| Literature DB >> 28513574 |
Guotao Peng1,2, Sijie Lin3, Zhengqiu Fan4, Xiangrong Wang5.
Abstract
An important goal of understanding harmful algae blooms is to determine how envEntities:
Keywords: antioxidant system; mcy; microcystin; nitrogen; phosphorus
Mesh:
Substances:
Year: 2017 PMID: 28513574 PMCID: PMC5450716 DOI: 10.3390/toxins9050168
Source DB: PubMed Journal: Toxins (Basel) ISSN: 2072-6651 Impact factor: 4.546
Figure 1Cell density of M. aeruginosa at each treatment: nitrogen (A); and phosphorus (B). Different colors indicate different treatments: control (black), nutrient-deficient (red) and nutrient-added treatments (blue).
Figure 2Relative transcription levels of target genes in N treatments. Red colors indicate the significant results compared to the control (p < 0.05). Significant differences are noted between N-deficient and N-added treatments (p < 0.001 ***, p < 0.01 **, p < 0.05 *).
Figure 3Relative transcription levels of target genes in P treatments. Red colors indicate the significant results compared to the control (p < 0.05). Significant differences are noted between P-deficient and P-added treatments (p < 0.001 ***, p < 0.01 **, p < 0.05 *).
Figure 4The concentration of Malondialdehyde (MDA), Glutathione (GSH) and Superoxide dismutase (SOD) of M. aeruginosa at each treatment. Different colors represent sampling days: Day 3 (black), Day 5 (red), Day 7 (blue) and Day 9 (green). Same letters indicate observations that are statistically indistinguishable (ANOVA, p < 0.05).
Pearson’s correlation analysis between MDA and SOD, GSH concentrations at all treatments.
| Pearson’s Correlation Analysis | Pearson’s R | Adj. R-Square | |
|---|---|---|---|
| MDA vs. SOD | 0.002 | 0.7261 | 0.4908 |
| MDA vs. GSH | 0.039 | 0.5363 | 0.2328 |
Primers for RT-qPCR in this study
| Primer | Nucleotide Sequence (5′ to 3′) | Amplification Size (bp) | Reference |
|---|---|---|---|
| GGACGGGTGAGTAACGCGTA | 74 | [ | |
| CCCATTGCGGAAAATTCCCC | |||
| CCTACCGAGCGCTTGGG | 77 | This study | |
| GAAAATCCCCAAAGATTCCTGAGT | |||
| CGGTGACTGGGGTGTGTATG | 119 | This study | |
| ACTCGGTTTGGGGATGGA | |||
| TCTTCGGCATCGCTTTCTC | 90 | This study | |
| CACCCACAGCACTCATCCA | |||
| CGTTTCCCCGTCGCTTT | 122 | This study | |
| CCGAGTTTGGGTTTGATGGT |