Molecular characterization of vancomycin-resistant Staphylococcus aureus strains isolated from clinical samples: A three year study in Tehran, Iran.

INTRODUCTION: Emergence of vancomycin-intermediate Staphylococcus aureus (VISA) and vancomycin-resistant S. aureus (VRSA) strains has led to great concern in global public health in both developing and developed countries. This study investigated distribution and molecular characterization of VRSA strains in Tehran's hospitals using a combination of molecular typing methods.
MATERIALS AND METHODS: A total of 1789 S. aureus isolates obtained between 2014 and 2017 and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Resistance to vancomycin was determined by E-test method. After confirmation of the isolated VRSA strain, genetic analysis was performed by evaluating vanA and vanB genes presence.The presence of resistance (ermA, ermB, ermC, mupA, msrA, msrB, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa) and toxin (etb, eta, pvl, tst) encoding genes was investigated by the polymerase chain reaction (PCR) technique.
RESULTS: Of all S. aureus tested isolates, four isolates were confirmed as VRSA isolates and two isolates confirmed as VISA isolates. ST5- SCCmec II/t002 and ST239-SCCmec III/t037 strains had MIC values of 512μg/ml, ST239-SCCmec III/t037 and ST8-SCCmecIV/t008 strains had MIC values of 64μg/ml and ST22-SCCmec IV/t790 and ST239-SCCmec III/t030 strains had MIC values ≥ 8 μg/ml. pvl-encoding gene was confirmed in ST8-SCCmecIV/t008 and ST22-SCCmec IV/t790 strains. The isolates differed in the carriage of resistance and toxin encoding genes.
CONCLUSIONS: The study revealed the existence of VRSA strains in capital of Iran, Tehran. To our knowledge, this is the first report of ST239-SCCmec III/t037 as VRSA strain. These findings support the need for future surveillance studies on VRSA strains to keep the emergence and transmission of these isolates to a minimum.

Introduction

Staphylococcus aureus (S. aureus), a major cause of infection in either hospitals or within communities across the world, has developed resistance to commonly prescribed antimicrobial agents [1]. The most important factor contributing to the successful extensive distribution of this nosocomial pathogen is stated to be its remarkable ability to acquire resistance to new antimicrobial agents [2]. Shortly after the introduction of penicillin as a first therapeutic option for the treatment of infections caused by penicillin-resistant S. aureus, methicillin-resistant S. aureus (MRSA) emerged in the 1960s, and since the 1980s, vancomycin has become the drug of choice for the treatment of serious MRSA infections in many healthcare institutions [3]. Although vancomycin has been the most reliable therapeutic agent against infections caused by MRSA, there has been an alarming emergence of S. aureus strains with decreased susceptibility to vancomycin and other glycopeptides [3, 4]. The first vancomycin-resistant Enterococcus faecalis (VRE) strain was reported in France in 1988. The acquisition of mobile genetic elements containing the vanA gene by S. aureus from E. faecium in laboratory mice caused great concern about this transfer in nature [5]. In 1997, the first clinical isolate of S. aureus with intermediate resistance to vancomycin was reported from Japan. Additional vancomycin-intermediate S. aureus (VISA) strains (minimum inhibitory concentration [MIC] equal to 8 μg/ml) have been isolated in several countries, including the United States [6], France [7], Brazil [8], South Korea [9], and other countries [10]. The thickened and poorly cross-linked cell wall layer of a VISA strain presents increased amounts of D-Ala-D-Ala building blocks of cell wall as a binding site for vancomycin, resulting in diminished effects of vancomycin due to competition [4]. The first vancomycin-resistant Staphylococcus aureus (VRSA) strain (MIC>256 μg/ml) due to the acquisition of the vanA was reported in 2002 from Michigan [11], and then, in the same year, in Pennsylvania and in 2004 in New York [5, 12]. A high level of resistance to vancomycin occurs due to the function of the van gene complex. The product of the vanA gene is a ligase that leads to alteration of this dipeptide residue from D-Ala-D-Ala to D-alanyl-D-lactate (D-Ala-D-Lac), a dipeptide with substantially lower affinity for the antibiotic. The vanA gene is not found in any VISA strain [4].

Though there are few reports of vancomycin-resistant Staphylcoccus aureus (VRSA) worldwide, several cases of VRSA were reported in different provinces of Iran, including Tehran, Mashhad, Isfahan, Mazandaran, Gilan and Lorestan [13]. Based on this rationale, it seems that Iran is a hotspot region for the emergence of VRSA isolates, and their incidence may be on the rise. Keeping this in view, the current study investigated the occurrence and molecular characterization of VRSA strains in Tehran, Iran, during three years.

Material and methods

Bacterial isolation and identification

A total of 1789 S. aureus isolates were investigated in the period of three years from March 2014 to February 2017 in five university hospitals. The strains were collected from various clinical specimens including wound, blood, pus, urine, catheters and body fluids (bronchoalveolar lavage and cerebrospinal fluid). The study protocol was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences (IR.SBMU. MSP.REC.1396.148). Identification of the clinical isolates of S. aureus was performed by traditional biochemical methods including Gram staining, growth patterns on mannitol salt agar, catalase testing, rabbit plasma coagulase testing, and DNase testing. To definitively identify positive S. aureus isolates, they were subjected to polymerase chain reaction (PCR) for nucA gene [14, 15].

Detection of VRSA isolates

To screen for vancomycin resistance, all S. aureus isolates were inoculated on vancomycin agar screening medium. Vancomycin agar screen plates were prepared In-house by addition of 6 mg/L vancomycin to brain heart infusion (BHI) agar (Merck, Germany) (BHI-V6). All strains were tested for growth on BHI-V6 by spot inoculate 10 μl of each isolate with a 0.5 McFarland standard in saline onto the surface of the BHI-V6 and incubating the plate for 48 hours in ambient air at 35°C. Growth was considered as a positive result. E. fecalis ATCC 29212 was used as a vancomycin susceptible and E. fecalis ATCC 51299 was used as a reference control, in every test run [16].The isolates that had grown in vancomycin agar screening medium were further investigated to confirm the identifications [17].

Antimicrobial susceptibility testing

The antibiotic-resistance profile was determined by the Kirby-Bauer disk diffusion technique in accordance with the Clinical and Laboratory Standards Institute (CLSI) guideline [18] using 15 antibiotic discs including penicillin (PG 10 μg), ceftriaxon (CRO 30 μg), kanamycin (K 30 μg), ciprofloxacin (CIP 5μg), rifampicin (RP 5μg), clindamycin (CD 2 μg), quinupristin-dalfopristin (SYN 15μg), tetracyclin (T 30 μg), erythromycin (E 15 μg), linezolid (LZD 30 μg), teicoplanin (TEC 30 μg), amikacin (AK 30 μg), tobramycin (TN 10 μg), gentamicin (GM 10 μg), and trimethoprim- sulfamethoxazole (TS 2.5 μg). The MRSA isolates were screened using a cefoxitin disc (30 μg) on Mueller Hinton agar plates supplemented with 4% NaCl and were confirmed by the amplification of mecA gene by polymerase chain reaction (PCR) method [19]. All antibiotic disks used in this research were supplied by Mast, UK. The standard reference strain S. aureus ATCC 25923 and ATCC 29213 were used as a quality control strain in every test run.

MIC testing of S. aureus isolates

The E-test method (bioMerieux, Marcey l’Etoile, France) was used for the minimum inhibitory concentration (MIC) determination of S. aureus isolates according to the manufacturer’s instructions. The standard reference strain S. aureus ATCC 25923 and Enterococcus faecalis ATCC 51299 were used as vancomycin susceptible and resistant quality control strains in every test run. According to the CLSI guidelines, MIC breakpoints for vancomycin were defined as follows: susceptible, ≤2 μg/ml; intermediate, 4–8 μg/ml; and resistant, ≥16 μg/ml [18].

Extraction of genomic DNA

DNA of strains was extracted using the commercial kit InstaGene Matrix (BioRad, Hercules co., CA, USA). According to the manufacturer’s protocol for bacterial cells, we added lysostaphin (Sigma–Aldrich co., USA) at a final concentration of 30μg/ml for cell wall lysis. After extraction, the purity of DNA was assessed using a spectrophotometer.

Detection of resistance and toxin encoding genes

PCR was performed to determine the presence of resistance (vanA, vanB, mecA, mupA, ermA, ermB, ermC, msrA, msrB, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa) and toxin (etb, eta, pvl, tst) encoding genes. The primer sequences are presented in Table 1.

Table 1

Oligonucleotide primers used in this study.

Target	primer	Primer sequence (5´→3´)	Product size (bp)	Reference
nucA	F	GCGATTGATGGTGATACGGTT	270	[1]
	R	AGCCAAGCCTTGACGAACTAAAGC
mecA	F	AGAAGATGGTATGTGGAAGTTAG	583	[17]
	R	ATGTATGTGCGATTGTATTGC
luk-PV	F	TTCACTATTTGTAAAAGTGTCAGACCCACT	180	[20]
	R	TACTAATGAATTTTTTTATCGTAAGCCCTT
tst-1	F	TTATCGTAAGCCCTTTGTTG	398	[17]
	R	TAAAGGTAGTTCTATTGGAGTAGG
eta	F	GCAGGTGTTGATTTAGCATT	93	[2]
	R	AGATGTCCCTATTTTTGCTG
etb	F	ACAAGCAAAAGAATACAGCG	226	[2]
	R	GTTTTTGGCTGCTTCTCTTG
ant(4΄)-Ia	F	AATCGGTAGAAGCCCAA	135	[2]
	R	GCACCTGCCATTGCTA
aac(6΄)-Ie/aph(2˝)	F	CCAAGAGCAATAAGGGCATACC	222	[2]
	R	CACACTATCATAACCACT
aph(3΄)-IIIa	F	CTTGATCGAAAAATACCGCTGC	269	[2]
	R	TCATACTCTTCCGAGCAAA
ermA	F	TATCTTATCGTTGAGAAGGGATT	139	[21]]
	R	CTACACTTGGCTGATGAAA
ermB	F	CTATCTGATTGTTGAAGAAGCATT	141	[21]
	R	GTTTACTCTTGGTTTAGGATCAAA
ermC	F	AATCGTCAATTCCTGCATGT	299	[21]
	R	TAATCGTGGAATACGGGTTTG
msrA	F	GGCACAATAAGAGTG TTTAAAGG	940	[22]
	R	AAGTTATATCATGAATAGATTGTCCTGTT
msrB	F	TATGATATCCATAATAATTATCCAATC	595	[22]
	R	AAGTTATATCATGAATAGATTGTCCTGTT
mupA	F	CCCATGGCTTACCAGTTGA	1158	[23]
	R	CCATGGAGCACTATCCGA
tetM	F	AGTGGAGCGATTACAGAA	158	[2]
	R	CATATGTCCTGGCGTGTCTA
vanA	F	GGCAAGTCAGGTGAAGATG	713	[17]
	R	ATCAAGCGGTCAATCAGTTC
vanB	F	GTGACAAACCGGAGGCGAGGA	430	[24]
	R	CCGCCATCCTCCTGCAAAAAA

Multiplex PCR amplification for SCCmec typing

Different SCCmec types were determined by specific primers are described by Boye et al [25]. SCCmec types were identified by comparing the banding patterns of MRSA to ATCC 10442 (SCCmec type I), N315 (SCCmec type II), 85/2082 (SCCmec type III), MW2 (SCCmec type IVa), WIS (SCCmec type V), as reference strains.

spa typing

Spa typing was performed as described by Harmsen et al. [26] spa gene PCR products were subjected to DNA sequence analysis, and their nucleotide sequences on both strands were determined using an ABI Prism 377 automated sequencer (Applied Biosystems, Perkin-Elmer co., Foster City, CA). Sequence editing was done using Chromas software (version 1.45, Australia). Edited sequences were assigned to particular spa types according to the guidelines described by a Ridom SpaServer database (http://www.spaserver.ridom.de).

Multi-locus sequence typing (MLST)

MLST with standard primers introduced by the MLST database was performed on all isolates based on seven housekeeping genes (arcC, aroE, glpF, gmK, pta, tpiA and yqiL) as described by Enright et al. Isolates were assigned a sequence type (ST) according to the MLST website (http://www.mlst.net/).

Results

Of 1789 S. aureus isolates analysed, four isolates were resistant to vancomycin and were confirmed as VRSA, based on MIC results and vanA gene detection. All strains were isolated from hospitalized patients. Two of these isolates had MIC values of 512μg/ml, two strains had MIC values of 64μg/ml. Intermediate resistance to vancomycin was observed in two isolates with MIC ≥ 8 μg/ml. The vanA gene was not found in VISA strains. It is worth noting that none of isolates carried vanB genes. All 6 strains were methicillin-resistant and carried mecA. All 4 case patients infected with VRSA had received vancomycin therapy during the 11 months prior to infection while 2 cases patient infected with VISA had not had any treatment with vancomycin but had previously received glycopeptides. Interestingly, all the isolates were found to be positive for tst encoding gene. According to the MLST method, VRSA isolates were assigned to three different sequence types (STs) (ST5, ST239, and ST8). spa typing revealed that spa types t002, t037, and t008 belonged to VRSA isolates, while spa types t790 and t030 were isolated from VISA isolates. None of the isolates carry all the resistance encoding genes simultaneously. All VRSA and VISA isolates were MDR. Surprisingly, ST8-SCCmecIV/t008 isolate with vancomycin MIC 64 μg/ml does not carry the vanA gene. Molecular characterization of VRSA and VISA strains are described in Table 2.

Table 2

Molecular characterization of VRSA and VISA strains.

Molecular types	Sample/ward	Phenotypic resistance	Genotypic resistance	Toxin profile	Vancomycin MIC (mg/ml)	MIC Interpretive Breakpoints R/I/Sa μg/mL
						≤ 2	4–8	≥16
ST5- SCCmec II/t002	Throat/ICU	PG,CRO,K,CIP,CD,T,E,TEC,AK,TN,GM,TS	vanA, mecA, ermA, ermB, msrA, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa	tst, eta, etb	512	Resistant
ST239-SCCmec III/t037	bronchial aspirate/Internal	PG,CRO,K,CIP,RP,CD,T,E,TN,GM	vanA, mecA, ermA, ermB, msrA, tetM, ant (4΄)-Ia, aph (3΄)-IIIa	tst	512	Resistant
ST239-SCCmec III/t037	Wound/ICU	PG,CRO,K,CIP,RP,CD,T,E,AK,TN,GM,TS	vanA, mecA, ermA, ermB, ermC, msrB, tetM, ant (4΄)-Ia,	tst	64	Resistant
ST8-SCCmecIV/t008	Blood/Oncology	PG,CRO,K,CIP,RP,CD,T,E,AK,TN,TS	mecA, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa	pvl, tst	64	Resistant
ST22-SCCmec IV/t790	Blood/ICU	PG,CRO,CD,T,E,SYN,AK,TN,GM,TS	mecA, ermA, ermB, ermC, msrA, msrB, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa	pvl,tst, eta, etb	8	Intermediate Resistant
ST239-SCCmec III/t030	Catheter/Infectious	PG,CRO,K,CD,T,E,AK,TN,GM,TS	mecA, ermA, ermB, ermC, msrA, msrB, tetM, ant (4΄)-Ia, aac (6΄)-Ie/aph (2˝), aph (3΄)-IIIa	tst	8	Intermediate Resistant

PG: penicillin, CRO: ceftriaxone, K: kanamycin, CIP: ciprofloxacin, RP: rifampicin, CD: clindamycin, SYN: quinupristin-dalfopristin, T: tetracyclin, E: erythromycin, LZD: linezolid, TEC: teicoplanin, AK: amikacin, TN: tobramycin, GM: gentamicin, TS: trimethoprim- sulfamethoxazole.

a MIC breakpoints applied were those recommended for S. aureus by the Clinical and Laboratory Standards Institute (CLSI), susceptible, ≤2 μg/ml; intermediate, susceptible, ≤2 μg/ml; intermediate, 4–8 μg/ml; and resistant, ≥16 μg/ml; and resistant, ≥16 μg/ml [18].

Discussion

In the past few years, several antibiotics have been noted to be less effective in the treatment of S. aureus infections, leading to treatment failure. In these contexts, VRSA and VISA strains are highly prominent. Isolates of vancomycin resistant S. aureus have emerged in many parts of the world, such as the United States [11, 12], Japan [27], India [28, 29], and Iran [30, 31]. Although VRSA strains have hitherto been thought to be rare, the current findings on the prevalence of VRSA strains in Iran have demonstrated a steadily increased rate of VRSA isolates. In this study, we found an MRSA strain with high levels of resistance to vancomycin (MIC 512μg/ml) isolated from patient who had serious respiratory tract infection with long-time hospitalization and previous use of vancomycin. Our data showed that this isolate belonged to ST5-SCCmec II/t002 clone. Most of the previously isolated VRSA strains in the United States belong to sequence type 5 (ST5), one of the widespread MRSA clones [32]. It is noteworthy that other genetic and phenotypic backgrounds of our isolate were similar to those of its US counterpart, suggesting that the Iranian isolate has a strong relationship with the ST5 US strain. Several studies have reported variable resistance and virulence markers in ST5 strains [33]. In the present study, ST5-SCCmec II/t002 clone was positive for eta, etb and tst genes and carry aminoglycoside, macrolide and tetracycline resistance genes. According to the antibiotic susceptibility testing, this strain was resistant to most of the tested antibiotics except rifampicin, quinupristin-dalfopristin and linezolid, which is in contrast to previous studies that reported susceptible VRSA isolates to many of the antibiotics [12, 34, 35].

It is documented that ST239 is divided into three clades—the South American, European, and Asian clades. Furthermore, multi-resistant ST239 and positive tst isolates are much more frequent in the USA, Europe, and some Asian countries [36]. Our data showed that ST239-SCCmec III/t037 VRSA strains were PVL-negative, but was positive for tst gene in addition to genes, vanA, mecA, ermA, ermB, ermC, tetM, ant (4΄)-Ia, aph (3΄)-IIIa. These strains were significantly resistant to many antibiotic groups. This finding is in contrast to the results of a study in Iran by Havaei et al. [37], who reported ST239-SCCmec III/t037 as a VISA strain with MIC 4 μg/ml, which was obtained from the blood sample of a 50-year-old man. ST239 as a VISA strain was previously reported from Pennsylvania [38] and New Zealand [39]. Also, a study conducted in Iran by Azimian et al. [17] reported one VRSA isolate separated from the bronchial aspirate of a 26-year-old man that belonged to ST1283-SCCmec III/t037, a single locus variant of ST239 (an endemic clone in most Asian countries except South Korea and Japan). To the best of our knowledge, this is the first report of ST239-SCCmec III/t037 as VRSA strain. Literature have shown that a single point mutation in position 483 of the guanylate kinase gene (gmk) with the replacement of thymine by guanine (T → G), in ST239 can lead to the generation of ST1283. ST239, as previously reported, is a strain with a high level of resistance to vancomycin in Iran that should be more considered [17].

In contrast to previously published data from Iran, which reported ST8-t008 isolate as a VISA strain [37], in this study we found ST8-SCCmecIV/t008 isolate with vancomycin MIC of 64μg/ml that was isolated from the blood sample of a 34-year-old man. The result of the present study shows a significant rise in the resistance of vancomycin in ST8 isolate in Iran. In line with Tiwari et al.’s study in 2006 from India [40], ST8-SCCmecIV/t008 isolate was noted to be a VRSA van gene-negative strain. The absence of vanA gene in the present isolates does not rule out that these strains are not VRSA. It is thought that cell wall thickening may be responsible for the development of vancomycin resistance in these isolates. Although antimicrobial resistance pattern in ST8-SCCmecIV/t008 isolates may vary, trimethoprim- sulfamethoxazole resistance in ST8 isolates is reported by several investigators [41], which is in accordance with the present study. This is believed to be the first report of ST8-VRSA from Tehran, Iran, as well as Asia, and may soon become a global problem. This emergence of ST8-SCCmecIV/t008 VRSA/VISA may be attributed to the building of selective pressure of vancomycin as the main antimicrobial agent available to treat life-threatening infections with MRSA.

VISA strains with a heterogeneous genetic background were reported in several studies from Iran [1], India [40], US [38], Bangladesh [42], New Zealand [39] and China [43]. There is not enough information about the prevalence rate of VISA strains in Iran; however, in 2005, Saderi et al. reported the prevalence rate of 1.8% for VISA isolated from clinical samples based on the evaluation of four teaching hospitals in Tehran [44]. Havaei et al. reported five VISA strains (2.9%) amongst 171 S. aureus isolated from different Iranian hospitals [37]. Based on literature, there is an upward trend in the prevalence of VISA strains in Iran [1, 37]. In the present survey, two isolates with intermediate-resistance to vancomycin were related to the ST22-SCCmec IV/t790 and ST239-SCCmec III/t030 clones. Our result of VISA genotyping was the same as the previous report by Goudarzi et al. [1] from Iran, who reported two VISA isolates with genetically characteristic SCCmec type IV, spa type t790, and ST22.

In this study, it was shown that other VISA isolates belonged to ST239-SCCmec III/t030 clone, which is in accordance with Bozdogan et al.’s study, in which intermediate resistance to vancomycin in MRSA ST239 clone was reported [38]. ST239 VISA was also previously identified in Iran [37] and New Zealand [39]. The current finding on the prevalence of VRSA strains further demonstrates the necessity to implement infection-control precautions to prevent the spread of resistance to vancomycin in our hospitals.

Conclusion

To summarize, the results of this study showed that VRSA and VIS isolated in belonged to diverse genetic backgrounds which should be seriously taken into consideration. Although we confined our study within Tehran, the emergence of VRSA and VISA strains might also be prevalent in other provinces of Iran. Based on our antimicrobial susceptibility testing results, linezolid may be the most effective drug against VRSA strains. It seems that performing continuous and nationwide surveillance programs to map the vancomycin susceptibility pattern in our country is necessary.

Dataset.

(RAR)

Click here for additional data file.