Literature DB >> 17067393

Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India.

Hare Krishna Tiwari1, Malay Ranjan Sen.   

Abstract

BACKGROUND: Glycopeptides such as vancomycin are frequently the antibiotics of choice for the treatment of infections caused by methicillin resistant Staphylococcus aureus (MRSA). For the last 7 years incidence of vancomycin intermediate S. aureus and vancomycin resistant S. aureus (VISA and VRSA respectively) has been increasing in various parts of the world. The present study was carried out to find out the presence of VISA and VRSA in the northern part of India.
METHODS: A total 1681 staphylococcal isolates consisting of 783 S. aureus and 898 coagulase negative staphylococci (CoNS) were isolated from different clinical specimens from various outpatient departments and wards. All S. aureus and 93 CoNS were subjected to MIC testing (against vancomycin, teicolplanin and oxacillin); Brain Heart Infusion (BHI) vancomycin screen agar test; disc diffusion testing, and PCR for mecA, vanA and vanB genes detection.
RESULTS: Out of 783 S. aureus two S. aureus strains were found to be vancomycin and teicoplanin resistant (one strain with MIC 32 microg/ml and the other strain with MIC 64 microg/ml); six strains of S. aureus have shown to be vancomycin intermediate (two strains with MIC 16 microg/ml and four strains with MIC 8 microg/ml); and two strains with teicoplanin intermediate (MIC 16 microg/ml). One CoNS strain was resistant to vancomycin and teicoplanin (MIC 32 microg/ml), and two CoNS strains were intermediate to vancomycin and teicoplanin (MIC 16 microg/ml). All VRSA, VISA and vancomycin resistant CoNS had shown growth on BHI vancomycin screen agar (vancomycin 6 microg/ml) and were mecA PCR positive. None of these isolates have demonstrated vanA/vanB gene by PCR.
CONCLUSION: The present study reveals for the first time emergence of VISA/VRSA from this part of world and indicates the magnitude of antibiotic resistance in and around the study area. The major cause of this may be unawareness and indiscriminate use of broad-spectrum antibiotics.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 17067393      PMCID: PMC1634751          DOI: 10.1186/1471-2334-6-156

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

Staphylococcus aureus has long been recognized as a major pathogen of hospital acquired infections. Over the last decade, methicillin resistant S. aureus (MRSA) strains have become endemic in hospitals worldwide. In addition, it is now incipient community pathogen in many geographical regions [1]. MRSA is important because, in addition to being methicillin resistant, most strains are also resistant to other β-lactam antibiotic, with the exception of glycopeptide antibiotics [2,3]. In 1980s, because of widespread occurrence of MRSA, empiric therapy for staphylococcal infections (particularly nosocomial sepsis) was changed to vancomycin in many health care institutions. Vancomycin use in United States also increased during this period because of the growing numbers of infections with Clostridium difficile and coagulase negative staphylococci (CoNS) in health care institutions [4,5]. Thus, the early 1990s have shown a discernible increase in vancomycin use. As a consequence, selective pressure was established that eventually lead to the emergence of strains of S. aureus and other species of staphylococci with decreased susceptibility to vancomycin and other glycopeptides [6]. In 1997, the first strain of S. aureus with reduced susceptibility to vancomycin and teicoplanin was reported from Japan [7]. Shortly after, two additional cases were reported from United States [8]. However, first clinical isolate of vancomycin resistant S. aureus (VRSA) was reported from United States in 2002 [9]. More recently some workers have reported vancomycin resistant staphylococcal stains from Brazil [10] and Jordan [11]. Strains of Vancomycin Intermediate S. aureus (VISA) with vancomycin MIC of 8 μg/ml have been reported from Japan [7], United States [12-14], France [15], United Kingdom [16] and Germany [17]. Most of these isolates appear to have developed from preexisting MRSA infections. Assadullah et al from India have reported reduced susceptibility of vancomycin against MRSA and CoNS [18]. Keeping this in view we performed extensive longitudinal study of total 1681 staphylococcal strains for the assessment of current situation of vancomycin resistance in northern part of India. This is the first report of VRSA emergence from a tertiary care hospital from this part of world.

Methods

Staphylococcal Isolates

A total 1681 staphylococcal isolates consisting of 783 S. aureus and 898 CoNS were investigated for the period of three years from August 2002 to July 2005. The strains were collected from various clinical specimens including pus, urine, wound swabs, catheters, blood, sputum and CSF from the patients of different inpatient and outpatient departments of the University Hospital, BHU. This is a tertiary care teaching hospital, which serves the population of eastern region of Uttar Pradesh and adjoining districts of Bihar, Jharkhand and Madhya Pradesh, India.

Media and Culture Conditions

All clinical samples except urine were first inoculated onto blood agar (Hi-Media, India) and MacConkey agar (Hi-Media, India) plates whereas the urine samples were inoculated only on CLED agar (Hi-Media, India) plates. The plates were incubated at 37°C for 24–48 h. The identification of isolates was done according to standard method described elsewhere [19].

Growth on Mannitol Salt Agar

All staphylococcal isolates were again inoculated onto mannitol salt agar (Hi-Media, India) and plates were incubated at 37°C for 24–48 h. Mannitol fermentation was observed and recorded.

Coagulase Test

Slide coagulase tests of all 1681 isolates were performed by emulsifying few pure colonies of staphylococci from blood agar on undiluted rabbit plasma. Tube coagulase tests were performed by diluting the plasma in freshly prepared normal saline (1:6). Three to four pure colonies were emulsified in 1 ml of diluted plasma and the tubes were incubated at 37°C. Readings were taken at 1 h, 2 h, 3 h, and 4 h and further incubated overnight at room temperature if no clot formation was observed. S. aureus ATCC 29213 was used as control strain [19].

Latex agglutination test (Slidex Staph Plus)

Latex agglutination test on all clinical isolates was performed according to the protocols supplied by the manufacturer (Biomerurix India Ltd, New Delhi, India).

Determination of Minimum Inhibitory Concentration (MIC)

MIC of oxacillin (Hi-Media, India), vancomycin (Lilly Pharma, Giessen, Germany) and teicoplanin (Gruppo Lepetit, Angani, Italy) were determined by agar dilution method as described elsewhere [20]. Briefly, gradient plates of Mueller-Hinton agar (Hi-Media, India) were prepared with oxacillin (0.25–256 μg/ml) (with 2% NaCl), vancomycin (0.5–128 μg/ml) and teicoplanin (0.5–128 μg/ml). By direct colony suspension method 0.5 McFarland equivalent inouculum were prepared in normal saline from 18–24 h agar plate culture. The suspension was further diluted to achieve desired inoculum concentration of 105 CFU/ml. All strains were spotted onto gradient plates. Plates were incubated overnight at 35°C for any visible growth. Readings were taken according to NCCLS guidelines [20]. S. aureus ATCC 29213 and Enterococcus faecalis ATCC 29212 strains were used as vancomycin susceptible controls and E. faecalis ATCC 51299 as vancomycin resistant control.

Inoculation on BHI vancomycin screen agar

In-house prepared BHI agar (Hi-Media, India) screen plates containing 6 μg/ml vancomycin (Lilly Pharma, Giessen, Germany) were prepared. Inoculum suspensions were prepared by selecting colonies from overnight growth on nutrient agar plates. The colonies were transferred to sterile saline to produce a suspension that matches the turbidity of a 0.5 McFarland standard. The final inoculum concentration of 105 to 106 CFU per spot was prepared by adding the sterile saline to the bacterial suspension. These suspensions were inoculated onto BHI screen agar plates and were incubated for 24 h at 35°C in ambient air. Any visible growth indicated the vancomycin resistance. S. aureus ATCC 29213 and Enterococcus faecalis ATCC 29212 strains were used as a vancomycin susceptible control strains and E. faecalis ATCC 51299 as vancomycin resistant control strain.

Disc Diffusion

Disc diffusion test of Penicillin (10 U), Oxacillin (1 μg), Gentamicin (10 μg), Tobramycin (30 μg), Amikacin (30 μg), Netilmicin (30 μg), Norfloxacin (10 μg), Ciprofloxacin (5 μg), Chloramphenicol (30 μg), Erythromycin (15 μg), Tetracycline (15 μg), Trimethoprim/Sulfamethaxole (1.25/23.75 μg), Nitrofurantoin (300 μg), Vancomycin (30 μg), Cefoperazoneoxacillin/Sulbactam (75/30 μg) was carried out using Kirby-Bauer Method as described elsewhere [20]. Mueller-Hinton agar plates were overlaid with the inoculum (turbidity equivalent to that of a 0.5 McFarland Standard) of the S. aureus clinical strains. Zone diameters were measured at 24 and 48 h following NCCLS criteria [20]. S. aureus ATCC 29213 was used as reference strain.

Detection of mecA gene by PCR

Staphylococcal DNA was isolated using classical chloroform: phenol extraction method described elsewhere [21]. The oligonucleotide primers for mecA gene (mecA F 5' GTAGAAATGACTGAACGTCCGATGA 3' and mecA R 5' CCAATTCCACATTGTTTCGGTCTAA 3') and reaction condition previously reported were used [22]. A Biometra DNA thermocycler was programmed with the initial denaturation, 4 min at 94°C; 30 cycles with a 45-s denaturation step at 94°C, a 45-s annealing step at 56°C and a 30-s extension step at 72°C and 2 min extension step at 72°C and a holding step at 4°C until the sample was analyzed. The PCR products were electrophoresed, stained with 10 μM ethidium bromide and visualized by using UV transillumination. The positive tests have shown PCR product of 310 bp. S. aureus ATCC 29213, reference strain was used mecA positive control strain, and S. aureus ATCC 43300 as mecA negative control strain.

Detection of vanA and vanB genes by PCR

Staphylococcal DNA was isolated as described above [21]. Oligonucleotide primers for vanA (vanA F 5'CATGAATAGAATAAAAGTTGCAATA 3'and vanA R 5'CCCCTTTAACGCTAATACGACGATCAA 3') and vanB (vanB F 5' GTGACAAACCGGAGGCGAGGA 3' and vanB R5'CCGCCATCCTCCTGCAAAAAA 3') genes and reaction condition previously reported were used [23]. A Biometra DNA thermocycler was programmed with the initial denaturation, 10 min at 94°C; 30 cycles with a 30-s denaturation step at 94°C, a 45-s annealing step at 50°C and a 30-s extension step at 72°C and 10 min extension step at 72°C and a holding step at 4°C until the sample was analyzed. The PCR products were electrophoresed, stained with 10 μM ethidium bromide and visualized by using UV transillumination. Enterococcus faecalis A256 and Enterococcus faecalis V583 were used vanA and vanB positive control strains respectively whereas Enterococcus faecalis ATCC 29212 was used as vanA/B negative control strain.

Results

Out of 1681 staphylococcal isolates, 761 isolates were slide coagulase positive, 772 were slidex staph plus positive, and 783 were tube coagulase positive. Thus, 783 strains were confirmed as S. aureus and remaining 898 strains as CoNS. MIC of 783 S. aureus strains and 93 CoNS against oxacillin had shown that 318 S. aureus stains and 51 CoNS strains were resistant to oxacillin (MIC ≥ 4 μg/ml for S. aureus and MIC ≥ 0.5 μg/ml for CoNS). Out of 318 oxacillin resistant S. aureus strains, total two strains were found to be VRSA strains. One strain had shown vancomycin and teicoplanin MIC 32 μg/ml and the other strain with vancomycin and teicoplanin MIC 64 μg/ml. Out of 51 oxacillin resistant CoNS, one strain had shown vancomycin and teicoplanin MIC 32 μg/ml. Six strains of S. aureus were to be found vancomycin intermediate S. aureus (two strains with MIC of 16 μg/ml and four strains with MIC of 8 μg/ml). Two S. aureus strains were to be teicoplanin intermediate (MIC 16 μg/ml). The detailed description of all vancomycin intermediate/resistant S. aureus strains are given in table 1.
Table 1

Detailed description of vancomycin resistant staphylococcal strains.

StrainsNo. of IsolatesMIC vancomycin (μg/ml)MIC teicoplanin (μg/ml)SpecimensPrior vancomycin use historyWard/OPD
S. aureus* (VRSA)16464PusYesSurgery ward
S. aureus* (VRSA)13232PusYesSkin ward
S. aureus** (VISA)21616PusNoOrthopedic OPD
S. aureus** (VISA)488PusNoPost-operative ward
S. epidermidis (VRSE)13232Tip of ETTYesIntensive care unit
S. epidermidis (VISE)1116161616BloodUrineNoNoEndocrinology OPDPost-operative ward

*According to NCCLS guidelines (2000) these strains have been designated as Vancomycin Resistant Staphylococcus aureus.

**According to NCCLS guidelines (2000) these strains have been designated as Vancomycin Intermediate Staphylococcus aureus.

Detailed description of vancomycin resistant staphylococcal strains. *According to NCCLS guidelines (2000) these strains have been designated as Vancomycin Resistant Staphylococcus aureus. **According to NCCLS guidelines (2000) these strains have been designated as Vancomycin Intermediate Staphylococcus aureus. All oxacillin resistant S. aureus and CoNS strains had shown presence of mecA gene be PCR methods. All VISA, VRSA and vancomycin intermediate and resisistant CoNS strains were grown on BHI vancomycin screen agar. Disc diffusion test revealed that all vancomycin resistant staphylococcal isolates have shown antimicrobial resistance to most of the commonly used antimicrobials (table 2). However, none of theses strains could demonstrate the presence of vanA and or vanB gene by PCR.
Table 2

Resistance pattern of vancomycin resistant staphylococcal isolates to commonly tested antimicrobial agents as determined by disc diffusion method.

StrainsResistant/IntermediateSensitive
S. aureus (MIC van 64 μg/ml)Pen, Oxa, Gen, Tob, Amik, Net, Nor Cip, Chl, Ery, Tri/Sul, Cefo/Sul, VanTet, Nit
S. aureus (MIC van 32 μg/ml)Pen, Oxa, Gen, Tob, Amik, Net, Nor, Cip, Chl, Ery, Tri/Sul, Nit, VanTet, Cefo/Sul
S. aureus(MIC van 16 μg/ml)Pen, Oxa, Gen, Tob, Amik, Net, Nit, Nor, Cip, Ery, VanChl, Tri/Sul, Cefo/Sul
S. aureus(MIC van 8 μg/ml)Pen, Oxa, Gen, Tob, Amik, Net, Nor, Cip, Ery, VanTri/Sul, Nit, Cefo/Sul
S. epidermidis (MIC van 32 μg/ml)Pen, Oxa, Gen, Tob, Amik, Net, Nor, Cip, Chl, Ery, Cefo/Sul, Nit, VanTri/Sul
S. epidermidis (MIC van 16 μg/ml)Pen, Oxa, Gen, Tob, Net, Nor, Cip, Ery, VanTri/Sul, Nit, Amik, Cefo/Sul

Pen: Penicillin, Oxa: Oxacillin, Gen: Gentamicin, Tob: Tobramycin, Amik: Amikacin, Net: Netilmicin, Nor: Norfloxacin, Cip: Ciprofloxacin, Chl: Chloramphenicol, Ery: Erythromycin, Tet: Tetracycline, Nit: Nitrofurantoin Tri/Sul: Trimethoprim/Sulfamethaxole, Cefo/Sul: Cefoperazoneoxacillin/Sulbactam, Van: Vancomycin.

Resistance pattern of vancomycin resistant staphylococcal isolates to commonly tested antimicrobial agents as determined by disc diffusion method. Pen: Penicillin, Oxa: Oxacillin, Gen: Gentamicin, Tob: Tobramycin, Amik: Amikacin, Net: Netilmicin, Nor: Norfloxacin, Cip: Ciprofloxacin, Chl: Chloramphenicol, Ery: Erythromycin, Tet: Tetracycline, Nit: Nitrofurantoin Tri/Sul: Trimethoprim/Sulfamethaxole, Cefo/Sul: Cefoperazoneoxacillin/Sulbactam, Van: Vancomycin.

Discussion

In the routine microbiology laboratory prompt identification of the staphylococcal strains up to species level were done by catalase, coagulase and other standard biochemical test. However during routine screening by slide coagulase test many strains of S. aureus are missed due to their poor sensitivity and falsely reported as coagulase negative staphylococci during routine screening process. In our study we performed tube coagulase tests of all 1681 staphylococcal strains. Therefore the main criterion used for the S. aureus identification was tube coagulase test. However, the slidex staph plus test was also found to be good to differentiate S. aureus and CoNS. MICs of oxacillin, vancomycin and teicoplanin against S. aureus and CoNS revealed that there is a rise in the resistance. S. aureus and CoNS have shown 40.61 % and 54.83 % oxacillin resistance, respectively. We have found two MRSA strains which were showing vancomycin resistance (VRSA). These VRSA strains have been isolated from the pus of two different patients who were admitted in the different wards. One VRSA (vancomycin MIC 64 μg/ml) strain was isolated from pus of a 56 years old patient who was admitted in Medicine ward and; the other VRSA (vancomycin MIC 32 μg/ml) strain was isolated from pus of a 49 years old patient who was admitted in Skin and VD ward of our hospital (table 1). Both the isolates were also found to be resisistant to several other antimicrobials such as gentamicin, tobramycin, amikacin, norfloxacin, ciprofloxacin, erythromycin, tetracycline, trimethoprim/sulfamethoxazole and cefoperazone/sulbactam (table 2). While going through the detailed history of these two patients it was found that they were already treated with glycopeptides for more than 20 days. These patients were not responding to further vancomycin therapy and later died due to complication of the disease. The present study also encountered one vancomycin resistant CoNS strain with vancomycin and teicoplanin MIC 32 μg/ml. The strain was later identified as Staphylococcus epidermidis. This strain was isolated from culture of tip of endo-trachial tube of a patient who was admitted in the intensive care unit of teaching hospital. Of total six VISA strains, four had their MIC 8 μg/ml and two strains showed vancomycin and teicoplanin MIC of 16 μg/ml. Out of six VISA strains, two were isolated from the pus specimens of the patient visiting outpatient department and remaining four were from the pus specimens of patients admitted in post-operative ward. Out of two strains of CoNS (Staphylococcus epidermidis) with vancomycin and teicoplanin MIC 16 μg/ml, one was isolated from the blood of a patient who was admitted in orthopedic ward, and the other was isolated from the urine specimen of a patient visiting the endocrinology outpatient department. In this study we have found almost similar pattern of MIC of vancomycin and teicoplanin. The present study shows that there is a significant rise of reduced susceptibility of oxacillin, vancomycin and teicoplanin. The emergence of the glycopeptide resistance is of great concern. Though first case of VRSA was reported in 2002 in USA [9] but few other countries have reported the reduced susceptibility of S. aureus and CoNS against glycopeptides [6-8,10,11,13-18]. Recently Pallazo et al [10] have also reported some vancomycin resistant strains of CoNS in Brazil. More recently Bathaineh has reported VRSA strains from Jordan [11]. Ashdulla et al [18] have reported some strains of vancomycin intermediate S. aureus (VISA) from India. Song et al, 2004 have also been reported the emergence of heterogeneous vancomycin resistant S. aureus strains from India and its neighboring countries [24]. The current vancomycin resistant staphylococci in hospital as well as in community are alarming situation to the clinicians. The development of antibiotic resistance in developing countries like ours seems to be very much related to the irrational antibiotic usage due to it's easy availability at the drug store without prescription, injudicious use in hospitals and uncontrolled use in agriculture, animal husbandry and fisheries [25]. This emergence of VRSA/VISA may be due to building of selective pressure of vancomycin. Vancomycin, a glycopeptide is currently the main antimicrobial agent available to treat life-threatening infections with MRSA. Until recently vancomycin resistance among gram-positive bacteria had been thought to be uncommon but the confirmed reports of vancomycin resistance in Enterococcus spp; S. aureus and CoNS have been reported from various part of world. Widespread use of vancomycin to treat infections caused by MRSA and other gram-positive cocci has led to the emergence of vancomycin resistance. The large scale of development and subsequent spread of resistance to vancomycin has been perceived as a fearsome threat to the already challenging therapy of MRSA. The true mechanism of vancomycin resistance in S. aureus is not known. It was initially feared that S. aureus would acquire the van gene that code for vancomycin resistance in Enterococcus spp; this phenomenon was successfully accomplished in the laboratory [26]. Further, Showsh et al, 2001 [27] have demonstrated the presence of sex pheromone in S. aureus that promotes plasmid transfer in Enterococcus spp. Release of these pheromones by S. aureus with proximity to vancomycin-resistant enterococci causes the transfer of plasmids encoding van gene to the S. aureus. In current study all strains of VRSA and VISA strains were negative for vanA/vanB gene by PCR. Therefore the absence of vanA/B genes in the present isolates dose not rule out that these strains are not VRSA or VISA. There is another hypothesis which says that cell wall thickening is responsible for the development of vancomycin resistance. The mechanism of vancomycin resistance has been extensively studied with the first clinical VRSA strain, Mu50 [28-30]. Biochemical and transmission electron microscopy (TEM) examination of the Mu50 cell, suggested that it produces increased amounts of peptidoglycan. More murein monomers and more layers (probably 30–40 layers as judged by cell-wall thickness observed with TEM) of peptidoglycan are considered to be present in the cell wall. As a result, more vancomycin molecules are trapped in the peptidoglycan layers before reaching the cytoplasmic membrane where peptidoglycan synthesis occurs. Moreover, a higher concentration of vancomycin would be required to saturate all the murein monomers that are supplied at an increased rate in Mu50. Besides the vancomycin-trapping mechanism, designated "affinity trapping," [31-33], Hiramatsu has suggested that dense accumulation of vancomycin molecules within the thickened cell-wall significantly delays the timing of complete inhibition of cell-wall synthesis by not allowing efficient penetration of vancomycin molecules through the thickened cell-wall layers [30]. The thickened cell wall of VRSA strains become thinner with the loss of vancomycin resistance during the drug free passage and again become thick in resistant mutants. Pallazo et al [10] have also demonstrated the thickening of cell wall in vancomycin resistant staphylococci. This could be the possible mechanism behind the vancomycin resistant staphylococcal isolates that we have reported though we could not perform the test for the demonstration of cell wall thickening in these isolates.

Conclusion

Our study for the first time has exposed the emergence of VRSA and VISA in North India. Although we confined our study within North India, the emergence of VRSA/VISA might also be prevalent in other parts of India as antibiotic misuse is equally common there. Hence, there should be an immediate response from the concerned authorities to check further emergence and spreading of these notorious VRSA strains. A strict regulation on irrational antibiotic usages might be an appropriate and effective approach in this direction. Moreover, nationwide surveillance program should be carried out to map the vancomycin susceptibility pattern in this country. For this, all strains with vancomycin MIC 4 μg/ml should be earmarked and sent to the reference laboratory for the further characterization. This will help to identify the potential areas which are already under the major threat of VRSA/VISA emergence and therefore draw more focused attention of Government for prompt tackling of this problem.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

HK has conceived and designed the work and performed strain isolation and identification, antibiotic susceptibility testing, PCR tests and prepared the manuscript. MR has participated in the designing of the work and correction of manuscript. Both the authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  27 in total

1.  Vancomycin resistance plasmid in Enterococcus faecalis that encodes sensitivity to a sex pheromone also produced by Staphylococcus aureus.

Authors:  S A Showsh; E H De Boever; D B Clewell
Journal:  Antimicrob Agents Chemother       Date:  2001-07       Impact factor: 5.191

2.  Staphylococcus aureus with reduced susceptibility to vancomycin--United States, 1997.

Authors: 
Journal:  MMWR Morb Mortal Wkly Rep       Date:  1997-08-22       Impact factor: 17.586

3.  First report of vancomycin-resistant staphylococci isolated from healthy carriers in Brazil.

Authors:  I C V Palazzo; M L C Araujo; A L C Darini
Journal:  J Clin Microbiol       Date:  2005-01       Impact factor: 5.948

4.  Increase in glutamine-non-amidated muropeptides in the peptidoglycan of vancomycin-resistant Staphylococcus aureus strain Mu50.

Authors:  H Hanaki; H Labischinski; Y Inaba; N Kondo; H Murakami; K Hiramatsu
Journal:  J Antimicrob Chemother       Date:  1998-09       Impact factor: 5.790

5.  Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility.

Authors:  K Hiramatsu; H Hanaki; T Ino; K Yabuta; T Oguri; F C Tenover
Journal:  J Antimicrob Chemother       Date:  1997-07       Impact factor: 5.790

6.  Staphylococcus aureus with reduced susceptibility to vancomycin--Illinois, 1999.

Authors: 
Journal:  MMWR Morb Mortal Wkly Rep       Date:  2000-01-07       Impact factor: 17.586

7.  Emergence in Asian countries of Staphylococcus aureus with reduced susceptibility to vancomycin.

Authors:  Jae-Hoon Song; Keiichi Hiramatsu; Ji Yoeun Suh; Kwan Soo Ko; Teruyo Ito; Maria Kapi; Sungmin Kiem; Yeon-Sook Kim; Won Sup Oh; Kyong Ran Peck; Nam Yong Lee
Journal:  Antimicrob Agents Chemother       Date:  2004-12       Impact factor: 5.191

Review 8.  Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications.

Authors:  H F Chambers
Journal:  Clin Microbiol Rev       Date:  1997-10       Impact factor: 26.132

9.  Co-transfer of vancomycin and other resistance genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus.

Authors:  W C Noble; Z Virani; R G Cree
Journal:  FEMS Microbiol Lett       Date:  1992-06-01       Impact factor: 2.742

10.  The epidemiology of intravenous vancomycin usage in a university hospital. A 10-year study.

Authors:  J Ena; R W Dick; R N Jones; R P Wenzel
Journal:  JAMA       Date:  1993-02-03       Impact factor: 56.272

View more
  68 in total

1.  Colonization with vancomycin-intermediate Staphylococcus aureus strains containing the vanA resistance gene in a tertiary-care center in north India.

Authors:  Tuhina Banerjee; Shampa Anupurba
Journal:  J Clin Microbiol       Date:  2012-02-15       Impact factor: 5.948

Review 2.  Molecular epidemiology of clinically significant antibiotic resistance genes.

Authors:  P M Hawkey
Journal:  Br J Pharmacol       Date:  2008-03       Impact factor: 8.739

3.  Overexpression, crystallization and preliminary X-ray crystallographic analysis of hypothetical protein SAV0479 from Staphylococcus aureus Mu50.

Authors:  Chinar Pathak; Sun Bok Jang; Hookang Im; Hye Jin Yoon; Bong Jin Lee
Journal:  Acta Crystallogr Sect F Struct Biol Cryst Commun       Date:  2013-03-28

4.  Inappropriate continued empirical vancomycin use in a hospital with a high prevalence of methicillin-resistant Staphylococcus aureus.

Authors:  Nak-Hyun Kim; Hei Lim Koo; Pyoeng Gyun Choe; Pyeong Gyun Choe; Shinhye Cheon; Moonsuk Kim; Moon Suk Kim; Myung Jin Lee; Younghee Jung; Young Hee Jung; Wan Beom Park; Kyoung-Ho Song; Eu Suk Kim; Ji Hwan Bang; Hong Bin Kim; Sang Won Park; Nam Joong Kim; Myoung-don Oh; Eui Chong Kim
Journal:  Antimicrob Agents Chemother       Date:  2014-11-17       Impact factor: 5.191

Review 5.  Muller glia in retinal innate immunity: a perspective on their roles in endophthalmitis.

Authors:  Ashok Kumar; Rajeev K Pandey; Lindsay J Miller; Pawan K Singh; Mamta Kanwar
Journal:  Crit Rev Immunol       Date:  2013       Impact factor: 2.214

6.  Revisiting Methicillin-Resistant Staphylococcus aureus Infections.

Authors:  Abdelkarim Waness
Journal:  J Glob Infect Dis       Date:  2010-01

7.  Methicillin and Vancomycin Resistant S. aureus in Hospitalized Patients.

Authors:  Poonam Sood Loomba; Juhi Taneja; Bibhabati Mishra
Journal:  J Glob Infect Dis       Date:  2010-09

8.  Nosocomial Infections and Drug Susceptibility Patterns in Methicillin Sensitive and Methicillin Resistant Staphylococcus aureus.

Authors:  Nitish Kumar Sharma; Raina Garg; Shrikala Baliga; Gopalkrishna Bhat K
Journal:  J Clin Diagn Res       Date:  2013-09-16

9.  Comparison of In-vitro Activities of Linezolid and Vancomycin against Staphylococcus aureus Isolated from A Tertiary Care Hospital.

Authors:  Sachin Kishore; Deepika Verma; Me Siddique
Journal:  J Clin Diagn Res       Date:  2014-05-15

Review 10.  [Resistance to "last resort" antibiotics in Gram-positive cocci: The post-vancomycin era].

Authors:  Sandra Rincón; Diana Panesso; Lorena Díaz; Lina P Carvajal; Jinnethe Reyes; José M Munita; César A Arias
Journal:  Biomedica       Date:  2014-04       Impact factor: 0.935

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.