Elmakki; Thanaa Aboshouk; Hussein Ageely; Mohammed Mahfouz
Journal:  BMC Gastroenterol       Date:  2019-01-25       Impact factor: 3.067

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.