Epigallocatechin gallate supplementation protects against renal injury induced by fluoride intoxication in rats: Role of Nrf2/HO-1 signaling.

Fluoride intoxication generates free radicals, causing oxidative stress that plays a critical role in the progression of nephropathy. In the present study, we hypothesized that epigallocatechin gallate (EGCG), found in green tea, protects the kidneys of rats treated with fluoride by preventing oxidative stress, inflammation, and apoptosis. Pretreatment of fluoride-treated rats with EGCG resulted in a significant normalization of creatinine clearance and levels of urea, uric acid, and creatinine. Fluoride intoxication significantly increased renal oxidative stress markers and decreased the levels of renal enzymatic and non-enzymatic antioxidants. In addition, renal NO, TNF-α, IL-6 and NF-κB were also increased in the renal tissue of fluoride-treated rats. Further, EGCG pretreatment produced a significant improvement in renal antioxidant status and reduced lipid peroxidation, protein carbonylation and the levels of inflammatory markers in fluoride-treated kidney. Similarly, mRNA and protein analyses showed that EGCG pretreatment normalized the renal expression of Nrf2/Keap1 and its downstream regulatory proteins in fluoride-treated rat kidney. EGCG also effectively attenuated fluoride-induced renal apoptosis by the up-regulation of anti-apoptotic proteins such as Bcl-2 and down-regulation of Bax, caspase-3, caspase-9 and cytochrome c. Histology and immunohistochemical observations of Kim-1 provided further evidence that EGCG effectively protects the kidney from fluoride-mediated oxidative damage. These results suggest that EGCG ameliorates fluoride-induced oxidative renal injury by activation of the Nrf2/HO-1 pathway.

Introduction

Fluoride is used in numerous industrial activities and is a ubiquitous component of water sources, foods, and dental products [1]. Fluoride ions can easily spread from the lungs and the gastrointestinal tract to the blood. Numerous disorders have been connected to systemic fluoride consumption [2]. Fluoride compounds are used to enhance the strength of teeth, for water fluoridation and as food additives [3], [4]. The minimal risk level for daily oral fluoride uptake was determined to be 0.05 mg/kg/day, based on a non-observable adverse effect level (NOAEL) of 0.15 mg Fl/kg/day for an increased fracture rate. Estimations of human lethal fluoride doses showed a wide range of values, from 16 to 64 mg/kg in adults and 3 to 16 mg/kg in children [3]. Skeletal and dental fluorosis are the most common diseases caused by excessive consumption of fluoride. In advanced cases, skeletal fluorosis causes pain and damage to bones and joints [5]. In India, the most common cause of fluorosis is excessive consumption of fluoride-laden water derived from the deep bore wells. Over half of the ground water sources in India have fluoride above the levels recommended by the WHO [6].

Fluoride enhances the generation of reactive oxygen species and decreases antioxidant enzyme capacity, effects that play critical roles in fluoride-induced organ toxicity [7], [8], [9]. Natural antioxidants can help to conquer the oxidative stress and free radical-induced disorders. Numerous side effects of synthetic antioxidants have been reported previously. Therefore, attention has been recently paid to find natural antioxidants with lower side effects. Green tea catechins, especially epigallocatechin gallate (EGCG), are known to be the most potent antioxidant among all catechins [10]. Epidemiological and intervention studies indicate that consumption of 5–6 or more cups of green tea, containing 200–300 mg EGCG, per day may be beneficial for maintaining normal health status [11]. EGCG acts as a scavenger of many reactive oxygen/nitrogen species (ROS/RNS) such as superoxide radical anion, peroxyl and hydroxyl radicals, singlet oxygen, nitric oxide and peroxynitrite. EGCG may trap peroxyl radicals and thus break the chain reaction of free radicals and terminate lipid peroxidation. An electron paramagnetic resonance (EPR) study on tea catechins indicated that each molecule of EGCG has the ability to trap six superoxide anion or hydroxyl radicals [12].

EGCG has already been reported as a beneficial agent to manage the development of diabetic nephropathy and chronic renal failure induced by streptozotocin and adenine, respectively [13]. The potential role of oxidative stress in the renal injury associated with fluoride exposure suggests that inhibition of ROS-mediated oxidative stress may protect against fluoride-induced nephrotoxicity. These findings led us to hypothesize that EGCG might reduce fluoride-induced oxidative stress and inflammation and provide a defensive mechanism against fluoride nephrotoxicity. Thus, the purpose of the present study was to investigate the possible protective role of EGCG on fluoride-induced nephrotoxicity and to explore the underlying molecular pathways involved in the nephroprotection rendered by EGCG.

Materials and methods

EGCG was purchased from Sigma Aldrich (St. Louis, MO, USA). The antibody against Nrf2 was procured from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibody against heme oxygenase-1 (HO-1) was purchased from Abcam (Cambridge, UK). Goat anti-Bcl-2, Bax, cytochrome c, cleaved caspases 9 and 3, and β-actin monoclonal antibodies were purchased from Santa Cruz Biotechnology. Anti Kim-1 rat polyclonal antibody was purchased from Thermo Scientific (Pittsburgh, PA, USA). Sodium Fluoride (NaF, molecular weight 41.98) and all other chemicals and solvents were of certified analytical grade and purchased from S.D. Fine Chemicals (Mumbai, India) or Hi Media Laboratories Pvt. Ltd. (Mumbai, India). Reagent kits were obtained from Span Diagnostics (Mumbai, India). The structure of EGCG is shown in Fig. 1.

Fig. 1

Chemical structure of EGCG (C22H18O11).

Animals and diet

Healthy male albino Wistar rats (160–180 g) were obtained from the Central Animal House, Department of Experimental Medicine, Rajah Muthiah Medical College and Hospital, Annamalai University, and maintained in an air-conditioned room (25 ± 2 °C) with a 12 h light/12 h dark cycle. Food and water were provided ad libitum to all the animals. The study protocols were approved by the Institutional Animal Ethics Committee of Rajah Muthiah Medical College and Hospital (Reg No. 160/1999/CPCSEA, Proposal number: 952/2012), Annamalainagar and the study conducted in accordance with the Guide for the Care and Use of Laboratory Animals.

Experimental design

The rats were maintained under standard laboratory conditions (temperature 24 ± 2 °C; natural light–dark cycle). The rats had free access to drinking water and commercial standard pellet diet (Lipton India Ltd., Mumbai, India). In the present study, fluoride was administered intragastrically at a dose of 25 mg/kg body weight/day for 4 weeks, which was 1/10 of the oral LD50 value [14] in rats. The dose selection for EGCG (40 mg/kg) was based on the previous report of Thangapandiyan and Miltonprabu [15], which showed this dose to be protective against fluoride-induced hepatotoxicity in rats. The animals were randomly divided into four groups of six animals in each group. Group 1: control rats received only the vehicle, i.e., normal saline. Group 2: rats orally received EGCG at a dose of 40 mg/kg body weight for 4 weeks alone. Group 3: rats orally received fluoride 25 mg/kg body weight for 4 weeks alone. Group 4: rats orally received fluoride 25 mg/kg body weight along with EGCG at a dose of 40 mg/kg body weight. At the end of the treatment period, the rats were fasted overnight, anesthetized with pentobarbital sodium (35 mg/kg, i.p.) and sacrificed by cervical dislocation. Blood was collected and centrifuged (1000 × g for 15 min) for the separation of serum. Urine samples were obtained from each animal housed in a specially designed metabolic cage, and fecal contamination was avoided. Urine samples were collected in bottles within 24-h cycles. The volume of each sample was recorded and centrifuged at 3000 × g for 5 min. Urine samples were collected during the morning between 9.00 and 10.00 h. Kidney tissues from control and experimental groups of rats were excised, rinsed with ice-cold saline and homogenized in 100 mM Tris–HCl buffer (pH 7.4) using a Teflon homogenizer and centrifuged at 12,000 × g for 30 min at 40 °C. The supernatant was pooled and used for additional biochemical assays. The protein content in the tissue homogenate was also measured.

Biochemical assays

Estimation of urea, uric acid, creatinine and creatinine clearance

The levels of urea, uric acid and creatinine in serum and urine were estimated spectrophotometrically using commercial diagnostic kits (Sigma Diagnostics (I) Pvt. Ltd., Baroda, India). Creatinine clearance as an index of glomerular filtration rate was calculated from serum creatinine and a 24-h urine sample creatinine level.

Estimation of TNF-α, NO, IL-6 and NF-kB p65

The levels of proinflammatory cytokines such as TNF-α, NO, IL-6, and NFkBp65 in kidney tissues of control and experimental groups of rats were determined by specific ELISA kits according to the manufacturer's instructions (Biosource; Camarillo, CA, USA). The concentration of proinflammatory cytokines was determined spectrophotometrically at 450 nm. Standard plots were constructed by using standard cytokines and the concentrations for unknown samples were calculated from the standard plot. The nuclear level of p65 may correlate positively with the activation of NF-κB pathway. The NF-κB/p65 ActivELISA (Imgenex; San Diego, CA, USA) kit was used to quantify NF-κB free p65 in the nuclear fraction of the kidney tissue homogenate. The analysis was done according to the manufacturer's instructions.

Determination of lipid peroxidation and protein carbonyl contents

Lipid peroxidation in renal tissue was estimated colorimetrically by measuring thiobarbituric acid reactive substances (TBARS) and lipid hydroperoxides as described by Niehiaus and Samuelsson [16] and Jiang et al. [17], respectively. As a hallmark of protein oxidation, total protein carbonyl content was determined in the kidney by a spectrophotometric method described by Levine et al. [18] and expressed as nmol/mg protein.

Determination of non-enzymatic antioxidant concentrations

Reduced GSH was determined by the method of Moron et al. [19] based on the reaction with Ellman's reagent (19.8 mg dithionitrobisbenzoic acid in 100 mL of 0.1% sodium citrate). Total sulfhydryl groups (TSH) in the kidney homogenate were measured after the reaction with dithionitrobisbenzoic acid using the method of Ellman [20]. Ascorbic acid (vitamin C) and vitamin E concentrations were measured by the methods of Omaye et al. [21] and Desai [22], respectively.

Determination of activities of antioxidant and GSH-metabolizing enzymes

Superoxide dismutase (SOD) activity was determined by the method of Kakkar et al. [23] in which inhibition of the formation of NADH-phenazinemethosulfate nitroblue tetrazolium formation was measured spectrophotometrically at 560 nm. Catalase (CAT) activity was assayed colorimetrically as described by Sinha [24] using dichromate acetic acid reagent. Glutathione peroxidase (GPx) activity was assayed by the method based on the reaction between GSH remaining after the action of GPx and 5,5′-dithiobis-2-nitrobenzoic acid to form a complex that absorbs maximally at 412 nm, as described by Rotruck et al. [25]. Glutathione S-transferase (GST) activity was determined spectrophotometrically by using dichloro-2,4-dinitrobenzene as the substrate, as described by Habig et al. [26]. Glutathione reductase (GR), which uses NADPH to convert glutathione disulfide (GSSG) to the reduced form, was assayed by the method of Horn and Burns [27]. The estimation of glucose 6-phosphate dehydrogenase (G6PD) activity was carried out by the method of Beutler [28], where an increase in the absorbance was measured when the reaction was started by the addition of glucose 6-phosphate. Protein level was determined by using bovine serum albumin as the standard at 560 nm by Lowry et al. [29].

Determination of membrane-bound ATPase activities

Total ATPase activity in kidney homogenates was measured by the method of Evans [30]. The ATPase activity in 0.1 mL of an aliquot of the homogenate was measured in a final volume of 2 mL containing 0.1 mL of 0.1 M Tris–HCl (pH 7.4), 0.1 mL of 0.1 M NaCl, 0.1 mL of 0.1 M MgCl2, 1.5 mL of 0.1 M KCl, 0.1 mL of 1 mM EDTA and 0.1 mL of 0.01 M ATP. The reaction was stopped after 20 min by the addition of 1 mL of 10% trichloroacetic acid and then centrifuged (1500 × g for 10 min) and the inorganic phosphate (Pi) liberated was estimated in the protein-free supernatant. The amount of liberated Pi was estimated according to the method of Fiske and Subbarow [31].

The activity of Na+/K+-dependent ATPase was determined by the method of Bonting [32] with slight modification. In this assay, 0.2 mL of the kidney tissue homogenate was added to the mixture containing 1 mL of 184 mM Tris–HCl buffer (pH 7.5), 0.2 mL of 50 mM MgSO4, 0.2 mL of 50 mM KCl, 0.2 mL of 600 mM NaCl, 0.2 mL of 1 mM EDTA and 0.2 mL of 10 mM ATP and incubated for 15 min at 37 °C. When present, ouabain was used at a concentration of 1 mM. The reaction was stopped by the addition of 1 mL of ice cold 10% trichloroacetic acid. The amount of Pi liberated was then estimated in the protein-free supernatant. Na+/K+-ATPase activity was taken to be the ouabain-sensitive component of the total ATPase activity.

The activity of Ca2+-ATPase was assayed according to the method of Hjerten and Pan [33]. Briefly, 0.1 mL of tissue homogenate was added to a mixture containing 0.1 mL of 125 mM Tris–HCl buffer (pH 8), 0.1 mL of 50 mM CaCl2 and 0.1 mL of 10 mM ATP. The contents were incubated at 37 °C for 15 min. The reaction was stopped by the addition of 0.5 mL of ice cold 10% trichloroacetic acid and centrifuged. The amount of Pi liberated was estimated in the supernatant.

The activity of Mg2+-ATPase was assayed by the method of Ohnishi et al. [34]. The contents were incubated for 15 min at 37 °C and the reaction was stopped by adding 0.5 mL of 10% trichloroacetic acid. The Pi liberated was then estimated in the protein-free supernatant. The activities of these ATPase enzymes in tissue homogenates were expressed as log Pi liberated/min per mg protein.

Real-time qPCR analysis for Nrf2, HO-1, Keap1, γ-Gcsh, and Gstm3

Total RNA was extracted from the renal tissues from control and experimental groups of rats with TRIzol® reagent (Invitrogen; Carlsbad, CA), according to the manufacturer's protocol and purified by Qiagen RNeasy Mini Kit (Qiagen; Venlo, The Netherlands). Purified total RNA was reverse transcribed into single-strand cDNAs, which were successively analyzed by real-time qPCR using the SYBR GREEN PCR master mix (Applied Biosystems; Foster City, CA, USA). The amplification protocol involved one cycle at 95 °C for 3 min followed by 40 cycles at 95 °C for 30 s, 58 °C for 30 s, and then 72 °C for 30 s. Primer sequences were designed using Primer Express 2.0 software following the instructions of Applied Biosystems for optimal primer design and were synthesized commercially. The primer sequences for nuclear factor (erythroid-derived 2)-like 2 (Nrf2), heme oxygenase-1 (Hmox-1), Kelch-like associated protein 1 (Keap1), γ-glutamylcysteine synthetase heavy (catalytic) subunit (γ-Gcsh), Gstm3 and Gapdh are listed in Table 1. A standard curve was prepared using a serial dilution of a reference sample, and was included in each real-time run to correct for possible variations in product amplification. Relative copy numbers were obtained from standard curve values and were normalized to values obtained for the internal control, Gapdh. The fold change in expression was then obtained by the 2−ΔΔCT method.

Table 1

List of primers used for real-time qPCR.

Accession no.	Gene description	Gene symbol	Forward (5′–3′)	Reverse (3′–5′)	Product size (bp)
NM_031789.1	Nuclear factor (erythroid-derived 2)-like 2	Nrf2	gagacggccatgactgat	gtgaggggatcgatgagtaa	196
NM_012580.2	Heme oxygenase (decycling) 1	Hmox1	ggaactccctctgtagaccaa	gaggcttcacctcatcgtcta	288
NM_057152.1	Kelch-like ECH-associated protein 1	Keap1	ctgcatccaccacagcagcgt	gtgcagcacacagaccccggc	250
NM_012815.2	γ-Glutamylcysteine synthetase	γ-Gcsh	atgcagtattctgaactacc	acaaactcagattcacctac	396
NM_020540.1	Glutathione-S-transferase, mu 3	Gstm3	gaacgttcgcggacttactca	acgtatctcttctcctcatagtttg	78
NM_017008.3	Glyceraldehyde 3-phosphate dehydrogenase	Gapdh	aggttgtctcctgtgacttc	ctgttgctgtagccatattc	130

Western blot analysis for Nrf2, HO-1, γ-GCS, and μ-GST

Protein extraction was performed as follows. The rat kidney was homogenized in 1 mL of ice-cold hypotonic buffer A [10 mM HEPES (pH 7.8), 10 mM KCl, 2 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride (PMSF)]. To the homogenate, 80 μL of 10% Nonidet P-40 (NP-40) solution was added and the mixture was then centrifuged for 2 min at 14,000 × g. The supernatant was collected as a cytosolic fraction for HO-1 The precipitated nuclei were washed once with 500 μL of buffer A plus 40 μL of 10% NP-40, centrifuged, resuspended in 200 μL of buffer C [50 mM HEPES (pH 7–8), 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.1 mM PMSF, 20% glycerol] and centrifuged for 5 min at 14,800 × g. The supernatant containing nuclear proteins was collected for Nrf2 [35]. Protein concentration was determined according to the procedure described by Lowry using a protein assay kit supplied by Sigma (St. Louis, MO, USA). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer containing 2% β-mercaptoethanol was added to the supernatant. Equal amounts of protein (50 μg) were electrophoresed and subsequently transferred to nitrocellulose membranes (Schleicher and Schuell; Keene, NH, USA). Nitrocellulose blots were washed twice for 5 min each in PBS and blocked with 1% bovine serum albumin in PBS for 1 h prior to application of the primary antibody. Antibodies against Nrf2, μ-GST, γ-GCS, and Keap-1 were purchased from Santa Cruz Biotechnology, Inc. Antibody against HO-1 was purchased from Abcam. The primary antibody was diluted (1:1000) in the same buffer containing 0.05% Tween 20. The nitrocellulose membrane was incubated overnight at 4 °C with protein antibody. Blots were washed and incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (Abcam). Specific binding was detected using diaminobenzidine and H2O2 as substrates. Band intensities of Nrf2, HO-1, and β-actin were quantified by densitometry analysis using an image analysis system (Image J; National Institute of Health, Bethesda, MD, USA). The results were normalized to the β-actin expression in each group (mean ± SD) as percent of control. No differences were observed in β-actin expression between the experimental groups.

Western blot analysis for Bax, Bcl-2, caspase-3, caspase-9 and cytochrome c

Western blotting was performed by the method of Camano et al. [36] to analyze the expression pattern of Bax, Bcl-2, cytochrome c, caspase-9 and caspase-3. The kidney tissue samples were homogenized in an ice-cold lysis buffer (1× PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 10 μg/mL PMSF). The homogenate was centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was stored at −80 °C. The protein concentration was determined with the BioRad (Hercules, CA, USA) protein assay reagent. Equivalent amounts of protein were resolved on a 10% SDS-polyacrylamide gel and then transferred to a PVDF membrane. After blockage of nonspecific binding sites with 5% nonfat milk in PBS-T (PBS and 1% Tween 20) for 1 h at room temperature, the membrane was incubated overnight at 4 °C with diluted goat anti-Bcl-2, Bax, cytochrome c, cleaved caspases-3 and -9, or β-actin monoclonal antibodies (Santa Cruz Biotechnology, Inc.). The membranes were then washed three times with PBS-T, incubated further with a secondary horseradish peroxidase-conjugated antibody (Santa Cruz Biotechnology, Inc.) at room temperature for 1 h, and then washed three times with PBS-T. Specific binding was detected using diaminobenzidine and H2O2 as substrates. Band intensities of Bcl-2, Bax, cytochrome c, cleaved caspases-3 and -9 and β-actin were quantified by densitometry analysis using an image analysis system (Image J; National Institute of Health). The results were normalized to the β-actin expression in each group (mean ± SD) as percent of control. No differences were observed in β-actin expression between experimental groups.

Immunohistochemistry analysis of renal Kim-1

The protective effect of EGCG on Kim-1 expression in the kidney was assessed by immunohistochemical staining. Kidney sections on polylysine-coated slides were fixed in neutral buffered formalin, embedded in paraffin, and were treated with Kim-1 antibodies for immunohistochemical analysis. The procedures were conducted according to the manufacturer's protocol recommended for Kim-1 immunohistochemistry with slight modifications. Following deparaffinization and rehydration, sections were irradiated in 0.1 mol/L sodium citrate buffer (pH 6.0) in a microwave oven (medium low temperature) for 20 min. The sections were then exposed to 3% H2O2 for 10 min to bleach endogenous peroxidases, followed by rinsing 3 times in Tris buffer (pH 7.4) for 10 min each. Sections were selectively incubated with an anti Kim-1 rat polyclonal antibody (Thermo Scientific) overnight at 4 °C. On the next day, slides were washed 3 times in Tris buffer for 10 min each. The specificity of the antibodies was tested by omission of the primary antibodies and a positive control of rat tonsil tissue. After washing in Tris buffer (pH 7.4), tissues were visualized with 3,3′-diaminobenzidine (DAB) and counterstained with hematoxylin. Finally, the sections were dehydrated in xylene, mounted with DPX and a coverslip was attached. Slides prepared for each case were examined by light microscopy. Positive and negative controls were conducted in parallel with Kim-1 stained sections. Staining of sections with commercially available antibodies served as the positive control. Negative controls included staining tissue sections with the omission of the primary antibody. Ultra vision detection System (Thermo Scientific) was used as follows: sections were incubated with biotinylated goat anti-polyvalent, then with streptavidin peroxidase and finally with DAB plus a chromogen. Slides were counterstained with hematoxylin, visualized under a light microscope, and the extent of cell immunopositivity was assessed. The number of immunopositive cells was counted in 5 separate microscopic fields on each slide and the mean number for each slide was obtained, then the mean ± SD was calculated for each group (10 slides).

Histopathology

For histopathology examination, kidney tissues were dissected, fixed in Bouin's solution for 14–18 h, processed in a series of graded ethanol and embedded in paraffin. Paraffin sections were cut at 5-μm thickness and stained with hematoxylin and eosin for light microscopy examination. The sections were viewed and photographed on an Olympus light microscope (Olympus BX51, Tokyo, Japan) with attached camera (Olympus C-5050, Olympus Optical Co. Ltd.; Tokyo, Japan). Histopathology scoring was performed to evaluate the severity of renal tubular damage using a semiquantitative scale. All sections were evaluated for the degree of tubular and glomerular injury, inflammatory cell infiltration, necrosis, edema and calcification. Each kidney slide was examined and assigned scores for severity of changes using the following scale: None = 0%, mild = + = <25%, moderate = ++ = 25–50%, severe = +++ = 50–75%, and more severe = ++++ = >75% damage.

Statistical analysis

All the data were expressed as mean ± SD for the indicated number of experiments (n = 6). Statistical significance was evaluated by one-way analysis of variance using SPSS version 16.0 (SPSS; Cary, NC, USA) and individual comparisons were obtained by Duncan's multiple range test (DMRT) followed by a post hoc test, the least significant difference (LSD). Values were considered statistically significant when P < 0.05.

Results

Body weight gain, food intake, water intake and organ body weight ratio

Table 2 shows the effects of fluoride and EGCG on body weight gain, food and water intake and organ-body weight ratio (%) in control and experimental rats. In fluoride-treated rats, water and pellet diet consumption significantly (P < 0.05) decreased with a decrease in body weight. A significant (P < 0.05) increase in kidney:body weight ratio was recorded in fluoride-intoxicated rats when compared with control rats. Pretreatment with EGCG significantly (P < 0.05) increased the fluoride-induced alterations in food and water intake, body weight gain and kidney:body weight ratio when compared with rats treated with fluoride alone. Administration of EGCG alone did not show any alterations in those parameters and did not differ significantly from the normal control group.

Table 2

Body weight, absolute and relative kidney weights, and food and water intake in control and experimental rats.

Groups	Body weight			Absolute kidney weight (g)	Relative kidney weight (g/100 g bw)	Food intake (g/100 g bw/day)	Water intake (mL/rat/day)
	Initial (g)	Final (g)	% change
Control	156 ± 2	172 ± 4	10.7 ± 0.5a	1.49 ± 0.02a	0.57 ± 0.05a	11.2 ± 1.2	19.2 ± 2.1
EGCG	157 ± 2	174 ± 3	11.2 ± 0.5a	1.90 ± 0.04a	0.57 ± 0.06a	11.9 ± 1.1	20.8 ± 1.8
Fluoride	155 ± 2	142 ± 3	6.52 ± 0.40b	1.36 ± 0.01b	0.43 ± 0.05b	7.18 ± 0.92	15.4 ± 1.5
Fluoride + EGCG	158 ± 1	170 ± 3	8.56 ± 0.59c	1.60 ± 0.03c	0.51 ± 0.04c	10.6 ± 1.2	17.6 ± 1.7

Values are given as mean ± SD from six rats in each group. Values with different superscript letters (a–c) in the same column differ significantly at P < 0.05 (DMRT).

Effect of EGCG on serum and urinary nephrotoxic markers

Fig. 2 shows the level of serum and urinary nephrotoxic markers in control and experimental rats. Significant (P < 0.05) increases in the levels of serum urea (I), uric acid (II) and creatinine (III) with decreased creatinine clearance (IV) were observed in serum. Similarly, significant (P < 0.05) decreases were observed in the urinary levels of creatinine (V), urea (VI) and uric acid (VII) in fluoride-intoxicated rats when compared with normal control rats. Interestingly, pretreatment with ECGC (40 mg/kg) along with fluoride significantly (P < 0.05) restored the altered levels of serum and urinary nephrotoxic markers when compared with rats treated with fluoride alone. Rats treated with EGCG alone did not exhibit any alterations in the renal marker levels when compared to the control group.

Fig. 2

Effect of EGCG on kidney serum and urinary markers in control and fluoride-induced rats. Figure (I) shows urea in serum (mg/dL), (II) uric acid in serum (mg/dL), (III) creatinine in serum (mg/dL), (IV) creatinine clearance (mL/min), (V) urea in urine (mg/dL), (VI) uric acid in urine (mg/dL), and (VII) creatinine in urine (mg/dL). Values are expressed as mean ± SD for measurements in six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on kidney levels of TNF-α, NO, IL-6 and NFkB p65

The levels of TNF-α, NO, IL-6 and NF-κB p65 subunit in the renal tissues of control and experimental rats are shown in Fig. 3A–D. Levels of proinflammatory cytokines such as TNF-α, NO, IL-6 and NF-κB p65 subunit were significantly (P < 0.05) increased in fluoride-treated rats in comparison with control rats. Pretreatment of fluoride-treated rats with EGCG showed that the levels of these proinflammatory cytokines were significantly (P < 0.05) decreased to near control levels compared with rats treated with fluoride alone. Rats treated with EGCG alone did not show any changes in the proinflammatory markers when compared to the control rats.

Fig. 3

Effect of EGCG on renal TNF-α, NO, IL-6 and NFkB p65 in control and experimental rats. Values are expressed as mean ± SD for measurements from six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal oxidative stress markers

The levels of thiobarbituric acid reactive oxygen substances (TBARS), lipid hydroperoxide (LOOH) and protein carbonyl content (PCC) in control and experimental rats are shown in Table 3. The levels of lipid peroxidation products such as TBARS, LOOH and PCC were significantly (P < 0.05) increased in fluoride-treated rats when compared to control rats. Co-treatment with EGCG along with fluoride significantly (P < 0.05) decreased the level of renal oxidative stress markers when compared with rats treated with fluoride alone. Pre-administration of EGCG alone significantly (P < 0.05) reduced the levels of TBARS, LOOH and PCC when compared to the control group.

Table 3

Changes in the levels of renal thiobarbituric acid reactive substance (TBARS), lipid hydroperoxides (LOOH), and protein carbonyl (PC) content of control and experimental rats.

Groups	TBARS (mg/g tissue)	LOOH (mmol/g tissue)	PC (nmol/mg protein)
Control	2.50 ± 0.20a	0.59 ± 0.07a	1.73 ± 0.14a
EGCG	2.41 ± 0.17b	0.46 ± 0.05b	1.66 ± 0.13b
Fluoride	4.31 ± 0.34c	0.98 ± 0.08c	4.50 ± 0.45c
Fluoride + EGCG	2.72 ± 0.22d	0.67 ± 0.08d	2.36 ± 0.19d

Values are given as mean ± SD from six rats in each group. Values with different superscript letters (a–d) in the same column differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal non-enzymatic antioxidants

The levels of non-enzymatic antioxidants in the rat kidney of control and experimental rats are illustrated in Table 4. A significant (P < 0.05) decrease in the levels of the non-enzymatic antioxidants GSH, TSH, and vitamins C and E in the kidney of fluoride-treated rats was observed when compared to the control group. Co-treatment with EGCG along with fluoride significantly (P < 0.05) enhanced the level of these non-enzymatic antioxidants and brought them to near normal levels compared with rats treated with fluoride alone. Rats administered EGCG alone exhibited a significant (P < 0.05) increase in the level of these non-enzymatic antioxidants when compared to the control rats.

Table 4

Changes in the levels of renal status of GSH, TSH, vitamin C, and vitamin E of control and experimental rats.

Groups	GSH (μg/g protein)	TSH(μg/g protein)	Vit. C (μmol/mg/tissue)	Vit. E (μmol/mg/tissue)
	2.75 ± 0.31a	10.19 ± 0.68a	0.92 ± 0.07a	0.56 ± 0.05a
EGCG	2.82 ± 0.34b	10.24 ± 0.74b	0.96 ± 0.06b	0.62 ± 0.04b
Fluoride	1.37 ± 0.16c	7.67 ± 0.52c	0.55 ± 0.04c	0.36 ± 0.02c
Fluoride + EGCG	2.51 ± 0.20d	9.98 ± 0.75d	0.76 ± 0.05d	0.47 ± 0.03d

Values are given as mean ± SD from six rats in each group. Values with different superscript letters (a–d) in the same column differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal antioxidant enzyme activities

The level of renal enzymatic antioxidant status in the control and experimental rats is shown in Table 5. A significant (P < 0.05) decrease in the activities of renal antioxidant enzymes, namely superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione-S-transferase (GST), glutathione reductase (GR) and glucose-6-phosphate dehydrogenase (G6PD) was observed in the fluoride-intoxicated kidney tissues when compared to those from the control rats. Pretreatment of rats with EGCG along with fluoride showed a significant (P < 0.05) increase in the activities of these antioxidant enzymes when compared with rats treated with fluoride alone. Administration of EGCG alone produced a significant (P < 0.05) enhancement of these enzyme activities when compared with those from control rats.

Table 5

Changes in the levels of renal enzymatic antioxidants SOD, CAT, GPx, GST, GR and G6PD in control and experimental rats.

Groups	SOD	CAT	GPx	GST	GR	G6PD
Control	11.6 ± 0.8a	44.1 ± 3.2a	5.35 ± 0.33a	5.17 ± 0.37a	0.50 ± 0.05a	1.72 ± 0.12a
EGCG	12.3 ± 0.8b	46.6 ± 2.6b	6.20 ± 0.30b	6.38 ± 0.36b	0.68 ± 0.06b	1.82 ± 0.11b
Fluoride	7.38 ± 2.31c	26.5 ± 2.3c	3.54 ± 0.16c	4.23 ± 0.19c	0.31 ± 0.04c	1.02 ± 0.08c
Fluoride + EGCG	10.2 ± 0.9d	40.3 ± 2.7d	4.66 ± 0.39d	5.33 ± 0.25d	0.43 ± 0.02d	1.69 ± 0.20d

Values are given as mean ± SD from six rats in each group. Values with different superscript letters (a–d) in the same column differ significantly at P < 0.05 (DMRT). SOD – one unit of enzyme activity was defined as the enzyme reaction that gave 50% inhibition of NBT reduction per minute/mg protein. CAT – μmol of H2O2 consumed/min/mg protein. GPX – μmol of GSH consumed/min/mg protein. GST – μmol of CDNB-GSH conjugate formed/min/mg protein. GR – μmol of NADPH oxidized/min/mg protein. G6PD – μmol of NADPH formed/min/mg protein.

Effect of EGCG on kidney membrane bound ATPase activities

Table 6 displays the activities of renal membrane-bound Na+/K+-, Ca2+- and Mg2+-ATPase in the kidney of control and experimental rats. A significant (P < 0.05) decrease in the activities of renal membrane-bound ATPases was observed in the kidney of fluoride-treated rats as compared with control rats. However, in rats pretreated with EGCG and then treated with fluoride, there was a significant (P < 0.05) reduction in the activities of these membranes bound ATPases when compared with rats treated with fluoride alone. Normal rats treated with EGCG alone showed no significant difference in the activities of membrane-bound ATPases.

Table 6

Changes in the activities of renal membrane-bound ATPases of control and experimental rats.

Groups	Total ATPases	Na+/K+ ATPase	Ca2+ ATPase	Mg2+ ATPase
Control	1.74 ± 0.21a	0.52 ± 0.05a	0.57 ± 0.05a	0.60 ± 0.07a
EGCG	1.76 ± 0.23a	0.53 ± 0.05a	0.58 ± 0.06a	0.62 ± 0.06a
Fluoride	1.26 ± 0.12b	0.34 ± 0.04b	0.37 ± 0.03b	0.43 ± 0.04b
Fluoride + EGCG	1.64 ± 0.17ac	0.48 ± 0.06ac	0.52 ± 0.04ac	0.53 ± 0.05ac

Values are given as mean ± SD from six rats in each group. Values with different superscript letters (a–c) in the same column differ significantly at P < 0.05 (DMRT). ATPases – μg Pi liberated/min/mg protein.

Effect of EGCG on renal mRNA expression of Nrf2, HO-1, Keap-1, γ-GCS and μ-GST

Fig. 4 depicts the effect of EGCG on the mRNA expression of Nrf2, HO-1, Keap-1, γ-GCS, and μ-GST in the kidney tissues of control and experimental groups of rats. The mRNA expression of Nrf2, HO-1 and its downstream proteins such as γ-GCS and μ-GST significantly (P < 0.05) decreased with concomitant elevation of Keap-1 in the renal tissues of fluoride-treated rats. However, the altered mRNA expressions were significantly (P < 0.05) prevented and were near their normal levels by the pretreatment of fluoride-treated rats with EGCG. Conversely, group of rats treated with EGCG alone did not exhibit any statistically significant differences in gene expression of these proteins in comparison with those from the control group of rats.

Fig. 4

Effect of EGCG on mRNA expression of Nrf2, HO-1, Keap-1, γ-GCS, μ-GST, and Gapdh in kidney of control and experimental rats. Values are expressed as mean ± SD for measurements from six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal protein expression of Nrf2, HO-1, γ-GCS, μ-GST and Keap-1

Western blot analysis shows the protein expression pattern of Nrf2, HO-1, γ-GCS, μ-GST and Keap-1 in the renal tissues of control and experimental rats (Fig. 5). The levels of Nrf2, HO-1, γ-GCS and μ-GST protein expression significantly (P < 0.05) decreased with a simultaneous elevation of Keap-1 in the kidney tissues of fluoride-treated rats when compared with control rats. Pretreatment of fluoride-treated rats with EGCG showed a significant (P < 0.05) increase in the protein expression of Nrf2, HO-1, γ-GCS and μ-GST with a significant (P < 0.05) decrease in Keap-1 protein when compared with rats treated with fluoride alone. Rats treated with EGCG alone did not show any significant changes in protein expression when compared with control groups.

Fig. 5

Effect of EGCG on protein expression of Nrf2, HO-1, γ-GCS, μ-GST and Keap-1 in kidney of control and experimental rats. Protein expression was determined by Western blot analyses. Values are expressed as mean ± SD for measurements from six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal protein expression of Bax and Bcl-2

Western blot analysis shows the expression pattern of Bax and Bcl-2 proteins in the kidney tissues of control and experimental rats (Fig. 6). The level of Bax protein expression significantly (P < 0.05) increased with a significant (P < 0.05) decrease in the expression level of Bcl-2 protein in the kidney tissue of fluoride-treated rats as compared with those in control rats. Pre-treatment of fluoride-intoxicated rats with EGCG caused a significant (P < 0.05) decrease in the level of Bax with a significant (P < 0.05) increase in the level of Bcl-2 in the kidney tissue when compared to rats treated only with fluoride. Rats treated with EGCG alone did not show any alterations in their levels of Bax or Bcl-2 expression.

Fig. 6

Effect of EGCG on protein expression of apoptotic markers Bax and Bcl-2 in kidney of control and fluoride-treated rats. Protein expression was determined by Western blot analyses. Values are expressed as mean ± SD for measurements from six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal protein expression of cytochrome c, caspase-9 and caspase-3

Fig. 7 shows the Western blot analyses of cytochrome c, caspase-9 and caspase-3 in kidney tissue from control and experimental rats. The expression levels of these apoptotic markers significantly (P < 0.05) increased in the fluoride-treated rats when compared to the control rats. Pretreatment with EGCG along with fluoride produced a significant (P < 0.05) decrease in the renal tissue levels of cytochrome c, caspase-9, and caspase-3 compared with that in tissue from rats treated with fluoride alone. Rats treated with EGCG alone did not show any change in the levels of these apoptotic markers when compared with the control rats.

Fig. 7

Effect of EGCG on protein expression of cytochrome c, caspase-9 and caspase-3 in kidneys from control and experimental rats. Protein expression was determined by Western blot analyses. Values are expressed as mean ± SD for measurements from six rats in each group. Statistical significance was determined by one way ANOVA followed by post hoc t-test. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT).

Effect of EGCG on renal Kim-1

Immunohistochemical examination of Kim-1 mRNA in kidney samples from control and experimental rats is shown in Fig. 8. A significant (P > 0.05) increase in Kim-1 expression was observed in the renal proximal tubules of fluoride-treated rats when compared with that in cells from the control group. On the other hand, pretreatment of fluoride-intoxicated rats with EGCG caused significant (P > 0.05) reductions in the overexpression of Kim-1 in the kidney as compared with the group treated with fluoride alone. Rats receiving EGCG alone showed negative immunostaining for Kim-1 in their kidney tissue and were similar to that of the control group (Table 7).

Fig. 8

Immunohistochemistry of Kim-1 (400× magnification). Representative photomicrographs of Kim-1 determined by immunohistochemistry. There was no expression of Kim-1 in the inner part of the proximal regions of kidneys in control rats (A). EGCG administration itself did not induce Kim-1 expression as shown by the absence of staining in the tubular structures of the inner proximal regions (B). Fluoride-intoxicated rats strongly expressed Kim-1 (red arrow mark) in inner proximal tubules in the kidney (C). There was a marked decrease of Kim-1 expression (D) as evidenced by weak immunostaining in the proximal regions of rat kidneys pretreated with EGCG (40 mg/kg bw). Brown color indicates immunopositivity for Kim-1. Values are given as mean ± SD from six rats in each group. Bars with different superscript letters (a–c) differ significantly at P < 0.05 (DMRT). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

Table 7

Semi-quantitative histopathology scoring of renal tissue in control and experimental rats.

Groups	Control	EGCG	Fluoride	Fluoride + EGCG
Reduced glomeruli space			++++	++
Tubular dilation	−	−	+++	+
Tubular necrosis	−	−	++++	++
Tubular vacuolization	−	−	+++	+
Tubular degeneration	−	−	++++	++
Hemorrhage	−	−	+++	++
Inflammation	−	−	++++	+
Leukocyte infiltrations		−	+++	+

Scoring was done as follows: None (− = 0%), mild (+ = <25%), moderate (++ = 25–50%) severe (+++ = 50–75%) and more severe (++++ = >75%) damage.

Effect of EGCG on renal histology

Fig. 9 depicts photomicrographs of hematoxylin–eosin stained renal tissues of control and experimental groups of rats. Fig. 9A shows the section of renal tissue from control rats, demonstrating normal histology with normal glomeruli and proximal and distal convoluted tubules. Similarly, the sections of renal tissues from a control group of rats treated with EGCG alone also revealed an equivalent, normal histology (Fig. 9B). Fig. 9C and D portrays samples of renal tissue from fluoride-treated rats, exhibiting tubular cell necrosis, tubular lumen dilation, foci of denuded basement membrane, intraluminal casts, swelling, flattening, or loss of proximal tubular cells, diffuse interstitial edema, interstitial inflammatory cell infiltration, tubular degeneration, glomerular spaces, vacuolization, medullary congestion, apical blebbing and decreased cellularity of the glomeruli. Fig. 9E shows sections of renal tissues from fluoride-treated rats pretreated with EGCG, which exhibit almost normal glomerular, renal tubular and interstitial tissue.

Fig. 9

Photomicrographs of kidney sections of control and experimental rats stained with hematoxylin-eosin under light microscopy. (A) Control rat kidney showing normal renal corpuscles formed from tufts of glomerular capillaries surrounded by Bowman's space (H&E, 200×). (B) Rat kidney treated with EGCG alone showing normal glomerulus (G), proximal (PT) and distal convoluted tubules (DT) (H&E, 200×). (C and D) Fluoride-treated rat kidney showing glomerular space (GS), tubular degeneration (TD), hemorrhage (HM), tubular renal epithelial vacuolization (VC), glomerular atrophy, dilatation or vascular congestion and necrosis in the medullary area of fluoride-treated rats (H&E, 200×). (E) EGCG + fluoride group displaying a marked improvement in renal histology, which is comparable to that of the control group (H&E, 400×).

Discussion

The present investigation demonstrates the renoprotective potential of EGCG against fluoride-induced oxidative stress and the resulting nephrotoxicity in rats. Oxidative stress-mediated nephrotoxicity is one of the major complications in chronic fluoride intoxication. The pathogenesis of fluoride nephrotoxicity is multifactorial in which ROS generation plays a crucial role [37]. Renal toxicity of fluoride mainly depends on diffusion of fluoride ion in the form of hydrogen fluoride [38]. Fluoride is freely filtered through glomerular capillaries and then undergoes a variable degree of tubular reabsorption. Fluoride can impair the function of mitochondria, diminishing cellular respiration, enhance mitochondrial production of free radicals and consequently lead to cell death and renal dysfunction. Thus, oxidative stress plays a decisive role in the development of renal dysfunction upon chronic fluoride intoxication.

Body weight as well as organ weight alterations are used as an effective indicator for the deterioration of the health status of the animal. In addition to body weight, we assessed food and water intake and changes in the relative and absolute kidney weight of all the groups during the experimental period. It has been reported that fluoride accumulation causes disturbances in total body weight and absolute and relative kidney weights of rats, which may be due to the fluoride-induced oxidative damage to the renal tubular cells [39]. Our results are in agreement with this report that fluoride-treated rats also exhibited a decreased intake of food and water accompanied with retardation of growth rate and alteration in absolute and relative kidney weight. All these morphological changes observed in fluoride-intoxicated rats were effectively ameliorated by pretreatment with EGCG.

Fluoride-induced nephrotoxicity is a well-documented event. Renal injury due to fluoride intoxication could be assessed by measuring the serum and urinary levels of urea, uric acid, and creatinine, and the creatinine clearance, which were used as early indicators of renal dysfunction [40]. The elevated levels of urea, uric acid, and creatinine and the diminished creatinine clearance in the fluoride-treated rats indicate the development of glomerular injury and renal dysfunction. Pretreatment of fluoride-intoxicated rats with EGCG decreased levels of nephrotoxic markers. EGCG has already been demonstrated to scavenge reactive oxygen and nitrogen species, preventing the lipid peroxidation, protein carbonylation and thereby restoring the altered serum and urinary renal markers. Besides its antioxidant activity, a number of other interesting properties of EGCG have also been demonstrated, particularly its effect on membrane stabilization [41].

The present study showed that fluoride intoxication significantly elevated the levels of TNF-α, NO, IL-6 and NF-kB in renal tissue. Recent studies reveal that activation of NADPH oxidase (Nox) produces ROS along with increased production of pro-inflammatory cytokines, which are the critical mediators of fluoride-induced oxidative stress and inflammation [42]. TNF-α is a pro-inflammatory cytokine that in turn triggers a cascade of interleukins like IL-1β, IL-6 and IL-8. Elevated ROS levels upon fluoride intoxication orchestrates an upsurge of a plethora of cytokines leading to renal damage. In addition, it has been demonstrated that increased NO production is also implicated in fluoride-mediated cytotoxicity and oxidative damage. This can be explained by the ability of TNF-α to up-regulate iNOS. Excess NO reacts with superoxide anion to generate peroxynitrite radical, which then causes further cellular damage by oxidizing and nitrating macromolecules in the renal tissue. EGCG pretreatment significantly suppressed the overproduction of TNF-α, NO, IL-6 and reduced the level of NF-kB in the renal tissue of rats exposed to fluoride. The nephroprotective efficacy of EGCG may be attributed with its ability to inhibit the activation of the NF-kB signaling pathway, which promotes the transcription of Nox, TNF-α and iNOS genes [43].

In the present investigation, fluoride-treated rats exhibited a higher level of renal lipid peroxides, hydroperoxides and protein carbonyls and a significant decline in antioxidant profiles, clearly signifying the existence of oxidative stress. The results of the present study are also in line with the findings of Nabavi et al. [40], in which fluoride intoxication notably elevated renal lipid peroxidation. Increased lipid peroxidation may lead to a progressive diminution of glomerular function and the excessive accumulation of extracellular matrix proteins in the glomerular capillaries and mesangium, eventually leading to glomerular sclerosis and renal dysfunction. However, pretreatment with EGCG significantly decreased the level of lipid peroxides, hydroperoxides and protein carbonyls in renal tissue. This normalization may be accomplished by the antioxidant and free radical quenching nature of EGCG, because EGCG has been reported to protect cells from cell death mediated by oxidative stress and lipid peroxidation [44].

Fluoride intoxication is often associated with a significant decline in the level of intracellular non-enzymatic antioxidants such as GSH, TSH, vitamin C and E and elevation in the levels of pro-oxidants such as reactive free radicals and electrophilic substances that eventually result in oxidative renal dysfunction. Diminished levels of antioxidants indicate oxidative stress and lead to the oxidative damage of macromolecules in the renal tissue [40]. However, pretreatment with EGCG markedly returned GSH, TSH, and vitamins C and E in the renal tissue of fluoride-intoxicated rats to near-normal levels. Polyphenols have been reported to enhance the activity of γ-glutamylcysteine synthetase and produce simultaneous increases in the intracellular GSH level [45]. It has been demonstrated that polyphenols like EGCG, owing to their intermediate redox potential and physiochemical characteristics, can probably act as an interface between vitamins C and E and thereby regulate the antioxidant status of an organism during oxidative stress [46].

In the present study, we observed a sharp decline in the levels of antioxidant enzymes in the renal tissue of fluoride-treated rats due to overproduction of ROS. Decreases in the activities of GPx, GST, GR and G6PD may be due to the reaction of their —SH groups with lipid peroxidation products and free fluoride ions, leading to their inactivation. The inhibition of these enzymes not only reflects oxidative stress, but also exposes the cells to further oxidative damage, because these are the essential enzymes in cellular protection against ROS. However, pretreatment with EGCG in fluoride-intoxicated rats significantly improved the activities of these antioxidant enzymes, thus suggesting its role in scavenging the free radicals generated by fluoride. Zhou et al. [47] reported that the antioxidant nature of EGCG is mainly mediated through the activation of antioxidant enzymes at the gene level.

The assessment of membrane-bound enzyme activities like ATPases indicates that modifications occur in membranes under pathological conditions [48]. The peroxidation of membrane lipids not only alters the structure and functional integrity of cell membranes, but also affects the activities of various membrane-bound enzymes, including ATPases, which in turn lead to disruption of cellular homeostasis [49]. In the present study, a significant decline in the activities of membrane-bound total ATPases in the kidney was recorded in fluoride-treated rats. It is generally accepted that due to the high affinity for —SH groups, fluoride binds fervently to various proteins including ATPases and inactivates them. Pretreatment of fluoride-intoxicated rats with EGCG significantly sustained the activities of membrane-bound ATPases. This could be due to the capacity of EGCG to protect the —SH group from the oxidative damage through the inhibition of peroxidation of membrane lipids and stabilization of the membrane [50].

Nuclear factor erythroid 2 p45 (NF-E2)-related factor (Nrf2) plays a key role in regulating induction of phase II antioxidant enzymes. In addition to induction of antioxidant enzymes, Nrf2 has been shown to influence directly or indirectly expression of a battery of genes that are involved in inflammation, cell growth, apoptosis, cell adhesion, among other processes. Thus, activation of Nrf2 is considered to be an important molecular target of many chemopreventive agents [51], [52]. The present study showed that the expression of Nrf2, HO-1, GCS, and GST were decreased with a concomitant increase in Keap-1 in the renal tissue of fluoride-intoxicated rats. However, pretreatment with EGCG significantly increased the levels of Nrf2 by the HO-1 signaling pathway, enhanced its nuclear translocation with subsequent ARE binding, and downregulated the Keap-1 protein in the renal tissue; these results agree with the findings of Tsai et al. [53]. Na and Surh [54] reported that the antioxidant and cytoprotective mechanism of EGCG is mainly mediated through its ability to activate the Nrf2 pathway. Hence, this investigation should be considered as an innovative assessment for the renoprotective action of EGCG against fluoride intoxication in rats.

Bcl-2 family proteins are key regulators of physiological and pathological apoptosis. The family consists of both cell death promoters, such as Bax and Bad, and cell death inhibitors, which include Bcl-2, Bcl-X, and others. It has been demonstrated that the high ratio of Bax/Bcl-2 is associated with greater vulnerability to apoptotic activation [55]. In the present study, we confirmed that fluoride may exert its apoptotic effects through down-regulating Bcl-2 while up-regulating Bax and increasing the ratio of Bax to Bcl-2. Pretreatment with EGCG increased the level of Bcl-2 and decreased the level of Bax, suggesting that EGCG exhibits an antiapoptotic effect during fluoride-induced apoptosis through the modulation of the Bcl-2 family [56].

Caspase family proteases play an indispensable role during the process of apoptosis. In the present study, fluoride-treated rats showed increased levels of cytochrome c, caspase-9, and caspase-3 in renal tissue, which denotes the role of the mitochondrial-mediated intrinsic pathway of apoptosis upon fluoride intoxication. Pretreatment of fluoride-treated rats with EGCG significantly decreased the level of mitochondrial cytochrome c, caspase-9 and caspase-3 in the renal tissue. The antiapoptotic activity observed with EGCG treatment can be attributed to its free-radical scavenging activity, anti-inflammatory action with reduced TNF-α production, and inhibition of NF-kB [43].

Kidney injury molecule-1 (Kim-1), which is also known as hepatitis A virus cellular receptor 1 (Havcr1), is a type I transmembrane protein that is not detectable in normal kidney tissue, but is expressed at high levels in dedifferentiated proximal tubular epithelial cells after ischemic or toxic injury [57]. The present study showed that fluoride-intoxicated rat kidney proximal tubules exhibited an elevated level of Kim-1. These results suggest that increased levels of ROS by fluoride led to sustained stress in the renal proximal tubule, causing irreparable kidney injury. These findings are inconsistent with the results of Karaoz et al. [58] in fluoride-intoxicated rats. Pretreatment of fluoride-treated rats with EGCG significantly decreased the level of Kim-1. This may be mainly due to the ability of EGCG to balance the oxidant-antioxidant status, thereby regulating the release of inflammatory mediators [43].

The renoprotective nature of EGCG is further substantiated by the histology results. The histopathology observations of fluoride-treated rats showed tubular necrosis, tubular degeneration, hemorrhage, inflammatory infiltration, swelling of tubules and vacuolization in the renal tissue. This could be due to the accumulation of free radicals as a consequence of increased lipid peroxidation by free fluoride-ions. The increased formation of lipid peroxides and protein carbonyls leads to loss of membrane integrity and other pathological alterations in the fluoride-treated kidney tissue. Pretreatment with EGCG markedly diminished the significant pathology changes provoked by fluoride. This can be attributed to the antiradical, antioxidant, anti-inflammatory and chelating efficacy of EGCG, which significantly reduced the oxidative stress, leading to the reduction of pathology alterations and restoration of normal physiological state of the organism. Further, these membrane-stabilizing properties of EGCG may provide additional improvements in the pathology alterations caused by fluoride in the renal tissue of rats.

Reports in the literature showed that catechins possess many of the structural components that contribute to their antioxidant property. Catechins have a gallate moiety esterified at the third position on the C-ring, catechol groups (3,4,5-trihydroxyl groups) on the B-ring, and hydroxyl groups at the fifth and seventh positions on the A-ring (Fig. 1). The potent free radical scavenging activity of EGCG was attributed to the presence within the C-ring of the gallate group. It was also observed that the more hydroxyl groups that the catechin (EGCG) possesses, the more effective is the free radical scavenging effects [59]. Further, a well-known electrophile quercetin exerted a protective effect against oxidative stress through the upregulation of Nrf2 [60]. EGCG itself is an electrophile (—CO—) and, therefore, acts as a Micheal acceptor and is able to modify the cysteinyl thiol groups in Keap1, suggesting that a possible structure-activity relationship exists between the chemical backbone of the polyphenols and the degree of Nrf2 activation [61].

Consequently, we assume that EGCG may downregulate Keap1 activity, which leads to Nrf2 translocation into the nucleus where it can activate antioxidant genes. Our results also demonstrate that EGCG significantly decreased the fluoride-induced Keap1 activity in the renal tissue. We believe that this Keap1 inhibition may be due to the reactive nature of EGCG, which may directly interact with the cysteinyl residues present in Keap1, thereby stimulating Nrf2 dissociation (Fig. 10). Thus, the present study reveals the nephroprotective nature of EGCG in fluoride-induced oxidative renal injury in rats and provides evidence that the activation of Nrf2/Keap 1 signaling by EGCG may be responsible for the attenuation of fluoride-induced oxidative stress and the consequent renal inflammation and apoptosis. Further detailed studies are in progress to elucidate the precise molecular mechanism by which EGCG reduces fluoride-induced renal toxicity in rats.

Fig. 10

Scheme showing the nephroprotective mechanism of EGCG against fluoride-induced renal toxicity in rats.