Literature DB >> 29220350

Deep sequencing of near full-length HIV-1 genomes from plasma identifies circulating subtype C and infrequent occurrence of AC recombinant form in Southern India.

Shuba Varshini Alampalli1, Michael M Thomson2, Raghavan Sampathkumar1, Karthi Sivaraman1, Anto Jesuraj U K J3, Chirag Dhar3, George D Souza4, Neil Berry5, Annapurna Vyakarnam1,6.   

Abstract

India has the third largest number of HIV-1-infected individuals accounting for approximately 2.1 million people, with a predominance of circulating subtype C strains and a low prevalence of subtype A and A1C and BC recombinant forms, identified over the past two decades. Recovery of near full-length HIV-1 genomes from a plasma source coupled with advances in next generation sequencing (NGS) technologies and development of universal methods for amplifying whole genomes of HIV-1 circulating in a target geography or population provides the opportunity for a detailed analysis of HIV-1 strain identification, evolution and dynamics. Here we describe the development and implementation of approaches for HIV-1 NGS analysis in a southern Indian cohort. Plasma samples (n = 20) were obtained from HIV-1-confirmed individuals living in and around the city of Bengaluru. Near full-length genome recovery was obtained for 9 Indian HIV-1 patients, with recovery of full-length gag and env genes for 10 and 2 additional subjects, respectively. Phylogenetic analyses indicate the majority of sequences to be represented by subtype C viruses branching within a monophyletic clade, comprising viruses from India, Nepal, Myanmar and China and closely related to a southern African cluster, with a low prevalence of the A1C recombinant form also present. Development of algorithms for bespoke recovery and analysis at a local level will further aid clinical management of HIV-1 infected Indian subjects and delineate the progress of the HIV-1 pandemic in this and other geographical regions.

Entities:  

Mesh:

Year:  2017        PMID: 29220350      PMCID: PMC5722309          DOI: 10.1371/journal.pone.0188603

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Characterising the genetic composition of HIV-1 circulating in different geographical locales represents a significant undertaking, with implications for vaccine design, treatment efficacy regimes and understanding the molecular epidemiology of transmitted variants in target populations, with group M subtypes (A-K) and circulating recombinant forms (CRFs) comprising the majority of the genotypes in global circulation. HIV-1 clade C infections represent approximately half of the total HIV-1 infections worldwide, being the majority variant in Southern Africa and the Indian subcontinent [1]. HIV-1 clade C therefore represents a significant target for vaccine efforts. We were interested in determining the specific variants of HIV-1 clade C circulating in a cohort of HIV-1-infected individuals in Bengaluru, southern India, using deep sequencing approaches. Previously, whole genome recovery of HIV-1 RNA from plasma using a pan-HIV-1 amplification strategy and next generation sequencing (NGS) and bioinformatics analyses has been reported [2-4], providing fresh insight on HIV-1 variation by taking into account many under-represented HIV-1 variants and recombinant forms in a given host. In this study, we describe modifications of the whole genome amplification protocol described by Gall et al [4] applied to clinically-relevant plasma viruses and a bioinformatics framework in the form of a bespoke pipeline, to amplify HIV-1 genomes from Indian clinical isolates and assemble them reliably post-NGS sequencing. Further, we describe a phylogenetic analysis of these Indian HIV-1 sequences using this pipeline for the first time, as either whole genome sequences or gag genes to determine the relationship with the diversity of HIV-1 clade C infections worldwide.

Materials and methods

Clinical details

This study was conducted according to the principles expressed in the Declaration of Helsinki. This study was approved by the Ethical Review Committee of St. John’s Medical College Hospital, Bengaluru, India (Ref no: 55/2015). Patients were included in this study after obtaining written consent. Relevant clinical information was documented in a pro forma and 30 ml of EDTA-anticoagulated peripheral blood was collected by venipuncture. A total of twenty subjects confirmed HIV seropositive (by the standard HIV I & II ELISA test and western blot) with known CD4+ T-cell counts and plasma HIV viral loads (Roche diagnostics, Germany) were studied (see Table 1). Sixteen out of twenty subjects with no prior history of treatment with antiretroviral drugs [antiretroviral treatment (ART)-naïve] or post-exposure prophylaxis were included and were confirmed to be TB negative. Four out of the twenty HIV positive subjects (SHE001, SC007, SC019 and SC062) were diagnosed with pulmonary and/or extrapulmonary tuberculosis (TB). A diagnosis of pulmonary TB (SHE001) was ascertained by sputum smear microscopy and culture. Standard smear grading of 1+, 2+ and 3+ was used to ascertain the bacterial burden. Smear-negative cases of pulmonary TB cases were diagnosed and classified by the treating clinician from plain chest radiographs as per the Revised National Tuberculosis Control Program (RNTCP) standards. A diagnosis of extra-pulmonary TB (SC007, SC019 and SC062) was established from tissue specimens by Ziehl-Neelsen staining for detection of acid-fast bacilli in tissue samples (obtained as surgical specimens/biopsies/fine-needle aspiration specimens). The RNTCP-approved Nucleic-Acid Amplification Test (NAAT) GeneXpert MTB/Rif of tissue sample was used for confirmation of this diagnosis. Subjects SC007 and SC019 had received treatment for either TB and /or HIV. SC007 was treated for TB (Anti-Tubercular/Tuberculosis Therapy/Treatment (ATT) but ART-naïve) for 52 days, whereas SC019 had completed 6 months of treatment for both TB and HIV prior to blood collection for this study. Of the 20 samples studied, 65% were male; the median age was 33 years (range 24–51); median CD4+ T-cell count at the time of study was 463.5 cells/mm3 (range 99–853); and the median viral load was 103,300 copies/ml (range 5,978–3,330,000 copies/ml). The correlation between CD4+ T-cell count and viral load for each sample is depicted in Figure A in S1 File.
Table 1

Clinical data.

S. No.SampleAgeSexPatient Category and TherapyType and site of TBDate of viral RNA isolationCD4 count (cells/mm3)Viral Load (copies/ml)
1SHE00145MHIV+TB+ (Treatment Naïve)Pulmonary TB, suspected intestinal TB16-04-2015773138000
2SC00726MHIV+TB+ (ATT 52 days and ART-naïve)Extra pulmonary TB, TB lymphadenitis05-05-2015510725000
3SC00849MHIV+ ART-naïveNone20-05-20153892980000
4SC01234FHIV+ ART-naïveNone25-05-201558214100
5SC01330FHIV+ ART-naïveNone28-05-2015510120000
6SC01530MHIV+ ART-naïveNone29-05-201541563000
7SC01745MHIV+ ART-naïveNone01-06-2015475108000
8SC01831MHIV+ ART-naïveNone02-06-20153829010
9SC01934MHIV+TB+ (Treated for both for 6 months)Extra pulmonary TB, Abdominal TB06-02-2015267347000
10SC02242FHIV+ ART-naïveNone08-06-201585339900
11SC02349MHIV+ ART-naïveNone08-06-201558398600
12SC06130FHIV+ ART-naïveNone31-08-201545280900
13SC06251MHIV+TB+ (Treatment Naïve)Extra pulmonary TB, Lymph node03-09-2015167752000
14SC06328FHIV+ ART-naïveNone07-09-201515881600
15SC06435MHIV+ ART-naïveNone07-09-20151093330000
16SC06524MHIV+ ART-naïveNone08-09-201549710800
17SC07232MHIV+ ART-naïveNone29-09-20152305970
18SC07327MHIV+ ART-naïveNone29-09-2015581131000
19SC07832FHIV+ ART-naïveNone06-10-201575513300
20SC08542FHIV+ ART-naïveNone03-11-201599368000

Viral RNA isolation

Viral RNA was purified from 1 ml of EDTA-treated plasma using the QIAamp viral RNA mini-kits (Qiagen, Cat # 52906) as per manufacturer protocol with some modifications. Instead of the recommended 140 μl, 1 ml of EDTA-treated plasma was processed in a single QIAamp Mini column and RNA was eluted in two batches of 40 μl of elution buffer each. 10 μl aliquots of purified plasma RNA were stored at -20°C for immediate use (less than 2 hours); long-term storage of RNA was at -80°C.

Primer design and one-step RT-PCR

The strategy adopted was to develop the pan-HIV-1 primer approach for the putative amplification of HIV-1 genomes of all major groups (M, N and O), their subtypes and recombinants as previously reported [4]. Initial analysis of field samples from the Indian cohort suggested modifications of primers to improve amplification efficiency and coverage of the gag-pol region were required. Further modifications were introduced based on consensus C-clade genome sequences retrieved from the Los Alamos HIV Sequence Database and an extended amplicon strategy adopted (summarized in Figure B in S1 File). Using the primers shown in Table 2, one-step RT-PCRs were performed to derive overlapping amplicons of 1.9 kb, 1.1 kb, 1.4 kb, 1.7 kb, 3 kb, and 3.5 kb using SuperScript III One-Step RT-PCR with Platinum Taq DNA High Fidelity Polymerase kits (Invitrogen, Cat # 12574–035). Each 25 μl reaction mixture contained 12.5 μl reaction mix (2 x), 4.5 μl RNase-free water, 1 μl each of each primer (conc. 20 nmol/μl), 1 μl SuperScript III RT/ Platinum Taq High Fidelity mix and 5 μl of template RNA. Cycling conditions were 50°C for 30 min; 94°C for 2 min; 35 cycles of 94°C for 15 sec, 58°C for 30 sec, and 68°C for 4 min 30 sec; and, finally, 68°C for 10 min. Amplicon quality was verified by agarose gel electrophoresis.
Table 2

Primers used in this study.

Amplicon NamePrimer SequenceCoordinates on HXB2 genomeReference
Amp1Pan-HIV-1F: AGCCYGGGAGCTCTCTGPan-HIV-1R: CCTCCAATTCCYCCTATCATTTT 26–1953 (1928 bp)Gall et al., JCM 2012
Amp2 (1F&1R)HIV-A2-SE-F1: AgTATgggCAAgCAgggAgCTHIV-A2-SE-R1: TgTCCTTCCTTTCCACATTTCC891-2051(1160 bp; overlap with Amp1: 1062 bp)This study
Amp3 (2F&3R)HIV-A2-SE-F2: gATgACAgCATgTCAgggAgTHIV-A2-SE-R3: TATAggCTgTACTgTCCATTA1827–3281 (1454 bp; overlap with Amp2: 224 bp)This study
Amp4 (4F&4R)HIV-A2-SE-F4: CTTCCACAgggATggAAggATHIV-A2-SE-R4: CTgCCATTTgTACTgCTgTCTT2994–4767 (1773 bp; overlap with Amp3: 287 bp)This study
Amp5Pan-HIV-3F: TTAAAAGAAAAGGGGGGATTGGGPan-HIV-3R: TGGCYTGTACCGTCAGCG4329–7394 (3066 bp; overlap with Amp4: 438 bp)Gall et al., JCM 2012
Amp6Pan-HIV-4F: CCTATGGCAGGAAGAAGCGPan-HIV-4R: CTTWTATGCAGCWTCTGAGGG5513–9063 (3551 bp; overlap with Amp5:1881 bp)Gall et al., JCM 2012

Illumina sequencing

Massive parallel sequencing of the pooled amplicons was carried out on an Illumina NextSeq 500 analyser. Library preparation was performed at Genotypic Technology’s Genomics facility following Nextera XT DNA Library Preparation protocol (Cat #FC-131-1024). 1 ng of Qubit-quantified genomic DNA was tagmented (fragmented and tagged) using Amplicon Tagment Mix provided in the Nextera XT Kit. The adapter tagged DNA was subjected to 12 cycles of indexing-PCR [72°C for 3 min followed by denaturation at 95°C for 30 sec, cycling (95°C for 10 sec, 55°C for 30 sec, 72°C for 30 sec) and 72°C for 5 min] to enrich the adapter-tagged fragments. The PCR product was purified using HighPrep beads (Magbio Genomics, #AC-60050). Quantification and size distribution of the prepared libraries were determined using Qubit fluorometer and the Agilent D1000 TapeStation respectively according to the manufacturer’s instructions.

Bioinformatics

QC and genome assembly

Raw reads generated from the Illumina machine were subjected to quality assessment using FastQC [5] and Trimmomatic v0.36 [6]. Based on per base quality score and k-mer presence, sequences were trimmed 10 bases at the 5’-end and five bases at 3’-end. Trimmed reads were mapped using bowtie2 [7] (default parameters) onto 2870 complete HIV-1 genomes to identify the closest reference. HIV-1 mapped reads were extracted and de novo assembled using IVA (Iterative Virus Assembler) [8]. IVA-assembled contigs were used as input for PRICE (Paired-Read Iterative Contig Extension) [9], with default options. PRICE uses incomplete assemblies of the clinical isolate genome and extends the contigs to fill the gaps iteratively. We ran PRICE for 10 iterations, choosing all contigs above 1000 bases at each cycle as templates for the next cycle. In nine cases, we obtained near complete genome assemblies (size > 8.5 kb) using this strategy and the remaining eleven cases could be assembled to obtain the gag gene owing to inadequate coverage of reads. In two cases, we assembled both gag and env genes but did not have enough read support to complete the whole genome. The genomes were made into their own consensus sequence using samtools [10] and bcftools [11].

Phylogenetic analyses

HIV-1 reference sequences were downloaded from the Los Alamos HIV Sequence Database [12] for phylogenetic analyses. Multiple sequence alignment was performed using MUSCLE [13] (default parameters) and phylogenetic trees were generated via maximum likelihood (ML) under the general time-reversible with gamma-distributed rate heterogeneity among sites (GTR+Γ) evolutionary model using RAxML v8.2.10 [14]. Trees were visualized with MEGA 7 [15]. The presence of intersubtype recombination was initially checked with Recombination Identification Program (RIP) [16], with subsequent analysis of the mosaic structure with the bootscanning method implemented in Simplot v3.5.1 [17]. For SNP-based phylogenetic tree, the HIV-1 specific filter reads for each sample were trimmed (adaptor/transposon sequence, 5’ < Q10 and 3’ 18]. SNP/InDels were saved in VCF format using samtools and bcftools. In order to include multiple reference sequences for a SNP-based phylogenetic tree, multiple sequence alignment among the reference was carried out with MUSCLE and corresponding bases (indicated as SNP/InDel by vcftools [19]) against each reference were extracted and concatenated using in-house R-scripts. The SNPs and InDels were concatenated for each sample following the same order of sequences in each case.

Results

Amplicon recovery and protocol optimization

Adaptation of the 4-amplicon strategy to recover near full-length HIV-1 genomes to a 6-amplicon strategy (Figure B in S1 File) for large-scale HIV-1 genome sequencing improved recovery of HIV-1 gene fragments from the Bengaluru cohort. While providing enhanced recovery of viral strains circulating in this population, amplification efficiency remained variable with some isolates, which appeared independent of baseline viral load status. Amplicons for each primer-pair, pooled in equimolar concentrations based upon NanoDrop readings, resulted in more than 1 million reads for each sample (minimum 30,000 reads per amplicon).

Initial de novo assembly and extension

In order to assemble a viable HIV-1 genome and enhance the potentially unique nature of each clinical isolate, we followed a two-step process involving de novo assembly using IVA (step 1) and PRICE (step 2). Extracted reads were mapped onto a consensus C-clade genome with the resulting read coverage for each sample shown in Table 3. SC012, SC018, SC019, SC023, SC061, SC063, SC064, SC065, SC072, SC073 and SC078 were analyzed across gag as a result of low coverage downstream of the pol gene.
Table 3

Summary of NGS results for each viral isolate.

Whole Genome
      Read Count for each primer used in this study
Sl.No.Sample IDTotal No. of paired-end readsPercentage of HIV-1 specific readsContigs After PRICELength of the contigAmp1Amp2Amp3Amp4Amp5Amp6
1SC00712,048,59045.86%190411,081,560839,1882,560,7872,406,79538,53717,069
2SC0083,456,56816.75%1908482,87658,111193,065312,74434,55816,670
3SHE0013,168,52828.06%19114111,89385,609321,476595,47515,0054,469
4SC0132,259,72029.48%19187439,695399,894161,80864,25993,51416,011
5SC0156,464,4582.37%1912275,80764,53622,7625,29311,7754,483
6SC0176,119,4263.02%1904383,65879,83352,11568,2691,665443
7SC0226,891,2468.60%18940327,410309,19997,578125,71026,9376,228
8SC0626,649,60825.91%19073894,930846,293354,433258,55755,65729,616
9SC0851,558,95214.98%19117127,991110,737113,63428,64034,9279,489
Partial Genome
      Read Count for each primer used in this study
Sl.No.Sample IDTotal No. of paired-end readsPercentage of HIV-1 specific readsContigs After PRICELength of the contigAmp1Amp2Amp3Amp4Amp5Amp6
1SC012223,8321.57%118392,7202,673352000
2SC018305,19034.23%1292462,55658,6859,2086419867
3SC0196,233,54615.60%24959;3621602,209569,824112,55822,80834,06210,188
4SC0236,185,7909.91%24841;4384481,739431,57475,5076,4757,1098,795
5SC061300,54052.14%23076;132488,14981,93314,4222033601,014
6SC0631,720,1042.33%32948;2354;191947,37742,0217,1447885151,394
7SC064168,99863.92%23592;329761,32556,14913,4121,3283,5701,346
8SC0651,869,0042.62%1197856,65652,6432,3042160221
9SC072156,8580.68%12748390300661300
10SC073297,64415.23%1215032,58032,1234,005210230
IVA uses an overlap consensus layout along with iteratively aligning reads to contigs so as to minimise sequencing errors and rare variations within the quasispecies. PRICE utilises the preassembled contigs from IVA and extends iteratively, until sufficiently long contigs are produced and gaps filled. In our runs, use of PRICE allowed us to merge multiple kilobase-sized contigs (Table 3) into a single genome-size assembly (>8500 bases) for nine strains.

Phylogenetic analysis of the clinical samples

Of the 20 Indian clinical samples, 9 yielded near full-length genomes (NFLG), with 10 further samples assembled across the complete gag gene. Sample SC078 had very few HIV-1 specific reads and could not be assembled across the complete gag gene and was therefore removed from further analyses. Since recombinant sequences can affect node support values and topologies in a phylogenetic tree, prior to tree construction, the newly obtained sequences were checked for the presence of intersubtype recombination using RIP. These analyses indicated that one virus, SC017, was A1C recombinant and all other sequences were of homogeneous subtypes (subtype C, except SC072 gag sequence, which was of subtype B). ML trees were constructed based on either whole-genome (Fig 1A) or gag alone (Fig 1B), excluding SC017 from the analyses. Multiple sequence alignments were generated with the HIV-1 subtype references downloaded from the Los Alamos HIV Sequence Database. In order to examine the phylogenetic relationship of the subtype C viruses from Bengaluru with other subtype C viruses from India and other countries, in the whole-genome tree, all subtype C NFLG sequences from India and other Asian countries (China, Myanmar and Nepal) available at the Los Alamos database, as well as references from the 11 subtype C clusters previously identified in Africa [20], were included in the analysis. The ML tree generated with this alignment (Fig 1A) shows that the Bengaluru sequences branch within a strongly supported monophyletic clade comprising all but one Asian subtype C sequences (the only exception being one sequence from India), within which sequences from Nepal, on the one hand, and China and Myanmar on the other, group in respective sub-clusters. The Asian subtype C clade is closely related to the previously identified African C6 cluster, comprising viruses from Botswana and South Africa, which in turn forms part of a supercluster comprising six clusters (C1 through C6) associated with southern Africa [20]. Within the Asian subtype C clade, the Bengaluru sequences failed to group with each other, except two sequences, SC008 and SC062, which joined in a cluster supported by a 94% bootstrap value. In the gag tree (Fig 1B), in which 15 other subtype C and the two subtype B full-length gag sequences from India available at the Los Alamos database were included, 18 sequences from Bengaluru were of subtype C, branching within the Indian/Asian clade, with only two pairs of sequences (SC022/SC023; SC063/SC064) grouping in well supported clusters, and one was of subtype B. Both viruses sequenced only in env were subtype C, branching within the CIN clade, in agreement with the gag phylogenetic tree (results not shown).
Fig 1

Maximum likelihood phylogenetic trees of HIV-1 sequences from Bengaluru.

Sequences from Bengaluru obtained in this study are labelled with red diamonds. Only bootstrap values ≥70% are shown. (a) Phylogenetic tree of NFLG sequences of subtype C. All NFLG subtype C sequences from Asia available at the Los Alamos HIV Sequence Database are included in the analysis. References of African subtype C clusters C1 through C10 [20] are also included and are shown compressed in triangles, as are clusters comprising sequences from China and Myanmar (CCN-MM) and from Nepal (CNP) (the last cluster comprising one sequence from India) nested within the Indian clade (CIN). (b) Phylogenetic tree of gag sequences of subtypes C and B. Fifteen randomly selected subtype C sequences and the only two subtype B sequences from India available at the Los Alamos database were included in the analysis, together with subtype references.

Maximum likelihood phylogenetic trees of HIV-1 sequences from Bengaluru.

Sequences from Bengaluru obtained in this study are labelled with red diamonds. Only bootstrap values ≥70% are shown. (a) Phylogenetic tree of NFLG sequences of subtype C. All NFLG subtype C sequences from Asia available at the Los Alamos HIV Sequence Database are included in the analysis. References of African subtype C clusters C1 through C10 [20] are also included and are shown compressed in triangles, as are clusters comprising sequences from China and Myanmar (CCN-MM) and from Nepal (CNP) (the last cluster comprising one sequence from India) nested within the Indian clade (CIN). (b) Phylogenetic tree of gag sequences of subtypes C and B. Fifteen randomly selected subtype C sequences and the only two subtype B sequences from India available at the Los Alamos database were included in the analysis, together with subtype references. SNP based phylogenetic tree was constructed in the same way and the orientation of the samples reflects the results of the previous trees. The SNPs and InDels in each sample annotated on consensus subtype-C genome are represented in Figure C in S1 File and many of the variations appear to be in the env gene. The mosaic structure of SC017 was analyzed by bootscanning using Indian A1 and C subtype references, together with references of subtypes B and H used as outgroups. The resulting bootscan plot (Fig 2) shows a complex structure with multiple breakpoints along the genome. To examine whether SC017 is related to other Indian A1C recombinant viruses, an ML phylogenetic tree was constructed with all Indian A1C recombinant NFLG sequences (only one per patient) deposited at the Los Alamos database. The tree shows clustering (75% bootstrap support) of SC017 only with one A1C recombinant, 95IN21301 (Figure D in S1 File). However, its mosaic structure differs substantially from that of SC017 (Figure E in S1 File).
Fig 2

Bootscan analysis of the NFLG of SC017.

The horizontal axis represents the position in the HXB2 genome and the vertical axis represents percent bootstrap values supporting clustering with reference sequences. Trees were constructed with the neighbor-joining method, using a window of 250 nt, sliding along the alignment in 20 nt steps.

Bootscan analysis of the NFLG of SC017.

The horizontal axis represents the position in the HXB2 genome and the vertical axis represents percent bootstrap values supporting clustering with reference sequences. Trees were constructed with the neighbor-joining method, using a window of 250 nt, sliding along the alignment in 20 nt steps. NCBI GenBank accession numbers for the sequences reported here are: KY713228 (SC007); KY713229 (SC008); KY713230 (SC013); KY713231 (SC015); KY713232 (SC017); KY713233 (SC022); KY713234 (SC062); KY713235 (SC085); KY713236 (SHE001); KY713237 (gag gene SC012); KY713238 (gag gene SC018); KY713239 (gag gene SC061); KY713240 (gag gene SC063); KY713241 (gag gene SC064); KY713242 (gag gene SC065); KY713243 (gag gene SC072); KY713244 (gag gene SC073); KY713245 (gag gene SC019); KY713246 (env gene SC019); KY713247 (gag gene SC023); KY713248 (env gene SC023).

Discussion

Here, we describe near full length genome recovery and assembly of HIV-1 from a clinical cohort in southern India using plasma-derived viral RNA, comprising recently replicating viral variants circulating in 20 HIV-1-diagnosed individuals from Bengaluru city. Overlapping amplicons using RT-PCR-based protocols and Illumina NextSeq 150 technology were used to generate de novo genome assemblies, optimized to enhance sequencing data/flow-through and to reflect evolution of HIV-1 genomes using phylogenetic analyses. Several universal methods for amplifying and sequencing whole HIV-1 genomes have been reported [2–4, 21–24]. However, we adapted the universal amplification protocol of Gall et al [4], where oligonucleotides were originally selected based on the large number of collated HIV-1 sequences in the Los Alamos database minimising amplification bias within highly conserved regions using bioinformatics predictions of sequence fidelity. Originally performed on 10 WHO HIV-1 genotype reference strains and 15 HIV-1 plasma RNA samples of various subtypes and CRFs an overall sensitivity of detection of 3000 HIV-1 RNA copies/ml was achieved. However, direct application of the universal primers appeared suboptimal for many field strains circulating in India, with plasma virus representing the primary source of viral RNA and we were unable to improve on the 3000 RNA copy number detection threshold; an overall 70% amplification efficiency success rate was, however, consistent with previous findings [2]. Interestingly, the inability to amplify from a proportion of Indian HIV-1 strains appeared independent of viral load even with re-design of primers, for example, to the gag/pol region making further refinement and re-design of these protocols inevitable. This is perhaps due to lack of documented circulating strains from South India, which can be used as a template for more efficient primer design and our data emphasizes significant differences in the gag-pol region of the circulating strains compared to the available reference genomes. While Illumina sequencing is a stochastic process which may not attain equal coverage of all amplicons in a given pool, this could potentially be overcome by preparing individual libraries for each amplicon of every sample. However, the significant associated cost escalation precluded using this option. At least a million reads of a single library were generated per sample (comprising an equimolar pool of all 6 amplicons), resulting in ~30,000 reads per amplicon which represented a mathematical minimum requirement for downstream de novo genome assembly. In addition, de novo assemblies are not robust in assembling whole genomes from short, paired-end data with inherent gaps in sequence coverage. Mindful of these limitations, in an Indian clade C dominant population, we manually assessed read quality, assembly construction and number of iterations during assembly extension for each sample, rather than use a standard reference-based assembly approach. The data generated extends our knowledge of HIV-1 strain characterization of viruses circulating in India reported since the 1990s, confirming that in addition to the largely subtype C predominance, subtypes A1 and B are also circulating as minor clades giving rise to A1C and BC recombinant forms [25-35]. Although analyses have usually been restricted to single genes, typically gag, pol, or env, some authors have reported sequencing of full-length proviral DNA of HIV-1 in India from cultured peripheral blood mononuclear cells [17,33,35-38], representative of both archived and replicating viral genomes. Reports of HIV-1 whole genome sequencing from plasma RNA, to identify viruses that are currently replicating and circulating in India, is however limited to one publication [2], in which sequences from 10 field HIV-1 samples genotypically confirmed to be subtype C strains were reported. Phylogenetic analyses of partial or full-length genomes have shown that the great majority of HIV-1 subtype C strains from India group in a monophyletic clade [17,25,26,30,36,38-41], designated CIN [26], which, according to phylodynamic analyses, originated in the 1970s [41-43], although sporadic cases of subtype C viruses branching outside of the CIN clade have been reported [6,30,36,41]. Analyses of relationships with viruses from other countries indicate that the African viruses most closely related to CIN are from the southern part of the continent [36,41], and that subtype C strains circulating in China [36,42,44], Myanmar [42], Nepal [45,46] and Bangladesh [47] derive from the Indian clade. Our ML phylogenetic trees confirm the monophyly of most Indian subtype C viruses, with all 8 NFLG and 18 gag subtype C viruses from Bengaluru branching within the CIN clade, interspersed among other Indian viruses (Fig 1). Additionally, for the first time we examine the relationship of the CIN clade with the previously identified African subtype C clusters [20], finding that it is closely related to a cluster (C6) comprising viruses from Botswana and South Africa (Fig 1A), which in turn groups in a supercluster (C1-C6) associated to Southern African countries, thus confirming previous reports indicating a close relationship between Indian and Southern African subtype C viruses. Of the 18 viruses from Bengaluru characterized in the NFLG or gag or env genes, only two were of non-subtype C genetic forms: one A1C recombinant (SC017), characterized in the NFLG (Fig 2), and one of subtype B (SC072), characterized in gag (Fig 1B). These results are consistent with previous studies reporting subtype B and A1C viruses to be minor components of the Indian HIV-1 epidemic [17,27,28,31-33]. SC017 exhibited a complex mosaic structure, with multiple breakpoints (Fig 2). In a phylogenetic tree, it appeared to be related to another A1C recombinant from India (Figure D in S1 File), although their mosaic structures were clearly different (Figure E in S1 File), implying that SC017 represents a unique recombinant form, as do other A1C recombinants characterized in India, which fail to cluster with each other (Figure D in S1 File). The extent of genetic mixing and its detailed nature in the context of the widespread distribution of HIV-1 subtype C in India will only become apparent by more systematic and detailed sequencing studies underscoring the utility of deep sequencing approaches to identify changes in the balance of epidemiologically relevant strains and the appearance of novel recombinants. These are most likely to be detected by direct sequence recovery from plasma samples, taken as evidence of productive, systemic infection and recent replication events in an individual where novel variants and recombinant forms will be detectable. Further analysis of the nine whole genomes and historical database isolates suggests limited evolution over time where the virus appears well-adapted to its host. Similar clustering patterns obtained with whole genome or gag gene suggests that overall recombination frequencies are also low. However, greater confidence in depicting the emergence of low frequency variants from whole genome recovery, (e.g. SC017, HIV-1 A1C) will be attained with the ability to fully map whole mosaic genomes. These will be further illuminated by refining and developing the types of approach described in this report, and elsewhere, given the urgent need for an effective HIV vaccine which is particularly able to target subtype C infections.

Conclusions

In conclusion, our data further indicate that Indian HIV-1 whole genome sequences converge to form a monophyletic lineage of subtype C, closely related to a southern African lineage, with sporadic cases of A1C recombinant forms exhibiting independent origins. While refinement of amplification protocols, sequencing platforms and bioinformatics tools for analysis of this kind of data are ongoing and likely to supersede the current study, application of techniques and approaches described here will benefit both the clinical management of HIV-1 patients, but will further allow a more precise description of molecular epidemiological trends and direction in specific geographical locales. Understanding complex interactions with coincident infections, such as tuberculosis or viral infections, will be facilitated by these types of approach. Such studies will benefit not only treatment approaches and regimens, but provide clearer data for vaccine design approaches when they become available. A) CD4+ T-cell count and viral load correlation of clinical samples. B) Primer redesigning for amplicon recovery of samples involved in this study. C) SNPs and InDels annotated on consensus C genome for each sample. D) Maximum likelihood phylogenetic tree of NFLG sequences of SC017 and other A1C recombinant viruses from India. E) Bootscan analysis of the NFLG of 95IN21301. (PDF) Click here for additional data file.
  44 in total

1.  Polymorphism of HIV-1 gag (p17) gene from female sex workers in Calcutta, India.

Authors:  S Sengupta; D Khetawat; S Jana; K Sarkar; S K Bhattacharya; S Chakrabarti
Journal:  Arch Virol       Date:  2005-06-15       Impact factor: 2.574

2.  Identification of unique B/C recombinant strains of HIV-1 in the southern state of Karnataka, India.

Authors:  Nagadenahalli Byrareddy Siddappa; Prashanta Kumar Dash; Anita Mahadevan; Anita Desai; Narayana Jayasuryan; Vasanthapuram Ravi; Parthasarathy Satishchandra; Susarla K Shankar; Udaykumar Ranga
Journal:  AIDS       Date:  2005-09-02       Impact factor: 4.177

3.  Molecular characterization of unique intersubtype HIV type 1 A1/C recombinant strain circulating in Pune, India.

Authors:  Sudhanshu Pandey; Srikanth Tripathy; Ramesh Paranjape
Journal:  AIDS Res Hum Retroviruses       Date:  2013-07-19       Impact factor: 2.205

4.  Universal amplification, next-generation sequencing, and assembly of HIV-1 genomes.

Authors:  Astrid Gall; Bridget Ferns; Clare Morris; Simon Watson; Matthew Cotten; Mark Robinson; Neil Berry; Deenan Pillay; Paul Kellam
Journal:  J Clin Microbiol       Date:  2012-09-19       Impact factor: 5.948

5.  Fast gapped-read alignment with Bowtie 2.

Authors:  Ben Langmead; Steven L Salzberg
Journal:  Nat Methods       Date:  2012-03-04       Impact factor: 28.547

6.  A computer program designed to screen rapidly for HIV type 1 intersubtype recombinant sequences.

Authors:  A C Siepel; A L Halpern; C Macken; B T Korber
Journal:  AIDS Res Hum Retroviruses       Date:  1995-11       Impact factor: 2.205

7.  Emergence of drug resistance-associated mutations in HIV-1 subtype C protease gene in north India.

Authors:  Mohd Azam; Abida Malik; Meher Rizvi; Supriya Singh; Poonam Gupta; Arvind Rai
Journal:  Virus Genes       Date:  2013-07-26       Impact factor: 2.332

8.  Prevalence of HIV-1 Subtypes and Antiretroviral Drug Resistance Mutations in Nepal.

Authors:  Nirajan Bhusal; Ruengpung Sutthent; Navin Horthongkham; Niracha Athipanyasilp; Wannee Kantakamalakul
Journal:  Curr HIV Res       Date:  2016       Impact factor: 1.581

9.  Identification of subtype C human immunodeficiency virus type 1 by subtype-specific PCR and its use in the characterization of viruses circulating in the southern parts of India.

Authors:  Nagadenahalli B Siddappa; Prashanta K Dash; Anita Mahadevan; Narayana Jayasuryan; Fen Hu; Bethany Dice; Randy Keefe; Kadappa S Satish; Bhuthiah Satish; Kuttan Sreekanthan; Ramdas Chatterjee; Kandala Venu; Parthasarathy Satishchandra; Vasanthapuram Ravi; Susarla K Shankar; Raj Shankarappa; Udaykumar Ranga
Journal:  J Clin Microbiol       Date:  2004-06       Impact factor: 5.948

10.  PRICE: software for the targeted assembly of components of (Meta) genomic sequence data.

Authors:  J Graham Ruby; Priya Bellare; Joseph L Derisi
Journal:  G3 (Bethesda)       Date:  2013-05-20       Impact factor: 3.154

View more
  3 in total

1.  Development of a Versatile, Near Full Genome Amplification and Sequencing Approach for a Broad Variety of HIV-1 Group M Variants.

Authors:  Andrew N Banin; Michael Tuen; Jude S Bimela; Marcel Tongo; Paul Zappile; Alireza Khodadadi-Jamayran; Aubin J Nanfack; Josephine Meli; Xiaohong Wang; Dora Mbanya; Jeanne Ngogang; Adriana Heguy; Phillipe N Nyambi; Charles Fokunang; Ralf Duerr
Journal:  Viruses       Date:  2019-04-01       Impact factor: 5.048

2.  Characterization of HIV-1 recombinant and subtype B near full-length genome among men who have sex with men in South Korea.

Authors:  Sangmi Ryou; Myeongsu Yoo; Kisoon Kim; Sangsoo Kim; Sang Il Kim; Youn Jeong Kim; Dae Won Park; Jun Yong Choi; Hyo Youl Kim; Jung Ho Kim; Joon Young Song; Shin-Woo Kim; Hyun-Ha Chang; Bo Youl Choi; Mee-Kyung Kee
Journal:  Sci Rep       Date:  2021-02-18       Impact factor: 4.379

3.  Validation of Variant Assembly Using HAPHPIPE with Next-Generation Sequence Data from Viruses.

Authors:  Keylie M Gibson; Margaret C Steiner; Uzma Rentia; Matthew L Bendall; Marcos Pérez-Losada; Keith A Crandall
Journal:  Viruses       Date:  2020-07-14       Impact factor: 5.048

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.