| Literature DB >> 28676800 |
Tatsuhiko Hoshino1,2, Tomohiro Toki3, Akira Ijiri1,2, Yuki Morono1,2, Hideaki Machiyama2, Juichiro Ashi4, Kei Okamura5, Fumio Inagaki1,2,6.
Abstract
Submarine mud volcanoes (SMVs) are formed by muddy sediments and breccias extruded to the seafloor from a source in the deep subseafloor and are characterized by the discharge of methane and other hydrocarbon gasses and deep-sourced fluids into the overlying seawater. Although SMVs act as a natural pipeline connecting the Earth's surface and subsurface biospheres, the dispersal of deep-biosphere microorganisms and their ecological roles remain largely unknown. In this study, we investigated the microbial communities in sediment and overlying seawater at two SMVs located on the Ryukyu Trench off Tanegashima Island, southern Japan. The microbial communities in mud volcano sediments were generally distinct from those in the overlying seawaters and in the well-stratified Pacific margin sediments collected at the Peru Margin, the Juan de Fuca Ridge flank off Oregon, and offshore of Shimokita Peninsula, northeastern Japan. Nevertheless, in-depth analysis of different taxonomic groups at the sub-species level revealed that the taxon affiliated with Atribacteria, heterotrophic anaerobic bacteria that typically occur in organic-rich anoxic subseafloor sediments, were commonly found not only in SMV sediments but also in the overlying seawater. We designed a new oligonucleotide probe for detecting Atribacteria using the catalyzed reporter deposition-fluorescence in situ hybridization (CARD-FISH). CARD-FISH, digital PCR and sequencing analysis of 16S rRNA genes consistently showed that Atribacteria are abundant in the methane plumes of the two SMVs (0.58 and 1.5 × 104 cells/mL, respectively) but not in surrounding waters, suggesting that microbial cells in subseafloor sediments are dispersed as "deep-biosphere seeds" into the ocean. These findings may have important implications for the microbial transmigration between the deep subseafloor biosphere and the hydrosphere.Entities:
Keywords: Atribacteria; CARD-FISH; deep subseafloor biosphere; digital PCR; methane; submarine mud volcano
Year: 2017 PMID: 28676800 PMCID: PMC5476839 DOI: 10.3389/fmicb.2017.01135
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Sampling sites.
| Cruise/expedition | Site | Latitude | Longitude | WD∗ | SD∗∗ |
|---|---|---|---|---|---|
| KH-15-02 | VTF2 (MV#1) | 30.88 | 131.77 | 1401 | 18–356 |
| VTF5 (MV#14) | 30.19 | 131.39 | 1667 | 29–301 | |
| ODP Leg 201 | 1227 | -8.99 | -79.96 | 427 | 50–660 |
| IODP Expedition 301 | 1301C | 47.75 | -127.76 | 2656 | 20–370 |
| CK-06-06 | C9001 | 41.18 | 142.20 | 1180 | 100–280 |
Oligonucleotide primers and Atribacteria-specific probe used in this study.
| Primer | Sequence (5′–3′) | Target | Use∗ | Reference |
|---|---|---|---|---|
| U515F | TGYCAGCMGCCGCCGTAA | Prokaryote | S | |
| U806R | GGACTACHVGGGTWTCTAAT | Prokaryote | S | |
| 515F_miseq∗∗ | AATGATACGGCGACCACCGAGATCTACAC | 1 st PCR product | S | |
| TCAGATGTGTATAAGAGACAGRYSWRTGYCAGCMGCCGCGGTAA | ||||
| 806R_miseq | CAAGCAGAAGACGGCATACGAGAT[index12nt]GTCTCGTGGGCTCGGAGAT | 1 st PCR product | S | |
| GTGTATAAGAGACAGRYSWRGGACTACHVGGGTWTCTAAT | ||||
| B27F | AGRGTTYGATYMTGGCTCAG | Bacteria | D | |
| B357R | CTGCWGCCNCCCGTAGG | Bacteria | D | |
| A806F | ATTAGATACCCSBGTAGTCC | Archaea | D | |
| A958R | YCCGGCGTTGAMTCCAATT | Archaea | D | |
| Atri578 | ACTTTTAAGACCGCCTACGA | C | This study | |