Literature DB >> 27357128

Exposure to vector-borne pathogens in candidate blood donor and free-roaming dogs of northeast Italy.

Marta Vascellari1, Silvia Ravagnan1, Antonio Carminato1, Stefania Cazzin1, Erika Carli1, Graziana Da Rold1, Laura Lucchese1, Alda Natale1, Domenico Otranto2, Gioia Capelli3.   

Abstract

BACKGROUND: Many vector-borne pathogens including viruses, bacteria, protozoa and nematodes occur in northeast Italy, representing a potential threat to animal and human populations. Little information is available on the circulation of the above vector-borne pathogens in dogs. This work aims to (i) assess exposure to and circulation of pathogens transmitted to dogs in northeast Italy by ticks, sandflies, and mosquitoes, and (ii) drive blood donor screening at the newly established canine blood bank of the Istituto Zooprofilattico Sperimentale delle Venezie.
METHODS: Blood samples from 150 privately-owned canine candidate blood donors and 338 free-roaming dogs were screened by serology (IFA for Leishmania infantum, Ehrlichia canis, Anaplasma phagocythophilum, Babesia canis, Rickettsia conorii, R. rickettsii), microscopic blood smear examination, and blood filtration for Dirofilaria spp. All candidate donors and seropositive free-roaming dogs were tested by PCR for L. infantum, E. canis, A. phagocythophilum, Babesia/Theileria and Rickettsia spp. The dogs had no clinical signs at the time of sampling.
RESULTS: Overall, 40 candidate donors (26.7 %) and 108 free-roaming dogs (32 %) were seroreactive to at least one vector-borne pathogen. Seroprevalence in candidate donors vs free-roaming dogs was: Leishmania infantum 6.7 vs 7.1 %; Anaplasma phagocytophilum 4.7 vs 3.3 %; Babesia canis 1.3 vs 2.7 %; Ehrlichia canis none vs 0.9 %; Rickettsia conorii 16 vs 21.3 % and R. rickettsii 11 vs 14.3 %. Seroreactivity to R. rickettsii, which is not reported in Italy, is likely a cross-reaction with other rickettsiae. Filariae, as Dirofilaria immitis (n = 19) and D. repens (n = 2), were identified in free-roaming dogs only. No significant differences were observed between candidate donors and free-roaming dogs either in the overall seroprevalence of vector-borne pathogens or for each individual pathogen. All PCRs and smears performed on blood were negative.
CONCLUSIONS: This study demonstrated that dogs are considerably exposed to vector-borne pathogens in northeast Italy. Although the dog owners reported regularly using ectoparasiticides against fleas and ticks, their dogs had similar exposure to vector-borne pathogens as free-roaming dogs. This prompts the need to improve owner education on the use of insecticidal and repellent compounds in order to reduce the risk of arthropod bites and exposure to vector-borne pathogens. Based on the absence of pathogens circulating in the blood of healthy dogs, the risk of transmission of these pathogens by blood transfusion seems to be low, depending also on the sensitivity of the tests used for screening.

Entities:  

Keywords:  Canine blood donors; Exposure; Free-roaming dogs; IFAT; Italy; Real-time PCR; Vector-borne pathogens

Mesh:

Year:  2016        PMID: 27357128      PMCID: PMC4928314          DOI: 10.1186/s13071-016-1639-6

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Several vector-borne pathogens (VBPs), transmitted by ticks, mosquitoes and sandflies, occur in dogs living in northeast Italy. Infection and/or disease are caused by members of the genera Anaplasma, Babesia, Borrelia, Dirofilaria, Ehrlichia, Leishmania, and Rickettsia [1-7]. Some of these infections can be life-threatening in dogs (leishmaniosis, cardiopulmonary filariosis, babesiosis) and, in some cases, in humans (leishmaniosis, dirofilariosis, anaplasmosis) [6]. The occurrence of a VBP in a given area is directly dependent on the presence of reservoir hosts and the density of the vectors. For example, the distribution of arthropod vectors in northeast Italy is well known as regards mosquitoes due to the presence of surveillance programs for West Nile virus [8, 9] and other arboviruses transmitted by the tiger mosquitoes, Aedes albopictus [10, 11]. Culex pipiens, Ae. albopictus, Ochlerotatus caspius and Ae. vexans have been identified as the most widespread mosquitoes in the area, including the novel invasive species, Aedes koreicus, which has recently been detected [12] and is expanding [13, 14]. All of the above mosquito species have been proven or are suspected to be vectors of Dirofilaria spp. [15-18]. Ixodes ricinus is the most widespread tick species in northeast Italy and has repeatedly been found to be infected with VBPs that can also affect dogs, i.e. Borrelia burgdorferi (s.l.), Rickettsia helvetica, R. monacensis, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Babesia spp. [19-24]. However, the most common tick species removed from dogs of north Italy is Rhipicephalus sanguineus, followed by I. hexagonus, I. ricinus and Dermacentor marginatus [21, 25, 26]. No studies are available on the vectorial role of Rh. sanguineus in north Italy. Two species of sandfly, Phlebotomus perniciosus and P. neglectus, have been reported in northeast Italy [4, 27, 28], where they are probably responsible for the transmission of L. infantum to dogs. Several VBPs can also be transmitted by blood transfusion. The safety of donated blood with respect to VBPs is guaranteed by serological and molecular screening of dog donors. The Consensus Statements of the American College of Veterinary Internal Medicine (ACVIM) for blood transfusion [29] recommend that donors be screened for VBPs in accordance with the following criteria: (i) the agent is known to be present in the territory; (ii) the agent is known to be potentially transmitted by blood transfusion; (iii) the agent is capable of causing subclinical infection in candidate blood donors; (iv) the disease in the recipient is severe or difficult to foresee. Hence knowledge of VBP circulation among dog populations is pivotal to estimating the risk of transmission by transfusion. In this study, we assessed exposure to and circulation of pathogens transmitted by ticks, sandflies and mosquitoes to dogs in northeast Italy, including free-roaming dogs and candidate blood donors at the newly established canine Blood Bank of the Istituto Zooprofilattico Sperimentale delle Venezie.

Methods

Dogs

From January 2014 to December 2015, a total of 488 dogs, including candidate blood donors (CBD) (n = 150) and free-roaming dogs (FRD) (n = 338), were sampled in several municipalities of the provinces of north and northeast Italy (municipalities of Padua, Treviso, Verona, Venice, Milan and Bologna). The breed, age, gender and location of the dogs are reported in Table 6.
Table 6

Breed, age, gender and location of the dogs according to seropositivity

Data A. phagocythophilum B. canis E. canis L. infantum R. conorii R. rickettsii
pos/tested (%)pos/tested (%)pos/tested (%)pos/tested (%)pos/tested (%)pos/tested (%)
Breed
 crossbreed10/327 (3.1)3/323 (0.9)9/327 (2.8)23/327 (7.0)68/327 (20.8)46/323 (14.2)
 other breed7/153 (4.6)0/111 (0)2/153 (1.3)11/153 (7.2)25/153 (16.3)13/116 (11.2)
Age (months)
 ≤122/91 (2.2)1/91 (1.1)1/91 (1.1)9/91 (9.9)16/91 (17.6)10/91 (11.0)
 >12 ≤ 365/88 (5.7)1/72 (1.4)0/87 (0)11/87 (12.6)15/87 (17.2)7/74 (9.5)
 >36 ≤ 603/69 (4.3)1/59 (1.7)1/70 (1.4)3/69 (4.3)9/69 (13.0)8/59 (13.6)
 > 604/68 (5.9)0/61 (0)0/69 (0)2/69 (2.9)14/69 (20.3)14/63 (22.2)
Gender
 female11/177 (6.2)1/148 (0.7)3/177 (1.7)13/176 (7.4)30/176 (17.0)16/150 (10.7)
 male6/303 (2.0)2/286 (0.7)8/304 (2.6)21/304 (6.9)64/304 (21.1)44/289 (15.2)
Location
 Padua9/226 (4.0)3/225 (1.3)2/228 (0.9)16/226 (7.1)41/227 (18.1)34/223 (15.2)
 Treviso2/157 (1.3)0/140 (0)7/158 (4.4)10/157 (6.4)39/157 (24.8)18/140 (12.9)
 Venice3/59 (5,1)0/43 (0)0/59 (0)4/59 (6.8)8/59 (13.6)5/48 (10.4)
 Other4/46 (8.7)0/34 (0)2/46 (4.3)4/46 (8.7)8/46 (17.4)3/34 (8.8)
CBDs were privately-owned dogs and included animals (n = 41) from two dog breeders. According to Italian Ministry of Health guidelines (http://tinyurl.com/h7vs3lz), candidate donor dogs need to fulfil the following inclusion criteria: age 2–8 years, body weight ≥ 25 kg, clinically healthy, regularly vaccinated and protected against endo- and ectoparasites. The FRDs included dogs with no identification (microchip) and privately-owned dogs allowed to wander around, especially in peri-urban and rural areas. According to the Italian law on Companion Animals and the Prevention of Stray Animals (Act no. 281/1991), FRDs are captured by the Local Veterinary Service, housed in shelters and sampled soon after capture. Conversely, CBDs were sampled at their first clinical visit. Whole blood and sera were tested by serology, PCR, blood smear examination, and blood filtration.

Ethical statement

Informed consent was obtained from the owners of CBDs, as required by the Blood Bank to become eligible donors. The donor screening programme included the collection of information on the health history of the dogs and infectious disease testing. FRDs were sampled and underwent a clinical evaluation by the Local Veterinary Health units at the time of entry to the shelter, as part of the zoonotic agent control programme.

Diagnostic procedures

Serology

Dog sera were tested by means of indirect immunofluorescence assay (IFA) to detect and quantify IgG antibodies against L. infantum, E. canis, A. phagocythophilum, B. canis, R. conorii and R. rickettsii. The latter pathogen is not reported in the Old World but was included in the screening battery in an attempt to detect cross-reactions with rickettsiae other than R. conorii. The in-house assay for L. infantum was performed according to the procedure described in the OIE Terrestrial Manual [30]. The serum screening dilution was set at 1:40. The detection of IgG antibodies against the other pathogens was carried out using commercial kits following the manufacturers’ instructions. The kits were: the Ehrlichia canis Canine IFA IgG Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:50; the Canine Granulocytic Anaplasmosis IgG IFA Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:80; Fluo Babesia canis (Agrolabo S.p.A., Scarmagno, Italy), serum screening dilution 1:16; the Rickettsia conorii Canine IFA IgG Kit, and the Rickettsia rickettsii Canine IFA IgG Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:64. Positive and negative controls were added to each slide of the in-house and commercial kits. Two-fold serial dilutions were prepared and tested to define the serum titre of samples testing positive at screening.

Molecular analyses

DNA was extracted from EDTA-blood samples using a DNeasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. The samples were screened for Babesia/Theileria spp., Rickettsia spp., Leishmania spp. and Ehrlichia canis, using in-house SYBR Green Real-Time PCR (rPCR) assays, performed with the primers from [31-34] (Table 1). The reactions were carried out in a total volume of 20 μl, containing 10 μl of QuantiFast SYBR Green PCR Master mix 2X (Qiagen GmbH, Germany), sense and reverse primer (concentration reported in Table 1) and 3 μl of extracted DNA. Amplifications were performed in a StepOnePlus™ instrument (Applied Biosystems, Foster City, CA). The thermal profile consisted of 5 min of activation at 95 °C, followed by 40 cycles at 95 °C for 15 s (denaturation), specific annealing temperature (Table 1) for 30 s (annealing) and 60 °C for 30 s (extension). Following amplification, a melting curve analysis was performed by slowly raising the temperature of the thermal chamber from 60 °C to 95 °C to distinguish between specific amplicons and non-specific amplification products. Anaplasma phagocytophilum DNA was amplified by conventional PCR targeting the major surface protein gene (msp2), as described elsewhere [35]. To ensure the effectiveness of the nucleic acid extraction, a PCR targeting the 18S rRNA gene internal control was applied [36]. Negative (sterile water) and positive controls (DNA of Theileria orientalis, Rickettsia felis, Leishmania infantum, Ehrlichia canis and Anaplasma phagocytophilum) were included in each run.
Table 1

Target genes and rPCR primers used in this study for pathogen identification

Target organismGenePrimerSequence (5'-3')Pc(μM)TA(°C)Reference
Babesia/Theileria 18S rRNABJ1GTCTTGTAATTGGAATGATGG0.160[31]
BN2TAGTTTATGGTTAGGACTACG0.1
Rickettsia spp.rompBRompB OFmGTAACCGGAARTAATCGTTTCGT0.158[32]
RompB ORmGCTTTATAACCAGCTAAACCRCC0.1
Leishmania spp.COIICOII FGGCATAAATCCATGTAAGA0.352[33]
COII RTGGCTTTTATATTATCATTTT0.3
Ehrlichia canis 16S rRNACANISCAATTATTTATAGCCTCTGGCTATAGGA0.560[34]
CA1URGAGTTTGCCGGGACTTCTTCT0.5

Abbreviations: TA temperature of annealing; Pc primer concentration

16S rRNA = gene coding 16S ribosomal RNA; rompB = Rickettsial Outer Membrane Protein B gene; COII = Cytochrome c  oxidase subunit II gene ; 18S rRNA = gene coding 18S ribosomal RNA

Target genes and rPCR primers used in this study for pathogen identification Abbreviations: TA temperature of annealing; Pc primer concentration 16S rRNA = gene coding 16S ribosomal RNA; rompB = Rickettsial Outer Membrane Protein B gene; COII = Cytochrome c  oxidase subunit II gene ; 18S rRNA = gene coding 18S ribosomal RNA

Blood smear examination

The blood smears were stained (Diff Quick Stain Set, Medion Diagnostic AG, Duedingen, SZ) and examined for the presence of any pathogens, i.e. L. infantum, Babesia spp., Hepatozoon canis, A. phagocytophilum, A. platys, E. canis and microfilariae.

Filariae screening and identification

One ml of blood in ethylene diamine tetraacetic acid (EDTA) was tested by standard filtration test and staining. The number of microfilariae per millilitre (mf/ml) was calculated as the average of ten counts serially performed on 10 μl of blood samples. The identification of microfilariae was based on their morphology and morphometry [37]. The samples suspected to be positive for D. repens were confirmed by PCR and sequencing [38].

Statistical analysis

The differences between CBDs and FRDs in the prevalence of VBPs for each pathogen and each data element collected on the dogs (breed, gender, age and location) were analysed by the Chi-square test or Fisher’s exact test, where appropriate. Significance was set at P < 0.01. The agreement between serological status for R. conorii/R. rickettsii and for A. phagocytophilum/E. canis was tested using the kappa coefficient [39]. SPSS for Windows, version 13.0 software was used.

Results

None of the dogs had any clinical signs of VBDs at the time of sampling. The owners of CBDs reported regularly using compounds to control fleas and ticks and taking preventative measures against filariae, while no information was available for FRDs. Overall, 40 CBDs (26.7 %) and 108 FRDs (32.0 %) were seroreactive to at least one VBP, as shown in Table 2. No significant differences were observed between CBDs and FRDs in the overall seroprevalence of VBPs or for each individual pathogen.
Table 2

Serological results and positivity for filariae in candidate blood donors and free-roaming dogs of northeastern Italy, 2014-2015

PathogensCandidate blood donorsFree-roaming dogs
No. examinedNo. positive%No. examinedNo. positive%
Anaplasma phagocytophilum 15074.7338113.3
Babesia canis 1040033830.9
Ehrlichia canis 15021.333892.7
Leishmania infantum 150106.7336247.1
Rickettsia conorii 1502416.03387221.3
Rickettsia rickettsii 1091211.03364814.3
R. conorii and R. rickettsii 1091211.0336339.82
Dirofilaria spp.15000330216.4
Serological results and positivity for filariae in candidate blood donors and free-roaming dogs of northeastern Italy, 2014-2015 Seropositivity was most frequently detected against rickettsiae (26 % in CBDs vs 24.3 % in FRDs), followed by L. infantum (~7 % in both groups). Twenty-six of the CBDs (17.3 %) were seroreactive to one test only, 13 (8.7 %) to two and 1 (0.7 %) to three (details in Table 3). Of the FRDs, 56 dogs (16.6 %) were seroreactive to one test only, 43 (12.7 %) to two, 7 (2.1 %) to three and 1 (0.3 %) to four (details in Table 4).
Table 3

Candidate blood donors seroreactive to several antigens (n = 40)

Candidate donor no. Ap Bc Ec Li Rc Rr
10ne01:400ne
20001:401:640
31:8000000
40001:8000
51:8000000
600001:640
70ne01:400ne
81:16000000
91:16000000
100ne001:64ne
111:80ne000ne
120ne001:512ne
1300001:1280
1400001:641:64
151:800001:5121:512
1600001:1280
1700001:641:64
180ne01:4000
190ne001:64ne
2000001:2561:256
2100001:641:64
220ne01:400ne
230ne01:400ne
240ne01:400ne
250001:12801:2560
260ne001:256ne
2700001:641:64
2800001:640
2900001:640
3000001:641:64
3100001:641:64
3200001:81921:2048
3300001:641:64
34001:80000
350ne1:5000ne
3600001:640
3700001:1281:128
380ne01:400ne
391:8000000
4000001:1281:256

Abbreviations: Ap, Anaplasma phagocytophilum; Bc, Babesia canis; Ec, Ehrlichia canis; Li, Leishmania infantum; Rc, Rickettsia conorii; Rr, Rickettsia rickettsii; ne, not examined

Table 4

Free-roaming dogs seroreactive to several antigens (n = 108)

Free-roaming dog no. Ap Bc Ec Li Rc Rr
100001:1281:128
200001:640
30001:4000
400001:1281:128
500001:1280
6001:50000
7001:50000
800001:640
900001:2561:256
1000001:640
11001:50000
12001:5001:1280
1300001:640
1400001:1280
1500001:1280
1600001:640
1700001:5121:128
180001:401:1280
190001:401:2560
20000001:64
2100001:640
2200001:1280
23001:50000
24000001:64
2500001:641:64
2600001:641:64
2700001:640
2800001:641:64
29001:5001:641:64
30001:400000
3100001:5121:256
3200001:20481:2048
331:80001:401:10241:512
340001:4000
350001:401:640
3600001:1280
3700001:1281:128
380001:401:10241:256
391:80001:4000
4000001:640
4100001:1280
4200001:1280
4300001:640
440001:401:2561:1280
4500001:641:64
460001:4000
4700001:640
4800001:1280
491:16000000
501:32000ne1:64ne
51000ne1:256ne
5200001:641:64
5300001:641:64
540001:4000
551:160001:401:640
560001:4000
57000001:64
581:1600001:2561:256
591:320001:4000
600001:4000
6100001:640
6200001:640
6301:16001:2560
641:800001:640
65000001:1024
6600001:10241:2048
6700001:10241:2048
6800001:2561:256
690001:4000
700001:4000
710001:401:1281:64
720001:401:1280
7300001:1281:64
7400001:2561:64
7500001:1280
761:8000001:64
77000001:64
7800001:641:256
7900001:640
8000001:641:64
810001:4001:64
821:800001:2561:512
8300001:2561:512
8400001:10240
8500001:640
8600001:640
87000001:128
8800001:2561:128
89000001:64
9000001:1281:128
91001:50000
9200001:641:256
93001:100000
94000001:64
95000001:64
961:512000000
9700001:5121:1024
980001:4000
9901:160000
10001:160000
1010001:4000
10200001:641:64
10300001:641:256
10400001:641:128
1050001:4000
10600001:1281:128
10700001:641:64
1080001:4000

Abbreviations: Ap, Anaplasma phagocytophilum; Bc, Babesia canis; Ec, Ehrlichia canis; Li, Leishmania infantum; Rc, Rickettsia conorii; Rr, Rickettsia rickettsii; ne, not examined

Candidate blood donors seroreactive to several antigens (n = 40) Abbreviations: Ap, Anaplasma phagocytophilum; Bc, Babesia canis; Ec, Ehrlichia canis; Li, Leishmania infantum; Rc, Rickettsia conorii; Rr, Rickettsia rickettsii; ne, not examined Free-roaming dogs seroreactive to several antigens (n = 108) Abbreviations: Ap, Anaplasma phagocytophilum; Bc, Babesia canis; Ec, Ehrlichia canis; Li, Leishmania infantum; Rc, Rickettsia conorii; Rr, Rickettsia rickettsii; ne, not examined The most common seropositivity for two antigens in the same dog (co-reaction) was for R. conorii and R. rickettsii, in both groups of dogs (Tables 3 and 4). Specifically, of the 101 dogs testing positive for Rickettsia spp., 49 (48.5 %) were positive for both rickettsiae, 41 (40.6 %) exclusively for R. conorii and 11 (10.9 %) exclusively for R. rickettsii, the latter all being FRDs. Agreement between seropositivity for the two rickettsiae was moderate (k = 0.586), suggesting a certain degree of cross-reactivity. Conversely, seroreactivity for A. phagocytophilum and E. canis was completely discordant (k = -0.29), suggesting that these antigens did not cross-react in our test. The distribution of antibody titres was similar between CBDs and FRDs (P > 0.05) (Table 5).
Table 5

Distribution of antibody titres for each pathogen in candidate blood donors and free-roaming dogs in northeast Italy, 2014–2015

Pathogensa Candidate blood donorsFree-roaming dogs
Pos 1st dilutionPos 2nd dilutionPos > 2nd dilutionMax. titrePos 1st dilutionPos 2nd dilutionPos > 2nd dilutionMax. titre
Anaplasma phagocytophilum 5201:1605331:5120
Babesia canis 0003001:16
Ehrlichia canis 1101:1007111:400
Leishmania infantum 8111:128024001:40
Rickettsia conorii 14461:81923319201:2048
Rickettsia rickettsii 7141:2048229171:2048

a Serum screening dilution: Ap (1:80); Bc (1:16); Ec (1:50); Li (1:40); Rc (1:64); Rr (1:64)

Distribution of antibody titres for each pathogen in candidate blood donors and free-roaming dogs in northeast Italy, 2014–2015 a Serum screening dilution: Ap (1:80); Bc (1:16); Ec (1:50); Li (1:40); Rc (1:64); Rr (1:64) Among the dogs testing positive for L. infantum, only one dog showed a high antibody titre, consistent with clinical leishmaniosis (1:1280). The antibody titre for R. conorii or R. rickettsii was above 1: 320 (Table 5) in a total of 26 dogs (5.3 %). The 12 CBDs testing positive to both species of Rickettsia showed very similar titres. Conversely, 10 (27 %) of the 37 FRDs presenting co-reactions had a higher titre for R. rickettsii. No significant differences were found between seropositivity and the data given in Table 6. Breed, age, gender and location of the dogs according to seropositivity Microfilariae were found exclusively in FRDs (n = 21; 6.4 %) (χ = 9.982, df = 1, P = 0.0016) and were identified as D. immitis (n = 19) and D. repens (n = 2). All dogs testing positive for microfilariae were from the province of Padua (21/219; 9.6 %). The microfilariae of D. immitis per ml of blood (mf/ml) ranged from 4 to 26,620 (mean = 413), and numbered 26 and 14,440 mf/ml, respectively, in the two dogs found positive for D. repens. All PCRs and smears performed on blood were negative.

Discussion

This study has demonstrated that dogs are considerably exposed to VBPs in northeast Italy. The most frequent pathogens encountered by dogs in this area are members of the genus Rickettsia. Considering that R. rickettsii (the agent of Rocky Mountain Spotted Fever) is not reported in the Old World, the seroreactivity to this pathogen in the dogs in our study was the effect of a cross-reaction with other rickettsiae, as reported elsewhere [41] and stated in the instructions accompanying the serological kit used. The following species of Rickettsia were detected in north Italy: R. helvetica and R. monacensis, a common finding in Ixodes ricinus ticks [19, 20, 24], and R. slovaca and R. raoultii, detected in Dermacentor marginatus ticks removed from wild boars [42]. The circulation of many other Rickettsia spp. is reported in hosts and vectors in central and southern Italy, the most common being R. massiliae, R. aeschlimannii and R. conorii israeliensis [25, 43, 44]. Rickettsia conorii (the agent of the Mediterranean Spotted Fever), has been detected almost exclusively in southern Italy, in both humans [40] and dogs [2]. It can therefore be argued that a certain level of seroreactivity to this antigen is due to a cross-reaction with other Rickettsia spp. The high rate of exposure to rickettsiae and the low rate of exposure to A. phagocytophilum of the dogs in our study is consistent with the rate of infection found in Ixodes ricinus in the same area between 2005 and 2008 (i.e. 13.1 % and 3.7 % for R. helvetica and R. monacensis, respectively, and 1.5 % for A. phagocytophilum) [24]. In our survey, three FRDs had high titres for A. phagocytophilum, without any evident clinical signs, indicating either a previous infection or a subclinical/mild infection in dogs not subjected to laboratory testing to carefully evaluate their clinical status. However, in a previous study using an IFA test, seroprevalence was not significantly different between sick (47 %) and healthy dogs (40 %) [45]. Our dogs were found to have a very low rate of exposure to other pathogens transmitted by Rhipicephalus ticks (Ehrlichia and Babesia) compared to studies performed in central [46] and southern Italy [47, 48], which reported seroprevalence to be up to 46 % for E. canis and as high as 70 % for Babesia spp. This is likely due to the lower abundance of the brown dog tick of the Rh. sanguineus group in the northern compared to southern Italy, where warmer temperatures throughout the year may contribute to increasing tick abundance [49]. In addition, many studies have suggested that vector competence of different populations (haplotypes or sibling species) of the R. sanguineus group may vary, reviewed in [50]. However, populations of R. sanguineus have never been accurately mapped in northern Italy. The second pathogen to which FRDs and CBD dogs are exposed is L. infantum. All but one of the animals showed a serological titre below 1:80, a cut-off not usually indicative of infection [51] and thus requiring confirmation by other tests or seroconversion. The IFA used in this study showed no [52], or a very low rate of, cross-reaction with other VBPs [53], suggesting that the seroreactivity is most likely due to contact with an infected sandfly. This is consistent with the history of Leishmania in northern regions. Indeed, 20 years ago canine leishmaniosis was regarded as an infection “imported” from endemic areas of the south. The scenario has quickly changed [5], with new foci continuing to emerge in northern regions [4, 54, 55] and phlebotomine vectors recently being found in the northernmost part of the eastern Italian Alps [27]. Detection of D. immitis and D. repens in FRDs indicate that both nematodes are still circulating in the area of investigation, particularly in the lowlands around Padua. Northeastern Italy is an endemic area for D. immitis, with prevalences of up to 80 % being reported in the past [5, 56]. Surveys performed in the 1990s in the same province found 67 % of 175 stray dogs at the local municipality shelter to be infected by D. immitis [57]. At the end of the 1990s, contact between a mosquito infected by D. immitis and a host was estimated to occur every four nights for dogs and within two weeks for humans [7]. In subsequent years, after the advent of efficient preventative measures, the prevalence of heartworm infection dramatically decreased, especially in urban areas (unpublished data). However, in rural areas, both D. immitis and D. repens are still circulating, as demonstrated by the positivity of the FRDs taking part in this study and the presence of infected mosquitoes. The screening in 2010 of over 10,000 mosquitoes captured in the same area as this study revealed the presence of D. immitis, alone or in combination with D. repens, in 13 and two of the 20 monitored sites, respectively [17]. Despite the considerable rate of exposure to VBPs, none of the study dogs presented evident clinical signs and/or circulating pathogens at the time of sampling. This is not surprising, since the detection of pathogens in the bloodstream can be difficult even in clinical cases [1, 2, 41, 59–61]. A study performed on 650 sick dogs, yielded positive PCR results for Rickettsia spp. in 0.4, 1.4 and 3.3 % of dogs from northern, central and southern Italy, respectively [2]. Another study was unable to find A. phagocytophilum and Rickettsia spp. in 135 sick Italian dogs and found a low prevalence of E. canis (1.8 %) in 54 dogs in the north [58]. Conversely, in dogs showing clinical signs consistent with babesiosis, the pathogen is often detected both by blood smear examination and PCR [60, 61]. In north Italy, Babesia canis was found by PCR in 30/103 sick dogs (29 %) and B. vogeli in 1/103 (0.9 %) [61]. However, 55 % of the dogs infected by B. canis had travelled in eastern Europe, where babesiosis and the tick vector Dermacentor reticulatus are endemic [62], and were therefore likely to be imported cases. The comparable rate of exposure to pathogens transmitted by ticks and sandflies in CBDs and FRDs was unexpected considering that CBD owners are very careful about their dogs’ health, including the control of ectoparasites and prevention of dirofilariosis. Conversely, less or no care was expected to be taken of FRDs. This assumption is strengthened by the fact that positivity for filariae was found exclusively in FRDs, while the owners of CBDs proved to correctly use prophylactic measures against dirofilariosis. The similar seroprevalence for VBPs in the two groups may be explained by limited or incorrect use of compounds with repellent activity against arthropod vectors, as demonstrated by the results of a questionnaire administered to dog and cat owners in Portugal [63]. Repellents have in fact been proven to prevent vector bites and consequently the transmission of pathogens, even in highly endemic areas of south Italy [47, 64–66]. Our results confirm that serological positivity against tick-borne pathogens, even with very high titres, has to be carefully considered. Clinical observations, sensitive PCRs and repeated serological tests must be applied to confirm acute or chronic infections caused by rickettsial agents [41]. In addition, more specific, commercially available serological rickettsial assays, coupled with deeper knowledge of the pathogenic potential of the different species, are greatly required. Although exposure to VBPs is frequent for dogs living in northeast Italy, our results suggest that the risk of transmission by blood transfusion is low, if donors are carefully selected. Specifically, in areas endemic for Ixodes spp., it may be difficult to identify donors that are seronegative for Anaplasma spp. and Rickettsia spp. It might, therefore, be acceptable to use seropositive but PCR negative dogs as donors in such situations [67]. Conversely, serological screening for E. canis and L. infantum remains mandatory, since the antibody titres are predictive of infection. Finally, the diffusion and prevalence of other pathogens, such as Bartonella and haemoplasmas, should be investigated, as recommended by the updated Consensus Statements of the American College of Veterinary Internal Medicine (ACVIM) [67].

Conclusions

This study has improved our knowledge on the circulation of important VBPs in northeast Italy and has demonstrated a considerable rate of exposure to VBPs among dog populations. Although owners of CBDs reported regularly using compounds against fleas and ticks, their dogs had similar exposure to vector-borne pathogens as free-roaming dogs. This prompts the need to improve owner education on the use of repellent compounds in order to prevent arthropod bites and, consequently, the transmission of VBPs. The seroreactivity of CBDs to all the screened VBPs reinforces the need to continue applying this panel of PCRs at each blood donation. The test panel should also be continually revised according to additional information gathered on the introduction of pathogens and/or vectors from endemic areas.

Abbreviations

VBP, vector-borne pathogen; CBD, candidate blood donors; FRD, free-roaming dogs; ACVIM, American College of Veterinary Internal Medicine; PCR, polymerase chain reaction; EDTA, Ethylene Diamine Tetraacetic Acid; DNA, Deoxyribonucleic acid; rRNA, ribosomal ribonucleic acid; IFA, Immunofluorescence Assay.
  63 in total

1.  A molecular and serological study of exposure to tick-borne pathogens in sick dogs from Italy.

Authors:  M Trotta; A Fogliazza; T Furlanello; L Solano-Gallego
Journal:  Clin Microbiol Infect       Date:  2009-05-18       Impact factor: 8.067

2.  A duplex real-time polymerase chain reaction assay for the detection of and differentiation between Dirofilaria immitis and Dirofilaria repens in dogs and mosquitoes.

Authors:  Maria Stefania Latrofa; Filipe Dantas-Torres; Giada Annoscia; Marco Genchi; Donato Traversa; Domenico Otranto
Journal:  Vet Parasitol       Date:  2011-11-07       Impact factor: 2.738

3.  Saturation deficit and deer density affect questing activity and local abundance of Ixodes ricinus (Acari, Ixodidae) in Italy.

Authors:  V Tagliapietra; R Rosà; D Arnoldi; F Cagnacci; G Capelli; F Montarsi; H C Hauffe; A Rizzoli
Journal:  Vet Parasitol       Date:  2011-07-20       Impact factor: 2.738

4.  Risk assessment for canine leishmaniasis spreading in the north of Italy.

Authors:  Giulia Morosetti; Gioia Bongiorno; Bernadett Beran; Aldo Scalone; Judith Moser; Marina Gramiccia; Luigi Gradoni; Michele Maroli
Journal:  Geospat Health       Date:  2009-11       Impact factor: 1.212

5.  First finding of Dirofilaria repens in a natural population of Aedes albopictus.

Authors:  G Cancrini; R Romi; S Gabrielli; L Toma; M DI Paolo; P Scaramozzino
Journal:  Med Vet Entomol       Date:  2003-12       Impact factor: 2.739

6.  Babesia canis canis and Babesia canis vogeli clinicopathological findings and DNA detection by means of PCR-RFLP in blood from Italian dogs suspected of tick-borne disease.

Authors:  L Solano-Gallego; M Trotta; E Carli; B Carcy; M Caldin; T Furlanello
Journal:  Vet Parasitol       Date:  2008-07-26       Impact factor: 2.738

7.  Molecular xenomonitoring of Dirofilaria immitis and Dirofilaria repens in mosquitoes from north-eastern Italy by real-time PCR coupled with melting curve analysis.

Authors:  Maria Stefania Latrofa; Fabrizio Montarsi; Silvia Ciocchetta; Giada Annoscia; Filipe Dantas-Torres; Silvia Ravagnan; Gioia Capelli; Domenico Otranto
Journal:  Parasit Vectors       Date:  2012-04-20       Impact factor: 3.876

Review 8.  Update on Canine and Feline Blood Donor Screening for Blood-Borne Pathogens.

Authors:  K J Wardrop; A Birkenheuer; M C Blais; M B Callan; B Kohn; M R Lappin; J Sykes
Journal:  J Vet Intern Med       Date:  2016 Jan-Feb       Impact factor: 3.333

9.  Risk of canine and human exposure to Dirofilaria immitis infected mosquitoes in endemic areas of Italy.

Authors:  Gioia Capelli; Antonio Frangipane di Regalbono; Giulia Simonato; Rudi Cassini; Stefania Cazzin; Gabriella Cancrini; Domenico Otranto; Mario Pietrobelli
Journal:  Parasit Vectors       Date:  2013-03-07       Impact factor: 3.876

10.  First assessment of potential distribution and dispersal capacity of the emerging invasive mosquito Aedes koreicus in Northeast Italy.

Authors:  Matteo Marcantonio; Markus Metz; Frédéric Baldacchino; Daniele Arnoldi; Fabrizio Montarsi; Gioia Capelli; Sara Carlin; Markus Neteler; Annapaola Rizzoli
Journal:  Parasit Vectors       Date:  2016-02-03       Impact factor: 3.876

View more
  14 in total

1.  Improved molecular detection of Babesia infections in animals using a novel quantitative real-time PCR diagnostic assay targeting mitochondrial DNA.

Authors:  Barbara A Qurollo; Nikole R Archer; Megan E Schreeg; Henry S Marr; Adam J Birkenheuer; Kaitlin N Haney; Brittany S Thomas; Edward B Breitschwerdt
Journal:  Parasit Vectors       Date:  2017-03-07       Impact factor: 3.876

2.  Comparison of conventional polymerase chain reaction and routine blood smear for the detection of Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram Province, Thailand.

Authors:  Rucksak Rucksaken; Cherdsak Maneeruttanarungroj; Thanaporn Maswanna; Metita Sussadee; Pithai Kanbutra
Journal:  Vet World       Date:  2019-05-24

3.  Endoparasites and vector-borne pathogens in dogs from Greek islands: Pathogen distribution and zoonotic implications.

Authors:  Anastasia Diakou; Angela Di Cesare; Simone Morelli; Mariasole Colombo; Lenaig Halos; Giulia Simonato; Androniki Tamvakis; Frederic Beugnet; Barbara Paoletti; Donato Traversa
Journal:  PLoS Negl Trop Dis       Date:  2019-05-08

4.  Serological Evidence of Anaplasma phagocytophilum and Spotted Fever Group Rickettsia spp. Exposure in Horses from Central Italy.

Authors:  Valentina Virginia Ebani
Journal:  Pathogens       Date:  2019-06-26

5.  Survival of Rickettsia conorii in artificially contaminated whole and leukoreduced canine blood units during the storage period.

Authors:  Laura Lucchese; Silvia Ravagnan; Graziana Da Rold; Federica Toniolo; Wendy Wurzburger; Monica Mion; Antonio Carminato; Pierre-Edouard Fournier; Gioia Capelli; Alda Natale; Marta Vascellari
Journal:  Parasit Vectors       Date:  2020-04-21       Impact factor: 3.876

6.  Tick-borne pathogens in Ixodidae ticks collected from privately-owned dogs in Italy: a country-wide molecular survey.

Authors:  Stefania Zanet; Elena Battisti; Paola Pepe; Lavinia Ciuca; Liliana Colombo; Anna Trisciuoglio; Ezio Ferroglio; Giuseppe Cringoli; Laura Rinaldi; Maria Paola Maurelli
Journal:  BMC Vet Res       Date:  2020-02-07       Impact factor: 2.741

7.  A Cross Sectional Study on Serological Prevalence of Ehrlichia canis and Rickettsia conorii in Different Canine Population of Sicily (South-Italy) during 2017-2019.

Authors:  Sergio Migliore; Valeria Gargano; Claudia De Maria; Delia Gambino; Antonino Gentile; Valeria Vitale Badaco; Giorgia Schirò; Francesco Mira; Paola Galluzzo; Domenico Vicari; Santina Di Bella
Journal:  Animals (Basel)       Date:  2020-12-20       Impact factor: 2.752

Review 8.  Epidemiological and Clinicopathological Features of Anaplasma phagocytophilum Infection in Dogs: A Systematic Review.

Authors:  Sarah El Hamiani Khatat; Sylvie Daminet; Luc Duchateau; Latifa Elhachimi; Malika Kachani; Hamid Sahibi
Journal:  Front Vet Sci       Date:  2021-06-23

9.  Infection by Mycoplasma spp., feline immunodeficiency virus and feline leukemia virus in cats from an area endemic for visceral leishmaniasis.

Authors:  Mary Marcondes; Karina Y Hirata; Juliana P Vides; Ludmila S V Sobrinho; Jaqueline S Azevedo; Thállitha S W J Vieira; Rafael F C Vieira
Journal:  Parasit Vectors       Date:  2018-03-20       Impact factor: 3.876

10.  Seropositivity to canine tick-borne pathogens in a population of sick dogs in Italy.

Authors:  Jairo Alfonso Mendoza-Roldan; Giovanni Benelli; Marcos Antonio Bezerra-Santos; Viet-Linh Nguyen; Giuseppe Conte; Roberta Iatta; Tommaso Furlanello; Domenico Otranto
Journal:  Parasit Vectors       Date:  2021-06-02       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.