Literature DB >> 28720814

Small RNA mediated repression of subtilisin production in Bacillus licheniformis.

Robert Hertel1, Sandra Meyerjürgens1, Birgit Voigt2,3, Heiko Liesegang1, Sonja Volland4.   

Abstract

The species Bacillus licheniformis includes important strains that are used in industrial production processes. Currently the physiological model used to adapt these processes is based on the closely related model organism B. subtilis. In this study we found that both organisms reveal significant differences in the regulation of subtilisin, their main natural protease and a product of industrial fermentation processes. We identified and characterized a novel antisense sRNA AprAs, which represents an RNA based repressor of apr, the gene encoding for the industrial relevant subtilisin protease. Reduction of the AprAs level leads to an enhanced proteolytic activity and an increase of Apr protein expression in the mutant strain. A vector based complementation of the AprAs deficient mutant confirmed this effect and demonstrated the necessity of cis transcription for full efficiency. A comparative analysis of the corresponding genome loci from B. licheniformis and B. subtilis revealed the absence of an aprAs promoter in B. subtilis and indicates that AprAs is a B. licheniformis species specific phenomenon. The discovery of AprAs is of great biotechnological interest since subtilisin Carlsberg is one of the main products of industrial fermentation by B. licheniformis.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28720814      PMCID: PMC5516005          DOI: 10.1038/s41598-017-05628-y

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Bacillus licheniformis was originally isolated and described by Weigman in 1898[1]. The species is a member of the B. subtilis species complex[2] and exhibits a saprophytic life style on organic material[3, 4]. The lifestyle results in three properties which promote B. licheniformis as platform for productive fermentations. (I) Bacilli can use a broad spectrum of plant derived C- and N-sources[5, 6]. (II) Since the organisms live on organic matter they are evolved for high concentrations of nutrient supply which enables the them to reach high cell densities in fermentations[7]. Finally, (III) they secrete high amounts of many efficient bio-polymer hydrolases[8] like lichenases[9], lipases[10], thermostable alpha-amylases[11], and many more[12-20]. Exoproteases of the subtilisin Carlsberg family are an industrial fermentation product of B. licheniformis and B. subtilis strains with an annual production rate of about 500 t[21]. Subtilisin is highly thermostable, active under alkaline conditions (pH 10–11) and, due to its low substrate specificity, an important additive for household detergents[21, 22]. In 2004 the type strain B. licheniformis DSM13 (also ATCC14580) was sequenced by Rey et al. (Davis, USA)[23] and Veith et al. (Göttingen, Germany)[24] revealing a plasmid free 4.2 Mbp genome. Almost a decade later, the RNA based regulatory network of B. licheniformis DSM13 was analysed by RNA-Seq using samples from different stages of an industrial fermentation[25].The transcriptome data revealed a considerable number of protein encoding RNAs and also 3,314 non-coding RNAs, divided in 2853 mRNA-bound and 461 small RNAs. In general, small RNAs (sRNA) are versatile regulators of gene expression, which can facilitate their function in cis or trans, controlling e.g. mRNA stability, degradation, termination and translation[26, 27]. Three prominent classes of sRNAs have been described: (i) structured sRNAs with limited complementarity to their targets, (ii) sRNAs that bind regulatory proteins and (iii) antisense RNAs synthesized from the strand complementary to their target mRNA[28]. In the transcriptome of B. licheniformis an antisense RNA element on the 3′ end of the apr gene, encoding the subtilisin protease, gained considerable attention, since the samples were taken from a subtilisin fermentation[25]. Due to its association with apr, we called the RNA element AprAs. Its active region has a length of 144 nucleotides and shows complete sequence identity to the antisense 3′ coding region of the apr gene. The RNA-Seq data from Wiegand et al.[25] also indicated that the small RNA is transcribed by its own promoter. Its transcription rate exceeds the transcription rate of the apr mRNA by three orders of magnitude. For the closely related organism B. subtilis no comparable antisense RNA associated with the 3′-end of aprE was described, although extensive transcriptome analyses were performed by Rasmussen et al. in 2009[29] and Nicolas et al. in 2012[30]. The subtilisin gene aprE in B. subtilis was found to be regulated by the interacting global transcriptional regulators CodY and ScoC as well as by AbrB[31]. Barbieri et al.[31] could also show that the regulatory network in B. subtilis results in a repression of the aprE gene within the exponential growth phase and an exclusive expression of AprE within the stationary phase. The genome of B. licheniformis DSM13 also exhibits orthologues of aprE regulators[23, 24] and the transcriptome analysis of B. licheniformis DSM13[25] showed a corresponding expression pattern for apr. However, the association of the apr gene with a highly expressed small antisense RNA indicates an additional regulatory layer in B. licheniformis. The here presented work focuses on the impact of the newly discovered antisense RNA AprAs. By inactivation of the aprAs promoter and vector encoded transcription of AprAs we could show its regulatory effect on proteolytic activity and Apr expression.

Results

Construction and characterization of an AprAs deficient mutant

To investigate the impact of the 144 base antisense sRNA AprAs (Bli_r0872 in Wiegand et al.[25]), an AprAs deficient B. licheniformis MW3 mutant was generated. A direct deletion of aprAs was not possible due to its overlap with the apr gene on the complementary DNA strand (see Fig. 1a). However, the previous RNA-Seq experiment[25] also included differential RNA-Seq (dRNA-Seq, see Sharma et al.[32]) and thus, the transcription start site of aprAs and a corresponding promoter pattern could be identified. The SigA pattern was located on the positive DNA strand between the stop codon of the apr coding region and its transcription terminator (see Fig. 1b). In order to prevent the transcription of AprAs, the AT-rich region of the −10 promoter box was replaced with the GC-rich recognition pattern of the AscI endonuclease. For easy detection of the desired mutation, a 2.6 kbp PCR product was amplified from the respective genomic region and digested with the endonuclease AscI. The mutant strain B. licheniformis MW3 AprAs− exhibited the expected 1.3 kbp DNA band consisting of the degradation products of the 2.6 kbp PCR product (see Supplementary Figure S1). A slot blot experiment confirmed that no transcriptional activity of the aprAs gene was detectable in the mutant strain compared to the original strain B. licheniformis MW3 (see Fig. 2).
Figure 1

AprAs transcription profile, promoter region and sequence analysis. (a) Transcription profile of AprAs in the early stage of an industrial subtilisin production[25]. Transcriptome data were visualised in a logarithmic scale using TraV[56]. The red graph represents the transcription activity of aprAs and the blue of apr. The black arrow on the complementary strand represents the coding region of apr and the yellow arrow of aprAs. The dark red arrows represent the identified promoters and green arrows predicted transcription terminators. (b) Promoter region of aprAs. The −10 box (TAGAAT) of the potential SigA promoter is highlighted in red and the exchanged sequence (AscI pattern) is given. Predicted transcription terminators are framed with green arrows. Protein coding sequences are shown in black bold letters and the stop codons are underlined. The aprAs coding sequence is given in orange letters and the experimentally determined transcription start site of AprAs[25] is framed in red. (c) AprAs sequence. The 144 base large AprAs sequence was analyzed via the RNAfold WebServer, using “The Vienna RNA Websuite”[55]. The calculation of secondary structures was possible and the optimal structure with a minimum free energy of −51.9 kcal/mol is shown in dot-bracket notation.

Figure 2

Slot blot analysis of AprAs transcription in B. licheniformis MW3 and B. licheniformis MW3 mutant strains. (a) The quality of the total RNA of B. licheniformis MW3 (lane 1), B. licheniformis MW3 AprAs− (lane 2), B. licheniformis MW3 pV2 (lane 3), B. licheniformis MW3 AprAs− pV2 (lane 4), B. licheniformis MW3 pV2::aprAs (lane 5) and B. licheniformis MW3 AprAs− pV2::aprAs (lane 6) was determined using an Agilent Bioanalyzer. Lane 1 and 2 were analysed on a separate chip and the respective ladders (L) are shown. (b) The AprAs transcript was detected with an AprAs specific probe in B. licheniformis MW3 total RNA. B. licheniformis MW3 (lane 1) and B. licheniformis MW3 pV2 (lane 3) show an AprAs specific signal, whereas B. licheniformis MW3 AprAs− and B. licheniformis MW3 AprAs− pV2 (lane 4) possess no or only a very faint AprAs specific signal. B. licheniformis MW3 pV2::aprAs (lane 5) and B. licheniformis MW3 AprAs- pV2::aprAs (lane 6) show a strong AprAs signal dependent on the AprAs transcription from vector pV2::aprAs.

AprAs transcription profile, promoter region and sequence analysis. (a) Transcription profile of AprAs in the early stage of an industrial subtilisin production[25]. Transcriptome data were visualised in a logarithmic scale using TraV[56]. The red graph represents the transcription activity of aprAs and the blue of apr. The black arrow on the complementary strand represents the coding region of apr and the yellow arrow of aprAs. The dark red arrows represent the identified promoters and green arrows predicted transcription terminators. (b) Promoter region of aprAs. The −10 box (TAGAAT) of the potential SigA promoter is highlighted in red and the exchanged sequence (AscI pattern) is given. Predicted transcription terminators are framed with green arrows. Protein coding sequences are shown in black bold letters and the stop codons are underlined. The aprAs coding sequence is given in orange letters and the experimentally determined transcription start site of AprAs[25] is framed in red. (c) AprAs sequence. The 144 base large AprAs sequence was analyzed via the RNAfold WebServer, using “The Vienna RNA Websuite”[55]. The calculation of secondary structures was possible and the optimal structure with a minimum free energy of −51.9 kcal/mol is shown in dot-bracket notation. Slot blot analysis of AprAs transcription in B. licheniformis MW3 and B. licheniformis MW3 mutant strains. (a) The quality of the total RNA of B. licheniformis MW3 (lane 1), B. licheniformis MW3 AprAs− (lane 2), B. licheniformis MW3 pV2 (lane 3), B. licheniformis MW3 AprAs− pV2 (lane 4), B. licheniformis MW3 pV2::aprAs (lane 5) and B. licheniformis MW3 AprAs− pV2::aprAs (lane 6) was determined using an Agilent Bioanalyzer. Lane 1 and 2 were analysed on a separate chip and the respective ladders (L) are shown. (b) The AprAs transcript was detected with an AprAs specific probe in B. licheniformis MW3 total RNA. B. licheniformis MW3 (lane 1) and B. licheniformis MW3 pV2 (lane 3) show an AprAs specific signal, whereas B. licheniformis MW3 AprAs− and B. licheniformis MW3 AprAs− pV2 (lane 4) possess no or only a very faint AprAs specific signal. B. licheniformis MW3 pV2::aprAs (lane 5) and B. licheniformis MW3 AprAs- pV2::aprAs (lane 6) show a strong AprAs signal dependent on the AprAs transcription from vector pV2::aprAs. To investigate the impact of AprAs on the protease activity of B. licheniformis, the AprAs− mutant and the original strain MW3 were grown on M9 skim milk agar plates. B. licheniformis MW3 AprAs− exhibited increased halo formation, indicative for a stronger proteolytic activity compared to strain MW3 (Fig. 3a). These qualitative results were confirmed by quantitative non-specific exoprotease assays using 24 h M9 skim milk liquid cultures. Here, the AprAs deficient strain B. licheniformis MW3 AprAs− showed an approximately four fold increased exoprotease activity compared to B. licheniformis MW3 (see Fig. 3b).
Figure 3

Determination of exoprotease activity by qualitative and quantitative measurement in B. licheniformis MW3 and mutant strains. For qualitative determination of exoprotease activity (a,c), cultures were adjusted to OD600 of 0.1. Of each culture 3 µl were dropped on a M9 skim milk agar plate and incubated for 5 days at 37 °C. Exoprotease activity led to the digestion of milk protein resulting in a surrounding halo. The size of the respective halos is indicated with a red bar. For quantitative determination of exoprotease activity (b,d), all cultures were inoculated to an OD600 of 0,1 in liquid M9 skim milk medium and incubated for 24 h under intensive shaking. The exoprotease activity was determined using the culture supernatant. (a) B. licheniformis MW3 AprAs− reveals an increased exoprotease activity visible through a stronger halo formation compared to MW3. (b) The four fold increased exoprotease activity of B. licheniformis MW3 AprAs− confirms the exoprotease phenotype observed in Fig. 3a. (c) B. licheniformis MW3 pV2::aprAs shows the smallest halo formation. The halo of the complemented B. licheniformis MW3 AprAs− pV2::aprAs is comparable to MW3 pV2. B. licheniformis MW3 AprAs− pV2 shows the strongest proteolytic activity indicated by the largest halo formation. The ectopic transcription of aprAs results in a reduction of exoprotease activity in both MW3 and mutant AprAs−. (d) The protease activity of the complemented strain B. licheniformis MW3 AprAs− pV2::aprAs is strongly decreased compared to B. licheniformis MW3 AprAs− and comparable to B. licheniformis MW3 pV2. B. licheniformis MW3 pV2::aprAs shows an approximately 50% reduced exoprotease activity.

Determination of exoprotease activity by qualitative and quantitative measurement in B. licheniformis MW3 and mutant strains. For qualitative determination of exoprotease activity (a,c), cultures were adjusted to OD600 of 0.1. Of each culture 3 µl were dropped on a M9 skim milk agar plate and incubated for 5 days at 37 °C. Exoprotease activity led to the digestion of milk protein resulting in a surrounding halo. The size of the respective halos is indicated with a red bar. For quantitative determination of exoprotease activity (b,d), all cultures were inoculated to an OD600 of 0,1 in liquid M9 skim milk medium and incubated for 24 h under intensive shaking. The exoprotease activity was determined using the culture supernatant. (a) B. licheniformis MW3 AprAs− reveals an increased exoprotease activity visible through a stronger halo formation compared to MW3. (b) The four fold increased exoprotease activity of B. licheniformis MW3 AprAs− confirms the exoprotease phenotype observed in Fig. 3a. (c) B. licheniformis MW3 pV2::aprAs shows the smallest halo formation. The halo of the complemented B. licheniformis MW3 AprAs− pV2::aprAs is comparable to MW3 pV2. B. licheniformis MW3 AprAs− pV2 shows the strongest proteolytic activity indicated by the largest halo formation. The ectopic transcription of aprAs results in a reduction of exoprotease activity in both MW3 and mutant AprAs−. (d) The protease activity of the complemented strain B. licheniformis MW3 AprAs− pV2::aprAs is strongly decreased compared to B. licheniformis MW3 AprAs− and comparable to B. licheniformis MW3 pV2. B. licheniformis MW3 pV2::aprAs shows an approximately 50% reduced exoprotease activity.

Verification of AprAs phenotype

B. licheniformis MW3 AprAs− was complemented with a vector encoded aprAs gene to restore the original phenotype and confirm that the observed exoprotease phenotype of B. licheniformis MW3 AprAs− is based on the inactivation of AprAs transcription. The aprAs gene with its native promoter was cloned into the Bacillus/E. coli shuttle vector pV2[33], creating pV2::aprAs. The vector was introduced into B. licheniformis MW3 AprAs− and the original strain B. licheniformis MW3. The vector pV2 was used as a control. The slot blot analysis (Fig. 2) confirmed the re-establishment of AprAs transcription in B. licheniformis MW3 AprAs− pV2::aprAs. B. licheniformis MW3 pV2 exhibited AprAs transcription due to the chromosomal aprAs gene. B. licheniformis MW3 pV2::aprAs showed an increased AprAs transcription due to expression from the chromosomal aprAs gene in addition to the multi-copy vector encoded aprAs gene. The qualitative evaluation of the protease activity on M9 skim milk agar plates (Fig. 3c) showed that the complemented mutant strain B. licheniformis MW3 AprAs− pV2::aprAs could re-establish the “wild type” phenotype. Its halo formation was comparable to B. licheniformis MW3 pV2 and reduced in comparison to B. licheniformis MW3 AprAs−. These qualitative results were confirmed by the quantitative exoprotease activity evaluation (Fig. 3d), determined in the supernatant of 4 ml culture in liquid M9 skim milk media. The reduction of AprAs transcription in B. licheniformis MW3 AprAs− resulted once more in an approximately 4 times increased exoprotease activity. This effect was reversed by the ectopic AprAs transcription in B. licheniformis MW3 AprAs− pV2::aprAs. The in trans overexpression of AprAs in the original strain MW3 resulted in an additional reduction of exoprotease activity of approximately 50% (see B. licheniformis MW3 pV2::aprAs).

Impact of AprAs on Apr expression

In order to investigate the correlation between the AprAs level and the expression of the protease Apr, the extracellular proteomes of the original strain MW3, the AprAs− mutant and the complemented strain were analysed by 2D-gelelectrophoresis and MALDI-TOF-MS/MS[34]. All strains were grown in 400 ml liquid M9 skim milk medium and supernatants were harvested after 12 h, 24 h, 36 h and 48 h. The quantitative exoprotease assay was performed using the supernatants of three experiments (Fig. 4a). The overall proteolytic activity of the strains increased constantly from 12 h to 48 h. The AprAs deficient mutant strain B. licheniformis MW3 AprAs− showed the highest activity levels with approximately 0.8 U/ml after 48 h. The initial strain B. licheniformis MW3 and the vector complemented strain MW3 AprAs− pV2::aprAs showed both lower activity levels with the highest level of approximately 0.5 U/ml. The samples with the highest activity levels (48 h) were analysed in triplicates by 2D-gelelectrophoresis. Three Apr spots were identified in the supernatants of the cultures. Figure 4b exemplarily shows the dual channel images of 2D-gels from the strain B. licheniformis MW3 compared to the mutant strains B. licheniformis MW3 AprAs− and B. licheniformis MW3 AprAs− pV2::aprAs respectively. The first image demonstrates a strong increase of Apr protein expression in the extracellular proteome of the AprAs− mutant compared to MW3. This effect is reversed after vector complementation of the mutant strain: B. licheniformis MW3 AprAs- pV2::aprAs shows only a slight increase in Apr expression compared to the original strain B. licheniformis MW3. To quantify the differences in Apr protein expression, the spot volumes of the Apr protein spots of all three replicates were compared. Figure 4c shows that the Apr expression in the extracellular proteome of B. licheniformis MW3 AprAs− was three times increased compared to the original strain B. licheniformis MW3. After vector complementation of the AprAs− mutant, a reduction of the Apr protein level was visible (see B. licheniformis MW3 AprAs− pV2::aprAs), but was still two times increased in comparison to the original strain MW3.
Figure 4

Protease activity and Apr protein expression in B. licheniformis MW3, MW3 AprAs− and MW3 AprAs− pV2::aprAs. The strains were grown in 400 ml M9 skim milk medium for 48 h. (a) The cell culture supernatants of samples from time points 12 h, 24 h, 36 h and 48 h were used for quantitative exoprotease activity determination. The absolute value of protease activity is shown as the average of three independent experiments, each with triplicate measurements. The exoprotease activity increased from 12 h to 48 h and is clearly stronger in B. licheniformis MW3 AprAs− in all experiments compared to B. licheniformis MW3 and MW3 AprAs− pV2::aprAs. The error bars display the standard deviation and the colour legend is shown in the figure. (b) Extracellular proteins were isolated from supernatants of 400 ml M9 skim milk cultures after 48 h of growth. The protein fractions were separated by 2D-gelelectrophoresis. A gel image of B. licheniformis MW3 (green) was overlaid with the respective image of MW3 AprAs−. The volume of the three identified Apr protein spots is strongly increased in B. licheniformis MW3 AprAs− (red) compared to the original strain B. licheniformis MW3 (green). In addition, the gel image of B. licheniformis MW3 (green) was overlaid with the respective image of MW3 AprAs− pV2::aprAs (red). After vector complementation, the effect of the mutation is reversed. B. licheniformis MW3 AprAs− pV2::aprAs shows only a slight increase in Apr protein expression compared to B. licheniformis MW3. (c) To quantify the Apr expression the spot volumes (in percentage of the whole protein spot volume) were calculated. The average of the normalized spot volumes of three replicates is shown and the standard deviation is given. The Apr protein expression in the extracellular proteome of B. licheniformis MW3 AprAs− is approximately three times increased compared to the original strain B. licheniformis MW3. The Apr expression of B. licheniformis MW3 AprAs− pV2::aprAs is reduced compared to the precursor strain B. licheniformis MW3 AprAs−, but still higher than in B. licheniformis MW3.

Protease activity and Apr protein expression in B. licheniformis MW3, MW3 AprAs− and MW3 AprAs− pV2::aprAs. The strains were grown in 400 ml M9 skim milk medium for 48 h. (a) The cell culture supernatants of samples from time points 12 h, 24 h, 36 h and 48 h were used for quantitative exoprotease activity determination. The absolute value of protease activity is shown as the average of three independent experiments, each with triplicate measurements. The exoprotease activity increased from 12 h to 48 h and is clearly stronger in B. licheniformis MW3 AprAs− in all experiments compared to B. licheniformis MW3 and MW3 AprAs− pV2::aprAs. The error bars display the standard deviation and the colour legend is shown in the figure. (b) Extracellular proteins were isolated from supernatants of 400 ml M9 skim milk cultures after 48 h of growth. The protein fractions were separated by 2D-gelelectrophoresis. A gel image of B. licheniformis MW3 (green) was overlaid with the respective image of MW3 AprAs−. The volume of the three identified Apr protein spots is strongly increased in B. licheniformis MW3 AprAs− (red) compared to the original strain B. licheniformis MW3 (green). In addition, the gel image of B. licheniformis MW3 (green) was overlaid with the respective image of MW3 AprAs− pV2::aprAs (red). After vector complementation, the effect of the mutation is reversed. B. licheniformis MW3 AprAs− pV2::aprAs shows only a slight increase in Apr protein expression compared to B. licheniformis MW3. (c) To quantify the Apr expression the spot volumes (in percentage of the whole protein spot volume) were calculated. The average of the normalized spot volumes of three replicates is shown and the standard deviation is given. The Apr protein expression in the extracellular proteome of B. licheniformis MW3 AprAs− is approximately three times increased compared to the original strain B. licheniformis MW3. The Apr expression of B. licheniformis MW3 AprAs− pV2::aprAs is reduced compared to the precursor strain B. licheniformis MW3 AprAs−, but still higher than in B. licheniformis MW3. The complete dual channel images of the compared strains (Supplementary Figure S2) showed no differential expression for protein spots of other known extracellular B. licheniformis proteases, such as the metalloprotease Mpr and the minor extracellular protease Vpr (Vpr_1–Vpr_6), as well as the extracellular bacillopeptidase Bpr (Bpr_1, Bpr_2).

Sequence comparison of the AprAs promoter region

Orthologues of the subtilisin gene are found in B. licheniformis and B. subtilis strains. Yet, to our knowledge no orthologous aprAs genes associated with apr genes were described in the transcriptome analyses of B. subtilis 168 from Rasmussen et al. in 2009[29] and Nicolas et al. in 2012[30]. To find out if aprAs and especially its promoter region are conserved, we performed a comparative sequence analysis. The comparison (Fig. 5) comprised the intergenic region between yfhN and apr respectively aprE, with a special focus on the −10 promoter box (green coloration), which was experimentally verified to be responsible for the transcription of AprAs in B. licheniformis DSM13 in the present investigation (see also Fig. 1). The comparison of B. licheniformis DSM13 and B. subtilis 168 showed that the aprAs promoter box (green coloration) is missing in B. subtilis 168. (Fig. 5a). To clarify if AprAs is a strain or species specific phenomenon, we also aligned the concerning regions of 17 B. licheniformis strains (see Fig. 5b) and 35 B. subtilis strains (see Fig. 5c). The sequence comparison showed that the aprAs promoter is present in all investigated B. licheniformis strains but not in the compared B. subtilis strains.
Figure 5

Alignment of AprAs promoter sequences from B. licheniformis and B. subtilis strains. Protein coding sequences are marked in grey. Transcription terminator sequences are marked in green and the promoter regions (−10 box) in red. The alignment was performed using MUSCLE[53]. (a) Sequence alignment of B. licheniformis DSM13 (NC_006270) and B. subtilis 168 (NC_000964). B. subtilis 168 lacks the −10 box upstream of the aprAs gene of B. licheniformis DSM13. (b) Sequence alignment of 17 B. licheniformis strains. The AprAs −10 box is present in all strains. (c) Sequence alignment of 35 B. subtilis strains. The AprAs −10 box is absent in all strains.

Alignment of AprAs promoter sequences from B. licheniformis and B. subtilis strains. Protein coding sequences are marked in grey. Transcription terminator sequences are marked in green and the promoter regions (−10 box) in red. The alignment was performed using MUSCLE[53]. (a) Sequence alignment of B. licheniformis DSM13 (NC_006270) and B. subtilis 168 (NC_000964). B. subtilis 168 lacks the −10 box upstream of the aprAs gene of B. licheniformis DSM13. (b) Sequence alignment of 17 B. licheniformis strains. The AprAs −10 box is present in all strains. (c) Sequence alignment of 35 B. subtilis strains. The AprAs −10 box is absent in all strains.

Discussion

Our results clearly reveal the small RNA AprAs as a repressor of the protease Apr. The protease activity measurements also demonstrated the necessity of cis transcription of AprAs in relation to apr for highly efficient repression. The observed protease phenotypes of the initial strain and the complemented strain B. licheniformis MW3 AprAs− pV2::aprAs were on the same level, showing that the transcription of one aprAs gene in cis amounts to approximately 50 copies[33, 35] in trans. The combination of the single cis encoded aprAs gene and the multi-copy vector in B. licheniformis MW3 pV2::aprAs reduced the exoprotease activity even 50% below the initial level (Fig. 3c,d). The exoproteome analysis (Fig. 4) showed the direct correlation between the observed protease related phenotype and the expression of the protease Apr. The comparison of MW3 and mutant proteomes revealed Apr as the only differentially expressed extracellular protease (Supplementary Figure S2). Protein spots of other known extracellular proteases[36, 37] did not change in relation to the AprAs level. Thus, the observed protease phenotype was facilitated by the negative regulation of AprAs on Apr expression. Although the Apr protein expression levels in B. licheniformis MW3 and MW3 AprAs− pV2::aprAs did not exactly correspond to the levels of the proteolytic activity, both analyses clearly indicate AprAs to be a repressor of Apr expression. Antisense RNA regulation on protein expression in Bacilli has been described before[27]. However, this is, to our knowledge, the first time that an RNA repressor of a biotechnologically relevant product has been reported. A requirement of the proteome analysis was the scale up of our experiment from 4 ml test tubes to 400 ml flask culture. Interestingly, after scaling up, we observed only a doubling of the proteolytic activity (Fig. 4a) in contrast to the four fold increased activity observed in the 4 ml volume experiment (Fig. 3b and d). Most likely, these differences result from the adaption of the experimental design, which can have an impact on productivity[38], but might also reflect additional regulatory layers. Investigations on the orthologous gene aprE from B. subtilis 168 revealed a complex regulatory network of the subtilisin protease including, as mentioned before, regulators such as ScoC, SinR, AbrB, DegU and further associated proteins[31, 39]. The genome of B. licheniformis DSM13[23, 24] encodes orthologues of these regulators, thus a regulatory network of similar complexity can be assumed. In case of AprAs, no orthologous sRNA was identified in B. subtilis 168[29, 30]. Our sequence comparison of the promoter box of aprAs showed its presence in all investigated B. licheniformis strains and its absence in all investigated B. subtilis strains. Therefore we assume that AprAs is a species specific sRNA and thus, our results demonstrate a clear difference on subtilisin protease regulation between B. licheniformis and B. subtilis. It remains unclear if a similar regulatory layer on the subtilisin protease exists in other B. subtilis species complex members or if it is unique for B. licheniformis. Transcriptome analysis in B. subtilis and S. aureus revealed that antisense activities can arise from inefficient termination of the sense transcription or from spurious initiation by alternative sigma factors[30, 40]. However, the strong transcriptional activity and the distinct transcription start site as well as the presence of a conserved SigA promoter pattern (Figs 1 and 5) support the hypothesis that AprAs is a real non-coding RNA and therefore a relevant regulatory layer of Apr expression. The regulation by AprAs could involve a pairing of the small RNA and its mRNA target leading to a guided degradation, as has been discussed for antisense regulators in Thomason and Storz[41] and in Desnoyers et al.[42]. The transcription of AprAs is three orders of magnitude stronger than the transcription of its target RNA[25], which resembles viral toxin/antitoxin type I systems[43], where the sense/antisense duplex is guided to degradation by RNaseIII[44]. Apparently, a quantitative titration of the target mRNA by the small RNA is involved in the regulatory mechanism. This is supported by the observation that in Real-time PCR analysis the apr mRNA level varies in relation to the AprAs level in the investigated mutant strains (Supplementary Figure S3). However, since a cis encoded aprAs is more effective than multiple vector encoded gene copies, an additional regulatory layer is possible. Figure 1c shows that AprAs might form a secondary structure which could delay the interaction of the sRNA and target mRNA. Hence, the transcription of AprAs close to its target mRNA could be an advantage that may explain the differences in efficiency between cis and vector encoded AprAs. It has been shown that the production of subtilisin in B. subtilis starts at the beginning of the stationary phase[31]. In contrast, Wiegand et al.[25] observed a delay between the beginning of the transcriptional activity of the apr gene at the end of the exponential growth phase and the actual occurrence of the Apr protease spot in the proteome of B. licheniformis. It is tempting to assume that an AprAs guided degradation of the apr mRNA may be responsible for this delay between transcription and expression of the apr gene. However, life time evaluations of small RNAs in a complex industrial high density medium are heavily challenged by the background RNase activity within the fermentation process. The production of subtilisin proteases in Bacilli is of great biotechnological relevance since these production systems are extensively used to produce the main enzymatic components of household detergents[8]. Thus, a fourfold increase of the subtilisin activity, as has been achieved with the B. licheniformis wild type subtilisin gene in the AprAs− mutant, is very promising. Although apr orthologues have been identified in most genomes of members of the B. subtilis species complex, the presence of AprAs-like RNA repressors seems less ubiquitous. AprAs was not identified in B. subtilis 168[29, 30] or in the 35 investigated B. subtilis genomes (Fig. 5). However, the possibility to achieve an increased subtilisin production by an AprAs− mutation in B. licheniformis has been demonstrated in our study and should be evaluated for B. licheniformis based fermentations of subtilisin-like enzymes.

Conclusion and outlook

The newly identified antisense sRNA AprAs was shown to be a negative regulator of the biotechnologically important subtilisin family protease Apr in the type strain Bacillus licheniformis DSM13. The prevention of AprAs transcription led to an up to 4-fold increase of exoprotease activity as a result of the increased Apr protein expression. This effect was reversed by ectopic overexpression of AprAs and correspondingly, the native AprAs transcription in addition to the ectopic AprAs expression led to a decrease of proteolytic activity, even below the natural level. AprAs represents a new regulatory feature of Apr expression in B. licheniformis which is not present in the model organism and its close relative B. subtilis 168. Sequence comparison revealed its presence in all investigated B. licheniformis strains and its absence in all compared B. subtilis strains, leading to the conclusion of a species-specific feature. Further analyses should focus on revealing the detailed mechanism of AprAs regulation and the search for AprAs homologues in other Bacilli and industrially used apr gene loci.

Material and Methods

Bacterial strains and culture conditions

The bacterial strains used in this study are listed in Table 1. If not stated otherwise, the strains were grown in NB medium at 37 °C. M9 medium was prepared as described by Sambrook and Russell[45]. 1 L of M9 medium was additionally supplemented with 100 µl of SL-8 trace element solution as described by Atlas[46] and 100 µl vitamin solution. The vitamin solution contained per litre 50 mg pantothenic acid, 50 mg riboflavin, 10 mg pyridoxamine-HCl, 20 mg biotin, 20 mg folic acid, 25 mg niacin, 25 mg nicotinamide, 50 mg α-aminobenzoic acid, 50 mg thiamine-HCl and 50 mg cobalamine dissolved in H2O. M9 medium was supplemented with a final concentration of 0.1% (w/v) sterile skim milk to generate M9 skim milk medium. For medium solidification agar with a final concentration of 1.5% (w/v) was added prior to sterilisation by autoclaving.
Table 1

Bacterial strains und plasmids.

StrainGenotypeSource/Ref.
E. coli TOP10F- mcrA, Δ(mrr-hsdRMS-mcrBC), φ80lacZΔM15, ΔlacX74, nupG, recA1, araD139, Δ(ara-leu)7697, galE15, galK16, rpsL(StrR), endA1, λ Invitrogen
E. coli S17-1SmR, TpR, mod +, res , thi, pro, recA , RP4-Tc::Mu-Km::Tn7Lab strain collection[49]
B. licheniformis MW3 B. licheniformis DSM13 (ΔhsdR1, ΔmcrA, ΔhsdR2)Prof. Dr. Friedhelm Meinhardt, University Münster[48]
B. licheniformis MW3 AprAs B. licheniformis DSM13 (ΔhsdR1, ΔmcrA, ΔhsdR2, AprAs)this study
B. licheniformis MW3 pV2::aprAs B. licheniformis MW3 with pV2::aprAs this study
B. licheniformis MW3 AprA pV2::aprAs B. licheniformis MW3 AprA with pV2::aprAs this study
B. licheniformis MW3 pV2 B. licheniformis MW3 with pV2this study
B. licheniformis MW3 AprA pV2 B. licheniformis MW3 AprA with pV2this study
Plasmid Genotype Host Source/Ref.
pKVM2 bla tet R (PclpB-bgaB) oriT E. coli, Bacillus 47
pKVM2 AprAs AprAs deletion vector E. coli, Bacillus this study
pV2 bla, kan, oriT E. coli, Bacillus 33
pV2::aprAs bla, kan, oriT, aprAs E. coli, Bacillus this study
Bacterial strains und plasmids.

PCR, gel electrophoresis and vector construction

Primers used in this study are listed in Table 2 and plasmids in Table 1. PCRs (50 μl) consisted of 200 μM deoxynucleotides, 100 ng of template DNA, 5 pmol of each primer and 0.5 U Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Darmstadt, Germany). PCR products were purified directly using the PCR Purification Kit (Qiagen, Hilden, Germany) or after gel electrophoresis using a Qiaquick Gel extraction Kit (Qiagen, Hilden, Germany). DNA was analysed using a TAE agarose gel system as described elsewhere[42] and stained with Ethidium bromide (1 µg/mL) for 10 min. Vectors were constructed as described previously[30] using Escherichia coli TOP10 (Invitrogen, Carlsbad, USA) and isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). For sequence verification Sanger-sequencing was performed on an ABI3730XL capillary sequencer (BigDye 3.1 chemistry; Applied Biosystems, Darmstadt, Germany).
Table 2

Primers.

NameSequence
HLRH300 AAA GGATCCATTGGGCGGAGCAGACGTCAAAGCG
HLRH301CTCAATAACGGCGCGCCACAAATGGCATATAGAAAAAGCTAGTGTTTTTAGCAC
HLRH302GCCATTTGTGGCGCGCCGTTATTGAGCGGCAGCTTCGACATTG
HLRH303 TTTT CCATGGCTCGTGTTCACGATGGCCTTCAGC
HLRH304GGCCGATCAGGCAGATATTC
HLRH305GCATGTTGCCGGTACAGTAG
HLRH306GGGAGCCTTTCTCCTGTATGTG
HLRH307TCTTTCCCTGCCAGGTTGAAGC
HLRH308TTGAGCGGCAGCTTCGACATTG
HLRH309 CTAATACGACTCACTATAGGGAGACGGGAGCAGCAGCTTTGATCTTG
apr fwdCACTAGCTTTTTCTATATGCCATTTG
apr revACGGCGACTTATTTGGGAAGC
HLRH320 CTGA CGGCGCGCCGACCATCAGGCTCAACAGCG
HLRH321 TGCCCC ACGCGTGGATTGTGCTCTGGGATACCAC

Primer extensions are presented in italics and restriction sites in bold letters. The T7 RNA polymerase promoter is underlined and presented in italics.

Primers. Primer extensions are presented in italics and restriction sites in bold letters. The T7 RNA polymerase promoter is underlined and presented in italics.

Mutant construction

For construction of B. licheniformis MW3 AprAs−, the markerless deletion protocol of Rachinger et al.[47] was applied to the strain B. licheniformis MW3[48], a restriction-modification (RM) system-negative derivative of B. licheniformis DSM13[23, 24]. The deletion cassette consisted of flank A (primer pair HLRH300/301) and flank B (primer pair HLRH302/303), which were amplified from B. licheniformis MW3 chromosomal DNA. The used primers included the AscI restriction site instead of the −10 box of the putative AprAs promoter. The flanks were fused via SOE-PCR and cloned into the temperature-sensitive vector pKVM2 using BamHI and NcoI restriction sites (BamHI, NcoI, FastAP and T4-DNA-ligase (Thermo Scientific, Darmstadt, Germany)). Escherichia coli S17-1[49] was used for conjugative transfer of the resulting pKVM2 AprAs− deletion vector. The introduced deletion was confirmed by restriction analysis. For this purpose, the region of interest was amplified via PCR using primer HLRH306/307 and digested with the endonuclease AscI. The introduced AscI restriction site in the mutant strains results in the degradation of the 2.6 kbp PCR product to 1.3 kbp. The genotype of B. licheniformis MW3 AprAs− was also confirmed by sequencing using primer pair HLRH306/307 and the primers HLRH304/305/306/307. The complementation vector pV2::aprAs was constructed by amplification of aprAs from B. licheniformis MW3 chromosomal DNA using primers HLRH320/321 and cloning of the PCR product into the Bacillus/E. coli shuttle vector pV2[33] using AscI and MluI restriction sites. For construction of the B. licheniformis plasmid harbouring strains, pV2::aprAs or the empty pV2 were transferred via conjugation using Escherichia coli S17-1[49]. The generated strains were controlled via plasmid re-isolation and restriction analysis.

Slot Blot analysis

Cells were collected at different time points and disrupted with a Mikrodismembrator U (B. Braun Biotech International GmbH, Melsungen, Germany). Total RNA was prepared using the RNeasy Mini Kit (Quiagen, Hilden, Germany). The RNA quality was analysed using the Agilent 2100 Bioanalyser and the Agilent RNA 6000 Nano ladder (Agilent Technologies, Waldbronn). Digoxigenin labelled RNA probes were prepared by in vitro transcription with T7 RNA polymerase using the DIG Northern Starter Kit (Roche, Basel, Switzerland) and templates for in vitro transcription were generated by PCR using the primer pair HLRH308/309. Total RNA was diluted in 10x SSC to a concentration of 0.5 μg/100 μl and blotted on to a positively charged Nylon membrane (Roche, Basel, Switzerland) using the Bio-Dot SF microfiltration unit (BIO-RAD Laboratories GmbH, Munich, Germany). Subsequently, the RNA was covalently bound by exposing the membrane to UV-light (302 nm) for 120 sec on a UV-light table (Image Quant 100, GE Healthcare, Little Chalfont, UK). RNA probe hybridization was performed using the DIG Northern Starter Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions and detection was accomplished via the ChemoCam Imager (Intes, Göttingen, Germany).

Real-time PCR

Reverse transcription of 100 ng total RNA from each sample was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Darmstadt, Germany). For quantification of the apr cDNA the Real-time PCR Thermal Cycler IQ5 (Biorad, Munich, Germany) was used in combination with the QuaniTect SYBR® Green PCR Kit (Qiagen, Hilden, Germany) and the apr specific primer pair apr fwd/apr rev. For absolute quantification of apr transcripts a standard curve was calculated using vector pV2::aprAs with concentrations of 101 to 108 copies/µl.

Protease assay

For exoprotease activity determination cells were cultivated 12–48 h in M9 skim milk medium and pelleted for 2 min at 16,200× g at 4 °C. The supernatants containing the exoprotease were analysed with Sigmas’ non-specific protease assay[50]. The protease activity for each sample was determined in triplicates using 2 mL Eppendorf tubes. Each sample contained one blank as reference.

Preparation of extracellular protein extracts for 2D-PAGE

B. licheniformis cells were grown in M9 skim milk medium for 48 h and supernatants were harvested by centrifugation of 360 mL cell culture at 10,000 rpm and 4 °C for 10 min. Extracellular proteins were prepared according to Voigt et al.[51]. Briefly, TCA was added to the supernatant to a final concentration of 10% of the initial culture volume and proteins were precipitated at 7 °C overnight. The proteins were collected by centrifugation at 10,000 rpm and 4 °C for 60 min and washed 8 times with 96% ethanol, and two times with 70% ethanol. After drying, the pellets were dissolved in a solution containing 8 M urea and 2 M thiourea, and centrifuged at 15,000 rpm and 4 °C for 30 min. The protein concentration of the samples was determined with RotiNanoquant (Carl Roth, Karlsruhe, Germany).

2D-PAGE, gel image analysis and protein identification

Commercially available IPG strips (18 cm long, Serva, Heidelberg, Germany) in the pH-range 3–10 were used for isoelectric focusing (IEF). 100 µg protein was adjusted to 306 μL with a solution containing 2 M thiourea and 8 M urea. CHAPS solution (20 mM DTT, 1% w/v CHAPS, 0.5% v/v Pharmalyte, pH 3–10) was added (34 µL for each sample). IEF strips were rehydrated with this solution over night. IEF was performed with the following program: step 1, 150 V for 150 Vh, step 2, 300 V for 300 Vh, step 3, 600 V for 600 Vh, step 4, 1500 V for 1500 Vh, step 5, 3000 V for 37.5 kVh. Following IEF, strips were equilibrated as described by Görg et al.[52]. Flat top gels (2D HPETM Large Gel NF-12.5%; Serva, Heidelberg, Germany) were used for protein separation in the second dimension. Gels were stained with Lava Purple (Fluorotechnics, Sydney, Australia) according to the instructions of the manufacturer. Gel images were analyzed with the Delta2D software (Decodon, Greifswald, Germany). Spot quantification was done according to Wolf et al.[34]. Briefly, gel images (three replicates) from the wild type samples were overlaid with the gels from the mutant samples. Fusion gels created with the image fusion function of the Delta2D software set to union fusion were used for spot detection. Spots were edited and transferred to the single gels. For spot quantification the % volume of each spot was calculated representing the relative portion of an individual spot of the total protein present on the gel. Proteins were excised from the gels using the Ettan Spot Picker (GE Healthcare, Little Chalfont, UK). Digestion and spotting onto MALDI targets were performed in the Ettan Spot Handling Workstation (GE Healthcare, Little Chalfont, UK). MALDI-TOF-MS/MS with the Proteome Analyzer 4800 (Applied Biosystems, Darmstadt, Germany) was performed as described by Wolf et al.[34]. Peak lists were searched with the MASCOT search engine version 2.1.0.4 (Matrix Science, London, UK) and search parameters as in Wolf et al.[34] against a B. subtilis data base.

Sequence analysis

For identification of the putative aprAs promoter region in 17 B. licheniformis strains and B. subtilis 168, the intergenic region between yhfN and apr from B licheniformis DSM13 was used to perform a blastn search. Correspondingly, the intergenic region between yhfN and aprE from B. subtilis 168 was used as query for a blastn search on 35 B. subtilis genomes. The identified regions were extracted from the respective genomes and used for a comparative sequence alignment performed with MUSCLE[53] using default parameters. Transcriptional terminators were predicted with the program TransTermHP[54]. Secondary structure predictions were performed using “The Vienna RNA Websuite”[55]. Supplementary information
  51 in total

1.  Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis.

Authors:  Pierre Nicolas; Ulrike Mäder; Etienne Dervyn; Tatiana Rochat; Aurélie Leduc; Nathalie Pigeonneau; Elena Bidnenko; Elodie Marchadier; Mark Hoebeke; Stéphane Aymerich; Dörte Becher; Paola Bisicchia; Eric Botella; Olivier Delumeau; Geoff Doherty; Emma L Denham; Mark J Fogg; Vincent Fromion; Anne Goelzer; Annette Hansen; Elisabeth Härtig; Colin R Harwood; Georg Homuth; Hanne Jarmer; Matthieu Jules; Edda Klipp; Ludovic Le Chat; François Lecointe; Peter Lewis; Wolfram Liebermeister; Anika March; Ruben A T Mars; Priyanka Nannapaneni; David Noone; Susanne Pohl; Bernd Rinn; Frank Rügheimer; Praveen K Sappa; Franck Samson; Marc Schaffer; Benno Schwikowski; Leif Steil; Jörg Stülke; Thomas Wiegert; Kevin M Devine; Anthony J Wilkinson; Jan Maarten van Dijl; Michael Hecker; Uwe Völker; Philippe Bessières; Philippe Noirot
Journal:  Science       Date:  2012-03-02       Impact factor: 47.728

Review 2.  Bacterial small RNA regulators: versatile roles and rapidly evolving variations.

Authors:  Susan Gottesman; Gisela Storz
Journal:  Cold Spring Harb Perspect Biol       Date:  2011-12-01       Impact factor: 10.005

3.  Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis.

Authors:  Giulia Barbieri; Alessandra M Albertini; Eugenio Ferrari; Abraham L Sonenshein; Boris R Belitsky
Journal:  J Bacteriol       Date:  2016-01-04       Impact factor: 3.490

4.  Isolation of an organic solvent-tolerant bacterium Bacillus licheniformis PAL05 that is able to secrete solvent-stable lipase.

Authors:  Periasamy Anbu; Byung Ki Hur
Journal:  Biotechnol Appl Biochem       Date:  2014-03-25       Impact factor: 2.431

5.  Global expression profiling of Bacillus subtilis cells during industrial-close fed-batch fermentations with different nitrogen sources.

Authors:  Britta Jürgen; Steffen Tobisch; Mogens Wümpelmann; Dirk Gördes; Andreas Koch; Kerstin Thurow; Dirk Albrecht; Michael Hecker; Thomas Schweder
Journal:  Biotechnol Bioeng       Date:  2005-11-05       Impact factor: 4.530

Review 6.  Control of key metabolic intersections in Bacillus subtilis.

Authors:  Abraham L Sonenshein
Journal:  Nat Rev Microbiol       Date:  2007-12       Impact factor: 60.633

7.  The complete genome sequence of Bacillus licheniformis DSM13, an organism with great industrial potential.

Authors:  Birgit Veith; Christina Herzberg; Silke Steckel; Jörg Feesche; Karl Heinz Maurer; Petra Ehrenreich; Sebastian Bäumer; Anke Henne; Heiko Liesegang; Rainer Merkl; Armin Ehrenreich; Gerhard Gottschalk
Journal:  J Mol Microbiol Biotechnol       Date:  2004

8.  Sigma's Non-specific Protease Activity Assay - Casein as a Substrate.

Authors:  Carrie Cupp-Enyard
Journal:  J Vis Exp       Date:  2008-09-17       Impact factor: 1.355

9.  Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species.

Authors:  Michael W Rey; Preethi Ramaiya; Beth A Nelson; Shari D Brody-Karpin; Elizabeth J Zaretsky; Maria Tang; Alfredo Lopez de Leon; Henry Xiang; Veronica Gusti; Ib Groth Clausen; Peter B Olsen; Michael D Rasmussen; Jens T Andersen; Per L Jørgensen; Thomas S Larsen; Alexei Sorokin; Alexander Bolotin; Alla Lapidus; Nathalie Galleron; S Dusko Ehrlich; Randy M Berka
Journal:  Genome Biol       Date:  2004-09-13       Impact factor: 13.583

10.  Optimization and partial characterization of culture conditions for the production of alkaline protease from Bacillus licheniformis P003.

Authors:  Palash Kumar Sarker; Saimon Ahmad Talukdar; Promita Deb; Sm Abu Sayem; Kaniz Mohsina
Journal:  Springerplus       Date:  2013-10-04
View more
  3 in total

Review 1.  Synthetic Biology of Small RNAs and Riboswitches.

Authors:  Jordan K Villa; Yichi Su; Lydia M Contreras; Ming C Hammond
Journal:  Microbiol Spectr       Date:  2018-05

2.  Plasmid Negative Regulation of CPAF Expression Is Pgp4 Independent and Restricted to Invasive Chlamydia trachomatis Biovars.

Authors:  Harlan D Caldwell; Grant McClarty; Michael John Patton; Chih-Yu Chen; Chunfu Yang; Stuart McCorrister; Chris Grant; Garrett Westmacott; Xin-Yong Yuan; Estela Ochoa; Robert Fariss; William M Whitmire; John H Carlson
Journal:  mBio       Date:  2018-01-30       Impact factor: 7.867

Review 3.  Keratinases as Versatile Enzymatic Tools for Sustainable Development.

Authors:  Marcin Sypka; Iga Jodłowska; Aneta M Białkowska
Journal:  Biomolecules       Date:  2021-12-18
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.