Laurie A Mans1, Laia Querol Cano1,2, Jason van Pelt1, Panagiota Giardoglou1, Willem-Jan Keune3, Anna-Pavlina G Haramis4. 1. Institute of Biology, Leiden University, Sylviusweg 72, 2333 BE, Leiden, The Netherlands. 2. Radboud Institute for Molecular Life Sciences - Tumour immunology department, Geert Grooteplein 28, 6525 GA, Nijmegen, The Netherlands. 3. Department of Biochemistry, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, The Netherlands. 4. Institute of Biology, Leiden University, Sylviusweg 72, 2333 BE, Leiden, The Netherlands. a.haramis@biology.leidenuniv.nl.
Abstract
Autophagy is an evolutionarily conserved process that degrades cellular components to restore energy homeostasis under limited nutrient conditions. How this starvation-induced autophagy is regulated at the whole-body level is not fully understood. Here, we show that the tumor suppressor Lkb1, which activates the key energy sensor AMPK, also regulates starvation-induced autophagy at the organismal level. Lkb1-deficient zebrafish larvae fail to activate autophagy in response to nutrient restriction upon yolk termination, shown by reduced levels of the autophagy-activating proteins Atg5, Lc3-II and Becn1, and aberrant accumulation of the cargo receptor and autophagy substrate p62. We demonstrate that the autophagy defect in lkb1 mutants can be partially rescued by inhibiting mTOR signaling but not by inhibiting the PI3K pathway. Interestingly, mTOR-independent activation of autophagy restores degradation of the aberrantly accumulated p62 in lkb1 mutants and prolongs their survival. Our data uncover a novel critical role for Lkb1 in regulating starvation-induced autophagy at the organismal level, providing mechanistic insight into metabolic adaptation during development.
Autophagy is an evolutionarily conserved process that degrades cellular components to restore energy homeostasis under limited nutrient conditions. How this starvation-induced autophagy is regulated at the whole-body level is not fully understood. Here, we show that the tumor suppressor Lkb1, which activates the key energy sensor AMPK, also regulates starvation-induced autophagy at the organismal level. Lkb1-deficient zebrafish larvae fail to activate autophagy in response to nutrient restriction upon yolk termination, shown by reduced levels of the autophagy-activating proteins Atg5, Lc3-II and Becn1, and aberrant accumulation of the cargo receptor and autophagy substrate p62. We demonstrate that the autophagy defect in lkb1 mutants can be partially rescued by inhibiting mTOR signaling but not by inhibiting the PI3K pathway. Interestingly, mTOR-independent activation of autophagy restores degradation of the aberrantly accumulated p62 in lkb1 mutants and prolongs their survival. Our data uncover a novel critical role for Lkb1 in regulating starvation-induced autophagy at the organismal level, providing mechanistic insight into metabolic adaptation during development.
Autophagy is a highly conserved, multi-step intracellular process of self-degradation. Under basal conditions, autophagy eliminates damaged proteins and organelles from cells, serving a housekeeping/recycling function. However, upon metabolic stress, starvation–induced autophagy serves to provide substrates for biosynthesis and energy production in order to maintain cellular homeostasis[1, 2]. The importance of autophagy for cellular and organismal health is showcased by the fact that defects in autophagy have been linked to neurodegeneration, cancer, aging and metabolic syndrome[1].Starvation-induced autophagy promotes survival in the Drosophilafat body[3] and in Caenorhabditis elegans
[4]. A critical role for autophagy in surviving the metabolic stress at birth has also been demonstrated in mammals: mice deficient in Atg5 (autophagy protein 5, an E3 ubiquitin ligase necessary for autophagosomal elongation) survive foetal development, but die within one day after birth, exhibiting severe hypoglycaemia and hypolipidaemia[2]. However, the regulation of systemic starvation-induced autophagy is not well understood.Autophagy-induction in response to energetic stress is triggered by the activation of AMPK-activated protein kinase (AMPK)[5, 6], a key, evolutionarily conserved energy sensor. AMPK activation restores energy homeostasis at the cellular and organismal levels[7] by many different pathways, including via inhibition of the mechanistic target of rapamycin (mTOR)[8], a conserved serine-threonine kinase involved in nutrient sensing, growth and proliferation[9, 10]. AMPK itself is activated by multiple mechanisms including phosphorylation by the tumor suppressor LKB1/STK11 kinase in response to increased AMP or ADP levels in the cell[11, 12]. Because of the role of AMPK as a central energy checkpoint in the cell, these findings link LKB1 signaling to energy metabolism control, positioning LKB1 as a critical mediator of the effects of low energy on cell viability[11, 13]. Accordingly, cells lacking LKB1 undergo apoptosis under metabolic stress as they are unable to respond to energy deficiency and restore homeostasis[11]. LKB1/AMPK signaling is also important for long-term survival under nutrient-limiting conditions during C. elegans dauer (diapause) stage[14]. However, the early embryonic lethality of both Lkb1 mutant[15] and Ampka1/a2 double mutant mice[16] has precluded analysis of the in vivo role of LKB1/AMPK in physiological processes occurring at later developmental stages in vertebrates, such as during metabolic stress at birth.The LKB1/AMPK axis is a negative regulator of mTOR signaling[8] and mTOR signaling is a known inhibitor of autophagy[17]. However, LKB1 also activates 12 other AMPK-related kinases[18], and many mTOR-dependent and mTOR-independent autophagy regulators exist[19].LKB1/AMPK regulation of mTOR has been linked to the regulation of autophagy in different settings, for example in autophagy stimulated by fluid flow over the primary cilium of epithelial cells[20], and in cancer cells[21]. Furthermore, AMPK directly stimulates autophagy via the ULK1/Atg1 phosphorylation[22, 23]. And LKB1 may also stimulate autophagy by stabilizing p27, thereby linking nutrient sensing to cell-cycle progression[13]. However, whether and how LKB1 signaling regulates systemic starvation-induced autophagy in vertebrates is currently unknown.The regulation of systemic metabolism and autophagy are often studied in zebrafish because of its small size and vertebrate physiology[24, 25]. Importantly, fundamental principles of energy homeostasis are highly conserved between humans and zebrafish[26, 27]. Autophagy has critical functions during zebrafish embryonic development[28], with autophagy-defective animals displaying abnormal heart development[29], which is also seen in mice[30]. Zebrafish are also a valuable model for studying tissue regeneration, and autophagy has been shown to be required for the regeneration of amputated caudal fins[31]. Like mammals, zebrafish also experience metabolic stress at birth, when the maternal nutrient supply (yolk) is depleted. The metabolic stress at birth in mammals is accompanied by induction of gluconeogenesis[32, 33] and of autophagy[2, 34]. While induction of gluconeogenesis also serves as a mechanism to restore energy homeostasis in zebrafish[35], a role for autophagy during this metabolic transition has not been investigated.We previously used TILLING[36] to generate zebrafish mutants that carried a point mutation leading to a stop codon in the kinase domain of Lkb1 (stk11
). These mutants survived gastrulation and early embryonic development but died prematurely from starvation at 7 to 8 days post-fertilization (dpf). Our experiments, impossible to conduct in mice due to the early embryonic lethality of Lkb1 knock-out mice[15], established Lkb1 as a critical regulator of whole-body energy homeostasis[37]. Zebrafishlkb1 (stk11
) mutants are unable to cope with the energetic stress induced upon yolk depletion and fail to adapt their metabolism to lower nutrient levels. lkb1 mutants are indistinguishable from wild type (wt) siblings while their maternal nutrient supply is still present, until 5–6 dpf. However, they die within 1–2 days following yolk depletion whereas wt larvae can survive without food until 13–14 dpf[38].The zebrafishlkb1 mutant phenotype is reminiscent of the Atg5 knock-out mice that appear normal until birth but die soon after, due to their inability to cope with the metabolic stress at birth[2]. This resemblance prompted us to investigate the autophagy status in the lkb1 mutants to study the role of Lkb1 in regulation of systemic starvation-induced autophagy.We show that Lkb1-deficient larvae fail to activate autophagy in response to nutrient restriction. Furthermore, we demonstrate aberrant accumulation of the autophagy adaptor and substrate p62 in lkb1 mutants, confirming impaired autophagy. Genetic or chemical induction of autophagy in lkb1 mutants prolongs their survival, while suppression of autophagy shortens it. Survival prolongation only occurs when degradation of p62 is restored. We therefore show that autophagy is essential to survive the feeding-fasting transition in zebrafish, and identify Lkb1 as a critical regulator of whole-body starvation-induced autophagy in vertebrates.
Results
lkb1 mutants fail to activate autophagy under nutrient limitation
To determine if autophagy initiation and maintenance is affected in the lkb1 mutants we previously generated[37], we analyzed wt and lkb1 larvae between 5–7 dpf during the metabolic transition following yolk depletion. lkb1 mutants are indistinguishable from wt larvae up to day 5–6 dpf[37] (while there is still yolk). We chose this time window also because the morphological lkb1 phenotype of flattened intestine and darkened liver is apparent at 7 dpf[37] and the majority of lkb1 mutants die at 8 dpf (Supplementary Fig. S1). Autophagic activity is commonly monitored by accumulation of the membrane-bound form of MAP1LC3B (microtubule-associated proteins 1 A/1B light chain 3B, Atg8 in yeast; Lc3B in zebrafish), Lc3-II, which is a ubiquitin-like protein[39] that localizes in autophagosomal membranes upon induction of autophagy. To enable visualization of Lc3-II accumulation in autophagosomes, we first blocked the fusion of autophagosomes with lysosomes by treating the larvae with 2.5 μM chloroquine[40] for 14 hours (h) before analysis.We found that Lc3-II protein levels were lower in lkb1 mutant larvae compared to their wt siblings after yolk depletion at 6 and 7 dpf (Fig. 1A). Note that the Lc3 antibody in zebrafish recognizes predominantly the cleaved Lc3B-II form, which still accurately reflects autophagic activity[41] (Supplementary Fig. S2A), and we were only able to detect a faint signal for Lc3B-I in zebrafish lysates (Fig. 1A). To verify this result, we used an alternative marker of autophagy by analyzing the expression of Atg5-containing protein complexes during development. We found that while the expression of the common ~56 KD complex was unaffected, the ~47 KD complex, which is indicative of autophagy induction[31] was undetectable in the lkb1 mutants (Fig. 1A). Finally, we also assessed the levels of Beclin 1 (Becn1), a protein involved in autophagosome nucleation[30, 42] and also commonly used as an autophagy indicator. Becn1 expression was also strongly reduced in the lkb1 mutants (Supplementary Fig. S2B). While Lc3-II and Becn1 levels progressively increased in wt larvae between 5–7 dpf, indicating upregulation of autophagy upon yolk termination, lkb1 mutants did not show such an increase, suggesting they fail to activate autophagy under nutrient limiting conditions (Fig. 1A, and Supplementary Fig. S2B).
Figure 1
lkb1 mutant larvae show impaired activation of autophagy following yolk depletion. (A) Representative Western blot analysis of Lc3-II, Atg5, p62 and Tubulin (loading control) in total protein lysates of wt and lkb1 trunks between 5–7 dpf. Larvae were treated with chloroquine (2.5 μM) for 14 h prior to processing. The marked decrease in Lc3-II and Atg5-containing complexes together with the p62 accumulation indicate impaired autophagy in lkb1 larvae. Uncropped images of the blots are shown in Supplementary Fig. S7A–C. (B–E) Transverse vibratome sections (150 μm) of intestine of 7 dpf wt and lkb1 mutants stained with anti-LC3B antibody (green), rhodamine-phalloidin to detect F-actin (red) and DAPI to detect nuclei (blue). Lc3B staining in the lkb1 intestine is barely detectable (C,E) and more foci of intense staining were visible in wt sections compared to sections from lkb1 mutants. (F,G) Immunohistochemical analysis of transverse paraffin sections (5 μm) of liver and intestine of 7 dpf wt and lkb1 larvae reveals high levels of p62 accumulation in lkb1 liver and intestine. Magnification: 40×. PD: pronephric ducts; L: liver; SI: intestine.
lkb1 mutant larvae show impaired activation of autophagy following yolk depletion. (A) Representative Western blot analysis of Lc3-II, Atg5, p62 and Tubulin (loading control) in total protein lysates of wt and lkb1 trunks between 5–7 dpf. Larvae were treated with chloroquine (2.5 μM) for 14 h prior to processing. The marked decrease in Lc3-II and Atg5-containing complexes together with the p62 accumulation indicate impaired autophagy in lkb1 larvae. Uncropped images of the blots are shown in Supplementary Fig. S7A–C. (B–E) Transverse vibratome sections (150 μm) of intestine of 7 dpf wt and lkb1 mutants stained with anti-LC3B antibody (green), rhodamine-phalloidin to detect F-actin (red) and DAPI to detect nuclei (blue). Lc3B staining in the lkb1 intestine is barely detectable (C,E) and more foci of intense staining were visible in wt sections compared to sections from lkb1 mutants. (F,G) Immunohistochemical analysis of transverse paraffin sections (5 μm) of liver and intestine of 7 dpf wt and lkb1 larvae reveals high levels of p62 accumulation in lkb1 liver and intestine. Magnification: 40×. PD: pronephric ducts; L: liver; SI: intestine.To examine the spatial distribution of autophagy, we performed immunofluorescence analysis with antibodies against Lc3B on transverse liver and intestine sections of lkb1 and wt larvae at 7 dpf. Lc3B expression was strongly reduced in lkb1 intestines and livers as compared to their wt counterparts (Fig. 1B–E and Supplementary Fig. S2E,F), confirming and supporting the immunoblotting results. Furthermore, immunohistochemistry (IHC) against Becn1 on transverse sections of wt and lkb1 mutants showed markedly reduced Becn1 staining in the lkb1 mutants compared to their wt counterparts (Supplementary Fig. S2C,D).To further confirm that activation of autophagy is impaired in lkb1 mutants, we monitored expression levels of the p62 protein (also known as sequestosome 1, (SQSTM1). p62 is an adaptor protein that targets ubiquitinated proteins or organelles that bind to it for selective autophagy[43]. Accumulation of p62 has been observed in mouse AMPK-deficient fibroblasts[44], and is associated with liver toxicity in autophagy-deficientmouse liver[45]. p62 itself is also an autophagy substrate, thus accumulation of p62 levels is a marker for impaired autophagy[46]. In agreement with our model that lkb1 mutants have impaired autophagy, Western blot analysis of p62 levels at 5, 6 and 7 dpf showed progressive accumulation of p62 specifically in the lkb1 mutants (Fig. 1A). IHC performed on transverse sections of lkb1 intestine and liver confirmed a marked accumulation of p62 in lkb1 larvae, whereas wt siblings were devoid of staining (Fig. 1F,G).Collectively, these findings demonstrate that whole-body autophagy is impaired in lkb1 mutants during the feeding-fasting transition in zebrafish, which could contribute to their premature death.
Abrogation of autophagy further decreases survival of lkb1 mutants
To investigate the effect of inhibiting autophagy on lkb1 larvae survival prior to yolk depletion, we blocked autophagosome formation using an antisense morpholino oligonucleotide (MO), that targets the translational start-site of atg5 mRNA[28, 47], atg5MO. We confirmed that injection of atg5MO abolishes Atg5 protein expression (Supplementary Fig. S3). Atg5-knockdown led to a reduction in Lc3-II levels compared to the negative control in both wt and lkb1 mutants at 4 dpf, before yolk depletion, confirming autophagy suppression upon atg5MO injection (Fig. 2A). While all un-injected wt and lkb1 larvae were alive at 4 dpf, a significant number of atg5MO-injected embryos were found dead at that time point. Genotyping all larvae at 4 dpf revealed that 75% of atg5MO-injected lkb1 larvae had died compared to only 25% of atg5MO-injected wt larvae (Fig. 2B). Thus, lkb1 mutants, which fail to induce autophagy at the metabolic transition, are also more sensitive to autophagy inhibition at earlier embryonic stages.
Figure 2
Inhibition of autophagy shortens survival of lkb1 larvae. (A) Representative Western blot analysis of Lc3-II and Actin (loading control) in total protein lysates of trunks of surviving wt and lkb1 larvae at 4 dpf that were injected with an atg5MO at the one-cell stage, and controls. Larvae were previously treated with 2.5 μM chloroquine for 14 h. Atg5 knock-down led to downregulation of Lc3-II levels in both wt and lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S8. (B) Graph depicting mortality percentages of atg5MO-injected wt and lkb1 larvae at 4 dpf. Data represent the means ± standard errors of the means (SEM) and are pooled from two independent experiments (n = 80/experiment). *P value < 0.05.
Inhibition of autophagy shortens survival of lkb1 larvae. (A) Representative Western blot analysis of Lc3-II and Actin (loading control) in total protein lysates of trunks of surviving wt and lkb1 larvae at 4 dpf that were injected with an atg5MO at the one-cell stage, and controls. Larvae were previously treated with 2.5 μM chloroquine for 14 h. Atg5 knock-down led to downregulation of Lc3-II levels in both wt and lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S8. (B) Graph depicting mortality percentages of atg5MO-injected wt and lkb1 larvae at 4 dpf. Data represent the means ± standard errors of the means (SEM) and are pooled from two independent experiments (n = 80/experiment). *P value < 0.05.
The autophagy defect in lkb1 mutants can be ameliorated by mTOR-dependent and -independent mechanisms
We next investigated the mechanism behind the impaired autophagy observed in the lkb1 mutants. Signaling through mTOR is known to inhibit autophagy, and we and others have previously reported that mTOR activity is high in wt larvae between 2 and 5 dpf and is downregulated at later stages of larval development[37, 47, 48]. This suggests that at the time of yolk depletion, mTOR activity is switched off, enabling the activation of autophagy. It has also been shown in mice that suppression of mTOR activity at birth enables activation of autophagy[49]. We hypothesized that mTOR inactivation was defective in the absence of Lkb1. Therefore, we first assessed the status of mTOR signaling in lkb1 mutants at the metabolic transition (6 dpf) by analyzing phosphorylation of the mTOR-substrate ribosomal protein S6 (RS6) by Western blot. Total RS6 levels were almost undetectable in wt larvae at this stage, consistent with our previous report[37]. However, both total and phospho- RS6 levels were high in lkb1 mutants (Fig. 3A), indicating active mTOR signaling, which was inhibited by rapamycin treatment. In comparison, in rapamycin-treated 6 dpf wt larvae, we observed increased phospho-RS6 expression (Fig. 3A). This could be explained by a known developmental delay caused by chronic mTOR inhibition during development[50]. Consistent with this, rapamycin-treated wt larvae retained significant amounts of yolk at 7 dpf, demonstrating a delay in larval development (Supplementary Fig. S4C).
Figure 3
Rapamycin treatment leads to increased Lc3-II accumulation but does not increase Atg5 (complexes) nor restore p62 degradation in lkb1 mutants. (A) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf that were treated with either 10 μM rapamycin from 24 hpf onwards, or with DMSO (negative control). Increased levels of RS6 and P-RS6 are observed in rapamycin-treated wt samples. Total RS6 levels did not change in lkb1 samples but P-RS6 decreased upon rapamycin treatment. (B) Representative Western blot analysis of p62, Lc3-II, and histone H3 (loading control). Larvae were treated with chloroquine (2.5 μM) for 14 h prior to processing. Rapamycin treatment leads to increased Lc3-II levels in both wt and lkb1 larvae, while p62 accumulation remained high in rapamycin-treated lkb1 mutants. (C) Representative Western blot analysis of Atg5 and Tubulin (loading control). Rapamycin treatment leads to an increase in the amount of the ~47 KD Atg5-containing complex in wt larvae and to a lesser extent in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S9A–C.
Rapamycin treatment leads to increased Lc3-II accumulation but does not increase Atg5 (complexes) nor restore p62 degradation in lkb1 mutants. (A) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf that were treated with either 10 μM rapamycin from 24 hpf onwards, or with DMSO (negative control). Increased levels of RS6 and P-RS6 are observed in rapamycin-treated wt samples. Total RS6 levels did not change in lkb1 samples but P-RS6 decreased upon rapamycin treatment. (B) Representative Western blot analysis of p62, Lc3-II, and histone H3 (loading control). Larvae were treated with chloroquine (2.5 μM) for 14 h prior to processing. Rapamycin treatment leads to increased Lc3-II levels in both wt and lkb1 larvae, while p62 accumulation remained high in rapamycin-treated lkb1 mutants. (C) Representative Western blot analysis of Atg5 and Tubulin (loading control). Rapamycin treatment leads to an increase in the amount of the ~47 KD Atg5-containing complex in wt larvae and to a lesser extent in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S9A–C.To determine whether mTOR signaling mediates the inhibition of autophagy seen in the lkb1 mutants at 6 dpf, we examined whether rapamycin treatment could restore autophagy in these mutants. We treated wt and lkb1 embryos with rapamycin from 1 dpf onwards. We have previously reported that rapamycin-treated lkb1 larvae survive until 9 dpf, but still have a considerable amount of yolk, demonstrating a developmental delay[37]. Rapamycin-treatment resulted in elevated Lc3-II levels in both wt and lkb1 larvae, at 6 dpf (Fig. 3B), indicating that autophagy in the lkb1 mutants is inhibited, at least in part, by mTOR signaling. The same was also observed when blocking autophagosome-lysosome fusion by chloroquine, which prevents degradation of autophagosome-associated Lc3, allowing monitoring of the autophagic flux[51] (Supplementary Fig. S4A,B). However, rapamycin-treatment led to only slight upregulation of Atg5 and complexed Atg5 in lkb1 mutants (Fig. 3C), and was not sufficient to decrease the marked p62 accumulation (Fig. 3B). These results suggest that while mTOR inhibition can at least partially restore autophagy in lkb1 mutant larvae, it cannot entirely alleviate the observed phenotype.We next analyzed the pro-survival PI3K pathway, which in response to external stimuli (growth factors, insulin) also suppresses autophagy, acting upstream of mTOR signaling[52]. To this end, we used the small molecule AR-12, an inhibitor of phosphoinositide-dependent kinase (PDK)-1, a component of the PI3K pathway[53], which has been shown to activate autophagy in zebrafish[54]. Treatment of wt and lkb1 siblings with AR-12 from 1 dpf onwards, led to accumulation of Lc3-II protein levels in wt but not in lkb1 larvae at 6 dpf (Fig. 4A). Interestingly, AR-12 treatment resulted in upregulation of Atg5 expression and formation of Atg5/12 complexes in wt larvae indicating autophagy induction, but no changes in Atg5 expression were observed in lkb1 larvae (Fig. 4B). Furthermore, while p62 protein expression was diminished in wt larvae upon AR-12-mediated activation of autophagy, accumulation of p62 remained unchanged in AR-12-treated lkb1 larvae (Fig. 4A). This indicates that inhibition of the PI3K pathway fails to induce autophagy in mutant larvae. We next assessed phosphorylation of the mTOR-substrate RS6 upon AR-12 treatment in wt and lkb1 larvae at 6 dpf. RS6 and phosphorylated RS6 (P-RS6) were not detectable in wt larvae at 6 dpf (Fig. 4C), consistent with downregulation of mTOR activity at later developmental stages (here and refs 37, 47 and 48). AR-12 treatment did not affect the high protein levels of RS6 or P-RS6 seen in the lkb1 mutants, indicating that they are unsusceptible to PI3K pathway inhibition. In line with the lack of autophagy induction, AR-12 treatment did not enhance lkb1 survival, as no statistically significant differences were observed in the percentage of AR-12-treated lkb1 larvae alive at 9 dpf compared to DMSO-treated controls (Fig. 4D).
Figure 4
The PI3K-inhibitor AR-12 does not rescue the autophagy defect in lkb1 mutants and does not prolong their survival. (A) Representative Western blot analysis of Lc3-II, p62 and Histone H3 and Tubulin (loading controls) in total protein lysates of wt and lkb1 trunks at 6 dpf. Larvae were treated with 1 μM AR-12 or DMSO (negative control) from 1 dpf, and with 2.5 μM chloroquine for 14 h prior to processing. AR-12 treatment leads to upregulation of Lc3-II levels in wt larvae but not in lkb1 mutants. p62 levels remain high in AR-12-treated lkb1 larvae. (B) AR-12 treatment leads to strong increase in the amounts of Atg5 and complexed Atg5 in wt larvae but not in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S10A,B. (C) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control). Protein levels of total RS6 and of P-RS6 were not affected by AR-12 treatment in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S9A–C. (D) Graph depicting survival percentage of lkb1 larvae alive at 9 dpf. Embryos were treated with 1 μM AR-12 or DMSO from 1 dpf, collected at 9 dpf, and genotyped for the lkb1 gene. Data represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments P value > 0.05, ns: not statistically significant.
The PI3K-inhibitor AR-12 does not rescue the autophagy defect in lkb1 mutants and does not prolong their survival. (A) Representative Western blot analysis of Lc3-II, p62 and Histone H3 and Tubulin (loading controls) in total protein lysates of wt and lkb1 trunks at 6 dpf. Larvae were treated with 1 μM AR-12 or DMSO (negative control) from 1 dpf, and with 2.5 μM chloroquine for 14 h prior to processing. AR-12 treatment leads to upregulation of Lc3-II levels in wt larvae but not in lkb1 mutants. p62 levels remain high in AR-12-treated lkb1 larvae. (B) AR-12 treatment leads to strong increase in the amounts of Atg5 and complexed Atg5 in wt larvae but not in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S10A,B. (C) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control). Protein levels of total RS6 and of P-RS6 were not affected by AR-12 treatment in lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S9A–C. (D) Graph depicting survival percentage of lkb1 larvae alive at 9 dpf. Embryos were treated with 1 μM AR-12 or DMSO from 1 dpf, collected at 9 dpf, and genotyped for the lkb1 gene. Data represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments P value > 0.05, ns: not statistically significant.Activation of autophagy by an mTOR-independent pathway can be achieved using calpeptin, which inhibits the autophagy inhibitors calpain proteases[55]. Calpeptin treatment of lkb1 and wt embryos from 1 dpf onwards, in the presence or absence of chloroquine, enhanced Lc3-II levels in both wt and lkb1 larvae at 6 dpf (Fig. 5A and Supplementary Fig. S5) without any effects on development or yolk absorption. Calpeptin treatment also resulted in upregulation of the amounts of Atg5 and complexed-Atg5 in both wt and lkb1 mutants (Fig. 5B). In contrast to rapamycin treatment, treatment with calpeptin restored p62 degradation in lkb1 mutants (Fig. 5A). Calpeptin treatment had no effect on RS6 phosphorylation in lkb1 mutants (Fig. 5C), consistent with calpeptin being an mTOR-independent autophagy activator[55]. Moreover, calpeptin-mediated activation of autophagy prolonged survival in 70% of the treated lkb1 larvae. Specifically, 17.5% of calpeptin-treated lkb1 larvae survived until 9 dpf, whereas only 1% of vehicle-treated lkb1 larvae were alive at this point (Fig. 5D). Therefore, we conclude that induction of mTOR-independent autophagy results in a more complete restoration of the lkb1 mutant phenotypes compared to that obtained upon inhibition of mTOR signaling.
Figure 5
Calpeptin treatment induces autophagy and prolongs survival of lkb1 larvae. (A) Representative Western blot analysis of Lc3-II, p62 and Histone H3 (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf. The embryos were treated with 50 μM calpeptin or DMSO (negative control) from 1 dpf onwards, and with 2.5 μM chloroquine for 14 h prior to lysing. Calpeptin treatment leads to upregulation of Lc3-II levels in both wt and lkb1 larvae. Induction of autophagy by calpeptin also leads to robust downregulation of p62 accumulation in lkb1 larvae. (B) Representative Western blot analysis of Atg5 and Tubulin (loading control). Calpeptin treatment leads stark increase in the amounts of Atg5 and of complexed Atg5 in both wt and lkb1 larvae (C) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control). Calpeptin treatment does not affect RS6 or P-RS6 levels in wt or lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S11A–C. (D) Graph depicting survival percentage of lkb1 mutants alive at 9 dpf. Embryos were treated with 50 μM calpeptin or DMSO from 1 dpf, collected at 9 dpf, and genotyped for the lkb1 gene. 17,5% out of a total 25% (70% of calpeptin-treated lkb1 larvae) are alive at 9 dpf. Only 1% of DMSO-treated lkb1 larvae are alive at 9 dpf. Data depicted in (D) represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments (n = 100/experiment). **P value < 0.05.
Calpeptin treatment induces autophagy and prolongs survival of lkb1 larvae. (A) Representative Western blot analysis of Lc3-II, p62 and Histone H3 (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf. The embryos were treated with 50 μM calpeptin or DMSO (negative control) from 1 dpf onwards, and with 2.5 μM chloroquine for 14 h prior to lysing. Calpeptin treatment leads to upregulation of Lc3-II levels in both wt and lkb1 larvae. Induction of autophagy by calpeptin also leads to robust downregulation of p62 accumulation in lkb1 larvae. (B) Representative Western blot analysis of Atg5 and Tubulin (loading control). Calpeptin treatment leads stark increase in the amounts of Atg5 and of complexed Atg5 in both wt and lkb1 larvae (C) Representative Western blot analysis of Ribosomal protein S6 (RS6), Phospho-RS6 and Tubulin (loading control). Calpeptin treatment does not affect RS6 or P-RS6 levels in wt or lkb1 mutants. Uncropped images of the blots are shown in Supplementary Fig. S11A–C. (D) Graph depicting survival percentage of lkb1 mutants alive at 9 dpf. Embryos were treated with 50 μM calpeptin or DMSO from 1 dpf, collected at 9 dpf, and genotyped for the lkb1 gene. 17,5% out of a total 25% (70% of calpeptin-treated lkb1 larvae) are alive at 9 dpf. Only 1% of DMSO-treated lkb1 larvae are alive at 9 dpf. Data depicted in (D) represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments (n = 100/experiment). **P value < 0.05.
Accumulation of p62 is an important regulator of autophagy in lkb1 mutants
Aberrant p62 accumulation appeared as a hallmark of impaired autophagy in lkb1 mutants, and strongly correlated with survival. While p62 is primarily thought of as a receptor delivering cargo proteins to autophagosomes for degradation, it has also been implicated in enhancing mTOR activity[56], thereby regulating autophagy as well. Loss of p62 function led to increased autophagy in mammalian cells and in C. elegans
[56]. We thus set out to determine whether reducing p62 levels in larvae would affect autophagy and survival. To this end, we injected a sqstm1/p62 MO, targeting splicing of sqstm1/p62 mRNA[54], into 1–2-cell stage embryos. RT-PCR confirmed that the sqstm1/p62 MO blocked sqstm1/p62 mRNA splicing until at least 5 dpf (Supplementary Fig. S6). Western blot analysis of 6 dpf larvae showed decreased p62 expression compared to un-injected controls in both wt and lkb1 lysates (Fig. 6A). This was coupled with increased Lc3-II protein levels, suggestive of autophagy induction. Knockdown of p62 significantly prolonged lkb1 survival up to 9dpf: Approximately 70% of sqstm1/p62 MO-injected lkb1 mutants survived to 9dpf, whereas less than 5% of un-injected lkb1 larvae were alive at this time-point (Fig. 6B). Thus, depleting p62 is sufficient to activate impaired autophagy in lkb1 mutants and extend survival.
Figure 6
p62 knock-down extends lkb1 mutants’ survival. (A) Representative Western blot analysis of p62, Lc3-II, and histone H3 (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf that were either injected with an sqstm1MO at the one-cell stage or controls. The larvae were treated with 2.5 μM chloroquine for 14 h prior to processing. p62 knock-down leads to increased Lc3-II levels in both wt and lkb1 larvae. p62 expression in lkb1 larvae is reduced upon p62 knock-down. Uncropped images of the blots are shown in Supplementary Fig. S12. (B) Graph depicting survival percentage of lkb1 larvae alive at 9 dpf. Embryos were injected with 0,5 mM sqstm1MO at the one cell stage, collected at 9 dpf, and genotyped for the lkb1 gene. Data represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments. ***P value ≤ 0.0001.
p62 knock-down extends lkb1 mutants’ survival. (A) Representative Western blot analysis of p62, Lc3-II, and histone H3 (loading control) in total protein lysates of wt and lkb1 trunks at 6 dpf that were either injected with an sqstm1MO at the one-cell stage or controls. The larvae were treated with 2.5 μM chloroquine for 14 h prior to processing. p62 knock-down leads to increased Lc3-II levels in both wt and lkb1 larvae. p62 expression in lkb1 larvae is reduced upon p62 knock-down. Uncropped images of the blots are shown in Supplementary Fig. S12. (B) Graph depicting survival percentage of lkb1 larvae alive at 9 dpf. Embryos were injected with 0,5 mM sqstm1MO at the one cell stage, collected at 9 dpf, and genotyped for the lkb1 gene. Data represent the means ± standard errors of the means (SEM) and are pooled from three independent experiments. ***P value ≤ 0.0001.
Discussion
Organisms adapt their metabolism in response to nutrient limitation to restore energy homeostasis and ensure survival. Here, we identify a novel link between metabolic adaptation during development and induction and maintenance of autophagy, mediated by the tumor suppressor Lkb1. Specifically, we use metabolically compromised Lkb1-deficient zebrafish larvae to show that Lkb1 is crucial in the induction of autophagy in response to the metabolic challenge accompanying depletion of the maternal nutrient supply. Our data therefore reveal an essential function for Lkb1 in controlling starvation-induced autophagy at the organismal level in vertebrates.Overall autophagy levels in lkb1 mutants are lower compared to those of wt siblings: while expression of autophagy–related proteins is progressively upregulated following yolk depletion in wt larvae, induction of autophagy in lkb1 mutants is strongly attenuated. Importantly, we demonstrate that genetic and chemical manipulation of autophagy levels significantly impacts lkb1 larvae survival: inducing autophagy by mTOR-dependent and –independent mechanisms prolongs survival, and suppressing autophagy by Atg5 depletion leads to premature death selectively of the mutants. The increased susceptibility of lkb1 larvae to Atg5 depletion during development occurred even while the yolk is not yet consumed, suggesting that even though the larvae do not show a morphological phenotype at this embryonic stage, the loss of Lkb1 appears to sensitize them to additional stress. This stress may be specifically autophagy inhibition, or related to alternative mechanisms, as autophagy-independent functions have been reported for several of the autophagy-related genes[57, 58], including Atg5[59].Various mechanisms, including mTOR and PI3K signaling, as well as calpains, are known to regulate autophagy[19], and likely interact at multiple levels. Indeed, our results, together with published work, indicate that all these influence the energy-sensing defect we observe in lkb1 mutants. We show that activating autophagy by calpeptin, which inhibits the action of the general autophagy inhibitors calpains[55], led to robust upregulation of Atg5 expression and restored degradation of p62 in lkb1 mutants. Thus, calpeptin fully rescued the autophagy defect of the lkb1 larvae and prolonged their survival. In contrast, while the mTOR-inhibitor rapamycin increased Lc3-II accumulation in lkb1 larvae, autophagy was not completely restored since p62 still accumulated. This may be due to the high mTOR activity in the mutants that could not be fully blocked by rapamycin treatment under these experimental conditions. In addition, although rapamycin treatment also prolonged lkb1 survival, we believe this was likely due to a generalized growth delay, evidenced by the presence of a considerable amount of yolk at 7 dpf (this study and refs 37 and 50), rather than due to partial restoration of autophagy. A developmental delay caused by rapamycin is further supported by the persistence of RS6 expression in rapamycin-treated wt larvae at 7 dpf when mTOR would normally be suppressed (mTOR signaling is suppressed in wt larvae upon yolk depletion at 5–6 dpf[37, 47, 48]).The autophagy receptor and substrate p62 aberrantly accumulates in lkb1 mutants indicating deficient autophagy. p62 is also a regulator of autophagy, as it participates in a feed-forward loop in which p62 enhances mTOR activity resulting in reduced autophagy, in turn leading to higher p62 levels in mice[60]. Here we also show that depletion of p62 in lkb1 larvae leads to activation of autophagy and prolonged survival. This implies that as the amount of p62 decreases due to autophagosomal clearance, its effect on mTOR activity is also reduced, and thus autophagy can be maintained. Furthermore, the aberrant accumulation of p62 in lkb1 larvae may in itself contribute to their premature lethality, as it has been shown that increased levels of p62 in autophagy-deficientmouse livers cause hepatotoxicity (reviewed in ref. 60). Further supporting our hypothesis, in apoptosis-impaired tumor cells with deficient autophagy, p62 accumulation triggers a positive feedback loop for the generation of reactive oxygen species (ROS) leading to enhanced genomic instability and tumorigenesis[61].PI3K signaling is a nutrient-sensing pathway that is also implicated in starvation-induced autophagy. Inhibition of the PI3K pathway activated autophagy in wt larvae, but not in lkb1 mutants, and did not prolong their survival. This is consistent with our previous findings that PI3K signaling is compromised in lkb1 mutants[37]. We postulate that defective PI3K signaling may contribute to the autophagy defect seen in these mutants. While AMPK is considered a major regulator of metabolism and has an important role in induction of autophagy under energetic stress[23, 44], it is not overtly activated in wt larvae at 7 dpf[37]; in agreement with these data, studies in mice have also reported that 24 hours of fasting did not lead to significant AMPK activation[62, 63]. Thus, the autophagy defect we describe in lkb1 mutants is unlikely to be solely attributable to impaired AMPK signaling, and deregulation of additional pathways, such as PI3K signaling and AMPK/mTOR-independent pathways may also be involved. Hence, nutrient-sensing pathways (like the PI3K pathway) and energy-sensing pathways (like the AMPK pathway) are likely in close cross-talk with each other, not only through their convergence on mTOR signaling but also through different, mTOR-independent mechanisms.Together, our data indicate that Lkb1 plays an important role in the regulation of autophagy at the whole-organism level, and confirm that autophagy is critical for survival during the metabolic transition in development. Since defects in autophagy are implicated in a plethora of diseases, a better understanding of the upstream regulatory pathways could provide new insights into their pathophysiology.
Materials and Methods
Zebrafish strains and Screening Methods
Zebrafish were handled in compliance with the local animal welfare regulations and were maintained according to standard protocols (zfin.org). Their culture was approved by the local animal welfare committee (DEC) of the University of Leiden and all protocols adhered to the international guidelines specified by the EU Animal Protection Directive 2010/63/EU. Genotype analysis for lkb1 mutants embryos was performed as previously described[37].
Longitudinal analysis of survival of lkb1 mutants
Larvae obtained from single matings of heterozygous lkb1 adults were analyzed over time. 48–95 larvae were genotyped on 6, 7, 8, 9, 10 and 11 dpf to assess the numbers of lkb1 mutants alive.
Western Blot analysis
Approximately 20 larvae/sample were lysed (3 μl per larva) in cold lysis buffer (50 mM Hepes, pH 7.6, 50 mM KCl, 50 mM NaF, 5 mM NaPPi, 1 mM EGTA, 1 mM EDTA, 1 mM beta-Glycerophosphate, 1 mM DTT, 1 mM Vanadate, 1% NP40) containing phosphatase and proteinase inhibitors. Lysates were pestled for 5 min, sonicated for 30 seconds at 30 seconds intervals for 5 min and centrifuged at 13.000 rpm for 15 min at 4 °C to pellet nuclei and cell debris. Protein lysates were boiled for 10 min and BCA assay was performed to measure protein concentration. Samples containing 12–30 μg of protein were heated at 95 °C for 5 min with 4× Bolt LDS sample buffer (Thermofisher, #B0007), supplemented with 5% beta-mercaptoethanol, and loaded onto a 12% Bis-Tris plus gel (Thermofisher, #NW00122). The protein marker used was Precision Plus ProteinTM Dual Color Standards, #1610374 (BioRad). Proteins were transferred onto a nitrocellulose membrane (Thermofisher, #88018) using a wet transfer system (Bio-Rad) according to manufacturer’s instructions. Subsequent blocking and antibody incubation were performed in 5% skimmed milk powder (#115363, Merck Millipore) in PBS containing 0.1% Tween-20. For the anti-p62 antibody, blocking was performed in 10% milk powder and antibody incubation in 1% milk powder in PBS containing 0.1% Tween-20. Antibodies used were: rabbit anti-LC3B (1:1000, Abcam, #ab51520), rabbit anti-p62 (1:1000, MBL, #PM045), rabbit anti-BECN1 (1:500, Santa Cruz, #sc-11427), rabbit anti-H3 (1:5000, Santa Cruz, #sc-10809), mouse anti-beta-actin (1:5000, Sigma, #A5441), mouse anti-Tubulin (1:500, Sigma, #T9026), rabbit anti-Atg5 (1:500, Novus, #NB110-53818). Secondary antibodies used were goat Anti-Mouse IgG (H + L)-HRP (1:10.000, BioRad, #1721011) and Goat Anti-Rabbit IgG (H + L)-HRP Conjugate (1:10.000, BioRad, #17210191). Membranes were developed using ECL (BioRad, #1705060), followed by chemiluminescence detection with a gel doc system (BioRad).
Immunohistochemistry and Immunofluorescence
For transverse sections, larvae were fixed in 40% ethanol, 5% acetic acid and 10% formalin for 3 h at room temperature followed by three washes in 70% ethanol before being dehydrated following serial washes in Histoclear and reducing ethanol concentrations. Larvae were then sectioned at 5 μm intervals using a Reichert-Jung 2050 microtome (Leica). Sections were deparaffinized and hydrated following by 20 min of antigen retrieval in sodium citrate buffer pH 6.0 at 100 °C. Sections were blocked in 5% BSA in PBS − 0.1% Tween-20 for 1 h at room temperature and incubated overnight with sheep anti-p62 (1:200, Abcam, #ab31545) and rabbit anti-BECN1 (1:150, Santa Cruz, #sc-11427). Endogenous peroxidase activity was blocked in 0.3% H2O2 for 20 min at room temperature followed by incubation with rabbit anti-sheep antibody (1:800, Abcam, #ab6747) for 1 h at room temperature. Sections were incubated with 0.1 M imidazole prior to detection with 3,3′-diaminobenzidine (DAB) substrate and counterstaining with hematoxylin.For immunofluorescence, larvae were fixed in 4% PFA overnight at 4 °C, embedded vertically in a 0.5% gelatin/30% albumin mixture and sectioned at 120 μm intervals using a VT1000S vibratome (Leica). Sections were transferred to the wells of a 24-well plate containing PBD (PBS + 0.1% Tween-20 and 0.5% Triton-X-100), which was then replaced with blocking solution (PBD + 1% BSA) for 1 h at RT. Sections were incubated with rabbit anti-LC3B (1:1000, Abcam, #ab51520) in blocking solution overnight at 4 °C. Sections were washed three times for 15 min in PBS-0.1% Tween-20 and incubated with secondary anti-rabbit488 green fluorescent antibody (1:100, Thermofisher, #A11008) for 2 h at room temperature. Sections were then washed three times for 15 min in PBS-0.1% Tween-20 prior to be incubated with phalloidin-Alexa 588 (1:25, Thermofisher, #A12380) and DAPI (1:200, Thermofisher, #62248) for 30 min at room temperature in the dark and rinsed three times for 5 min with dH2O. Sections were then imaged using the Zeiss LSM5 Exciter confocal laser-scanning microscope.
Equipment and settings
For immunohistochemistry, the sections were imaged on an upright compound Nikon Eclipse E800 microscope. The images were captured using a Nikon Digital Sight camera unit, equipped with a DS-Fi1 digital camera head and a DS-L2 camera controller. Pixel dimensions of the acquired images were W2584 X H1936 pixels, at 150 pixels/inch.The magnification used was either 40×/0,75 magnification for anti-p62 staining (Fig. 1) or 100×/1,4 magnification for anti-Becn1 staining (Supplementary Fig. S2).The images were processed using Photoshop CS6 software. The original images were scaled-down constraining proportions, and cropped to the area of interest. Adjustment of Image Levels was applied on whole images. Assembly of the composite figures and labeling was done on Illustrator CC2015.Confocal images were obtained in a sequential manner using a Zeiss LSM5 Exciter Confocal Laser Scanning Microscope equipped with Argon (458, 488, 514 nm), and 405, 450 and 635 diode excitation lasers and a 40× water immersion objective (C-APOCHROMAT 40×/1.2 Water). Emission ranges were set at 420–480, 505–550 and 560–615 nm in separate channels to prevent bleeding. Images were obtained using the Leica application X software (Leica, Wetzlar, Germany) and post-acquisition data analysis was performed using ImageJ software.
Morpholino injections
Translation-blocking morpholino (MO) directed against atg5 (CATCCTTGTCATCTGCCATTATCAT) was obtained from Gene-Tools. The splice-blocking MO against Sqstm1/p62 (CTTCATCTAGAGACAAAGTTCAGGA) was a kind gift from Prof. AM Meijer. Splice efficiency of sqstm1 mRNA was tested in RT-PCR using a specific primer-set (Forward primer: 5′ ATTTGCAGCGAAAAGTGCTC 3′; Reverse primer:5′ AGTGAACGGAAACCCAGGAA 3′). Embryos were injected at the 1–2-cell stage with either 2 ng (atg5) or 4 ng (Sqstm1/p62) of MO.
Drug treatments
Wild type or lkb1 mutant zebrafish embryos were treated from 1 dpf in embryo-medium at 28 °C with either of the following treatments: 50 μM calpeptin (Abcam, #4ab120804), 1 μM AR-12 (Medkoo Biosciences, #200272), or 10 μM rapamycin (Sigma, #R0395). Stock solutions of AR-12, rapamycin and calpeptin were prepared in DMSO and diluted in embryo medium for treatment (final concentration of DMSO, 0.2%). Other treatments were prepared in embryo medium. All treatments were refreshed every 2–3 days, larvae collected at the specified time points and genotyped for the lkb1 gene. For Western Blotting, embryos were exposed to 2,5 μM chloroquine (Sigma, #C6628) for 14 h prior to lysing.
Statistics and quantification
Statistical significance was determined using Fisher’s exact test in GraphPad software. Error bars represent the means ± standard errors of the means (SEM) and are pooled from a minimum of two independent experiments. A p-value of <0.05 was used to define statistical significance.Supplementary material
Authors: Asensio A Gonzalez; Reetu Kumar; Jacob D Mulligan; Ashley J Davis; Richard Weindruch; Kurt W Saupe Journal: Am J Physiol Endocrinol Metab Date: 2004-07-13 Impact factor: 4.310
Authors: Jose M Lizcano; Olga Göransson; Rachel Toth; Maria Deak; Nick A Morrice; Jérôme Boudeau; Simon A Hawley; Lina Udd; Tomi P Mäkelä; D Grahame Hardie; Dario R Alessi Journal: EMBO J Date: 2004-02-19 Impact factor: 11.598
Authors: Philipp Gut; Bernat Baeza-Raja; Olov Andersson; Laura Hasenkamp; Joseph Hsiao; Daniel Hesselson; Katerina Akassoglou; Eric Verdin; Matthew D Hirschey; Didier Y R Stainier Journal: Nat Chem Biol Date: 2012-12-02 Impact factor: 15.040
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Samrah Masud; Tomasz K Prajsnar; Vincenzo Torraca; Gerda E M Lamers; Marianne Benning; Michiel Van Der Vaart; Annemarie H Meijer Journal: Autophagy Date: 2019-01-24 Impact factor: 16.016
Authors: Jianzhou Cui; Dhakshayini Morgan; Dao Han Cheng; Sok Lin Foo; Gracemary L R Yap; Patrick B Ampomah; Suruchi Arora; Karishma Sachaphibulkij; Balamurugan Periaswamy; Anna-Marie Fairhurst; Paola Florez De Sessions; Lina H K Lim Journal: Cells Date: 2020-06-04 Impact factor: 6.600