Literature DB >> 27232626

A Single Transcriptome of a Green Toad (Bufo viridis) Yields Candidate Genes for Sex Determination and -Differentiation and Non-Anonymous Population Genetic Markers.

Jörn F Gerchen1, Samuel J Reichert1, Johannes T Röhr2,3, Christoph Dieterich4, Werner Kloas1, Matthias Stöck1.   

Abstract

Large genome size, including immense repetitive and non-coding fractions, still present challenges for capacity, bioinformatics and thus affordability of whole genome sequencing in most amphibians. Here, we test the performance of a single transcriptome to understand whether it can provide a cost-efficient resource for species with large unknown genomes. Using RNA from six different tissues from a single Palearctic green toad (Bufo viridis) specimen and Hiseq2000, we obtained 22,5 Mio reads and publish >100,000 unigene sequences. To evaluate efficacy and quality, we first use this data to identify green toad specific candidate genes, known from other vertebrates for their role in sex determination and differentiation. Of a list of 37 genes, the transcriptome yielded 32 (87%), many of which providing the first such data for this non-model anuran species. However, for many of these genes, only fragments could be retrieved. In order to allow also applications to population genetics, we further used the transcriptome for the targeted development of 21 non-anonymous microsatellites and tested them in genetic families and backcrosses. Eleven markers were specifically developed to be located on the B. viridis sex chromosomes; for eight markers we can indeed demonstrate sex-specific transmission in genetic families. Depending on phylogenetic distance, several markers, which are sex-linked in green toads, show high cross-amplification success across the anuran phylogeny, involving nine systematic anuran families. Our data support the view that single transcriptome sequencing (based on multiple tissues) provides a reliable genomic resource and cost-efficient method for non-model amphibian species with large genome size and, despite limitations, should be considered as long as genome sequencing remains unaffordable for most species.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27232626      PMCID: PMC4883742          DOI: 10.1371/journal.pone.0156419

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Rare availability of amphibian genomes

The availability of whole genome sequencing has greatly facilitated evolutionary studies in non-model organisms [1]. Besides comparative research involving entire genomes (e.g. [2]), applications include candidate gene approaches and the development of specific marker sets for population genetics and speciation research. However, for some groups of non-model organisms, like most amphibians with very high DNA content [3], whole genome sequencing still is bioinformatically challenging and costly, and very few complete genomes are available. Due to their large proportion of repetitive sequences, assembly and proper annotation of such genomes remain difficult. Currently only two assembled and annotated amphibian genomes have become available: that of the model anuran, the tropical clawed frog, Xenopus tropicalis (Pipidae) [4], and recently that of the Tibetan frog, Nanorana parkeri (Dicroglossidae) [5].

Transcriptome sequencing as genomic resource for large-genome non-model species

Genetic and genomic applications often involve candidate gene approaches, in which the role of genes, known from related or model species, is examined in association studies for non-model species. In taxa with huge, unknown genomes, where whole genome sequencing still remains unaffordable, a useful resource may be transcriptomics (e.g. [6]). As transcriptomes only include exons and UTRs, sequencing efforts can be restricted to a small portion of the genome, and thus to the exclusion of hard-to-assemble non-coding intronic and intergenic repetitive regions. Amphibian transcriptomic information is expected to be well-annotatable. Given that many restrictions for whole genome approaches include most amphibians, in the present paper, we aimed at testing the usefulness of a single anuran transcriptome for obtaining a list of candidate genes on sexual development and sex determination. As another application, we aimed at the targeted development of non-anonymous transcriptomic microsatellites [7, 8], namely sex-specific and sex-linked markers. They appear less susceptible to phylogenetic noise than SNPs [9] and are applicable to population genetics and to study inheritance patterns [10, 11]. As our target species, we have chosen a diploid bufonid toad, the European green toad Bufo viridis. Importantly, no genome or transcriptome of the species or of related taxa from this systematic anuran family have so far been characterized. Palearctic green toads (B. viridis subgroup) form a complex of at least 12 mitochondrial lineages that inhabit large parts of Europe, North Africa and Asia with several diploid clades as well as tri- and tetraploid lineages [12]. Multiple natural hybrid zones of lineages with different divergence time can be found in this group [13, 14], making it a highly attractive amphibian radiation to study speciation and sex chromosome evolution under diploid [15] and polyploid hybridization [16]. In this paper, we present 11 markers located on the sex chromosome (with sex-linkage proven for 8 markers) and 10 autosomal markers for the B. viridis subgroup, most of which are transcriptome based and polymorphic.

Material and Methods

Animal sampling / ethics statement

Our study was approved by the relevant Institutional Animal Care and Use Committee (IACUC), namely the Service de la Consommation et des Affaires Vétérinaires du Canton de Vaud (Epalinges, Switzerland); toads and/or clutches were sampled according to permit 115790/229 in accordance with the Swiss import permit of the Bundesamt für Veterinärwesen, BVET Nr. 812/11, Bern, Switzerland, and authorization No. 1798, Service de la consommation et des affaires vétérinaires, Canton de Vaud, Epalinges, Switzerland.

Sequencing of a single transcriptome

RNA was extracted from six different tissues (liver, eye, brain, testes, heart, muscle) of a single male Bufo viridis, caught south of Astros, Greece (37.38299 N, 22.7455 E) in March 2011. RNA was pooled and adjusted to equal concentrations. Complementary DNA (cDNA) was synthesized and sequenced by BGI (BGI-Hongkong Co., Ltd.), using the Hiseq2000 sequencing system (Illumina, San Diego, USA). Reads were assembled using SOAPdenovo [17]: contigs (longest assembled sequences without Ns) were linked into scaffolds by mapping reads back to contigs and combining paired-end information. Scaffold length was estimated according to the average segment length of each pair of reads, and unknown bases were filled with Ns. Gaps in scaffolds were filled using paired-end reads, resulting in so-called unigenes. Raw reads were transmitted to the NCBI Sequence Read Archive (SRA, http://www.ncbi.nlm.nih.gov/Traces/sra/) under the accession Number SRS1034407, assembled sequences were transmitted to NCBI Transcriptome Shotgun Assembly Sequence Database (TSA, http://www.ncbi.nlm.nih.gov/genbank/tsa), BioSample accession for the project is SAMN03993917.

Functional annotation and classification

To predict protein functional information from the annotation of blast hits, unigene sequences were searched against four protein databases (Nr, Swissprot, KEGG, COG) using Blastx [18] with an E-value threshold of E-05. Blast2GO [19] as applied for GO annotation on the basis of the results of the Nr annotation. GO functional classification of all unigenes was performed using WEGO [20].

Genes involved in sex determination or sex differentiation

To evaluate the usefulness of a single, though multiple tissue-based, amphibian transcriptome for candidate gene approaches, we aimed at retrieving genes involved in male or female sex determination and sexual differentiation (list from M. Schartl, pers. comm., modified for anurans). Template sequences from the anuran model species Xenopus tropicalis or X. laevis were retrieved from Xenbase [21]. Sequences were blasted against a local database of all B. viridis unigenes using tblastn [18]. Using NCBI blastn, homology of unigenes from the resulting blast hits was confirmed. Only best blast hits with an E-value lower than E-05 were considered homologous. Blast hits were not considered homologous when there were other blast hits for different genes with E-values less then 10000 times larger.

Development of transcriptome-based microsatellite markers

Despite 150 million years (My) of divergence between bufonid, hylid and ranid anurans, chromosome number and interphase banding patterns suggest a high degree of structural conservation of their genomes [22]. Even after 200 My of separation, homology between large parts of X. tropicalis chromosome 1 (in which it is not the sex chromosome) and the sex chromosome of all examined diploid species of the B. viridis subgroup has been shown [15, 23]. Lacking more closely related relatives, the genome of X. tropicalis (and X. laevis) served as reference for B. viridis. Transcriptome data were first searched for microsatellite-like repetitive sequences (SSRs) using Misa (MIcroSAtellite identification tool, URL: http://pgrc.ipk-gatersleben.de/misa/). Repeats were filtered to exclude short repeats and duplicate entries. Sequences of repeat-containing unigenes were searched against the transcriptome of X. tropicalis [4] using the local alignment software Blast+ 2.2.25 [18] with the options "–evalue = 0.01 and –task = blastn" to identify homologous transcripts in X. tropicalis. The resulting best blast hits (gene name abbreviations) were searched against a mapping file (a list of gene names, synonyms and abbreviations, X. tropicalis start and end position and length in bp) available from Xenbase [21], which allowed assignment to a specific gene and its genomic location in the X. tropicalis-genome. Different markers were then selected over the whole length of X. tropicalis linkage group 1. For comparative studies of sex chromosomes and autosomes, additional markers on several autosomal linkage groups were developed. Because of the relatively low degree of polymorphisms in transcriptomic repeat sequences [7], different strategies were applied to increase the amount of polymorphic markers among candidates. Using Blast+ [18] with the megablast algorithm, candidate unigene sequences were searched against a database of the raw B. viridis Illumina reads. The sequences of the resulting Blast hits were mapped onto the unigene sequence using Geneious 7.06 (Biomatters). Ambiguities represented by a ratio of about 50%: 50% of raw Illumina reads in the resulting alignment were interpreted as heterozygous alleles in the individual diploid genome, from which the transcriptome was generated. It was expected, that markers, which were polymorphic within the single individual were likely to differ also between lineages. Furthermore, Serv [24] was applied, an algorithm, which uses a nonlinear model to calculate a numeric VARscore from intrinsic sequence properties. The VARscore predicts repeat variability and sequences, which were not already polymorphic within the single transcriptome, were selected for a high VARscore. Intron-exon boundaries of the repeat-containing unigenes were determined using the X. tropicalis genome [4] for these candidate genes using the Ensembl genome browser [25]. As amplification of genomic DNA markers fails if intron lengths and positions are not taken into account, X. tropicalis exons were aligned to the B. viridis unigene sequences using Geneious. PCR-primers for suitable marker candidates were then developed using Primer3 [26]. Primers were tested in 10 μl gradient PCR-reactions containing 1 μl B. viridis (or other green toads’) DNA (10 ng/μl), 1 μl 10x TopTaq-PCR-Buffer (with 15 mM MgCl2; Qiagen), 1 μl dNTP-Mix (2.5 mM of each dNTP), 0.5 μl forward primer (10 pmol/μl), 0.5 μl reverse primer (10 pmol/μl), 0.05 μl TopTaq polymerase (Qiagen) and 5.95 μl RNAse free water. The PCR protocol reads: initial denaturation at 95°C for 3 min, 35 cycles (including denaturation at 94°C for 30 s, annealing at 48–68°C for 60 s and elongation at 72°C for 40 s), and final elongation at 72°C for 10 min. PCR-products were screened for optimal annealing temperatures using agarose (2%) gel electrophoresis. Markers were tested for polymorphisms by direct sequencing of PCR-products and at least five individuals of four green toad species (B. viridis, B. balearicus, B. siculus and B. variabilis) were genotyped. For sequencing reactions, 25 μl PCR reactions were conducted, containing 2.5 μl DNA (10 ng/μl), 2.5 μl 10x TopTaq-PCR-Buffer (with 15 mM MgCl2; Qiagen), 2.5 μl dNTP-Mix (2.5 mM of each dNTP), 1.25 μl forward primer (10 pmol/μl), 1.25 μl reverse primer (10 pmol/μl), 0.125 μl TopTaq polymerase (Qiagen) and 14.875 μl RNAse free water. The PCR-protocol comprised initial denaturation at 95°C for 3 min, 35 cycles (including denaturation at 94°C for 30 s, annealing at optimal annealing temperature for 60 s and elongation at 72°C for 40 s), and a final elongation at 72°C for 10 min. PCR-products were purified and Sanger sequenced by Eurofins MWG (Ebersberg, Germany) using one or both of the original PCR primers for sequencing reactions. Sequences were aligned to the transcriptomic unigene sequences using Geneious and manually checked for indels, i.e. desired length polymorphisms.

Tests for sex linkage

To test whether markers located on X. tropicalis linkage group 1 are really located on the largely homologous B. viridis sex chromosome, sex-specific transmission was analyzed. In an XY-sex determination system, the father’s Y chromosome is always transmitted to male, while the X chromosome is always transmitted to female offspring. This was tested by genotyping previously generated genetic families with parents and offspring of known phenotypic sex [27, 28, 13]. Genotyping of all PCR-products was performed on an ABI 3500xL capillary sequencer (Applied Biosystems) with 0.5 μl diluted PCR-products in 9.25 μl Hi-Di formamide (Applied Biosystems) and 0.25 μl GeneScan 500 ROX size standard (Life Technologies). Genotypes were scored using Genemapper 4.1 (Applied Biosystems). Forward Primers of genotyping reactions were fluorescently labeled. For markers BvCamk4 (ATTO-550 labeled), BvHNRNPD (FAM), BvCherp (ATTO-550), BvDMRT1 (HEX), BvVLDLR (HEX) and BvIno80b (HEX) genotypes of parents and offspring (28 females, 21 males) of B. balearicus x B. siculus-F1 Cr13 (father) and B. balearicus Si337 (mother) were genotyped. For markers BvEll2 (FAM) and BvGar1 (HEX) B. balearicus Si336 (father) and B. siculus Si335 (mother; [13]) and resulting offspring (n = 30) were genotyped. Because the phenotypic sex of this offspring was unknown, it was also genotyped with the classical microsatellite markers C223, known to be sex-linked in B. siculus and B. balearicus [28]. C223 was amplified using 4 μl RNAse free water, 3 μl Multiplex PCR kit master mix (Qiagen), 0.5 μl C223 forward primer (10 pmol/μl, FAM-labeled), 0,5 μl C223 reverse primer (10 pmol/μl) and 2 μl DNA (10 ng/μl). The PCR-protocol comprised: Initial denaturation at 95°C for 15 min, 35 cycles (denaturation at 94°C for 30 s, annealing at 55°C for 90 s and elongation at 72°C for 60 s), and final elongation was at 60°C for 30 min. 0.5 μl of the C223 PCR-products were diluted in 22 μl RNAse free water and genotyped. Marker BvChd1 is nested in the same intron for, which sex linkage has been shown [23].

Cross amplification

Cross-amplification was tested for 11 markers located on X. tropicalis linkage group 1 (S3 Table). PCRs were performed with single high-molecular DNA samples of verified quality and quantity from nine systematic anuran families, namely Allobates femoralis (Arombatidae), Bombina orientalis (Bombinatoridae), Bufo bufo, Rhinella marina (Bufonidae), Hyla arborea (Hylidae), Hyloxalus azureiventris (Dendrobatidae), Pelophylax esculentus, Rana temporaria (Ranidae), Pelobates fuscus (Pelobatidae) and Xenopus tropicalis (Pipidae). Gradient-PCRs ranging in annealing temperatures from 47.8°C to 68°C were performed to determine the optimum. In case of uncertainties about quality, quantity or specificity of products, PCRs were repeated using a narrower gradient around the assumed optimal target temperature. Cross-amplification was tested in 10 μl gradient PCR-reactions containing 2 μl DNA (10 ng/μl), 1 μl 10x TopTaq-PCR-Buffer (with 15 mM MgCl2, Qiagen), 1 μl dNTP-Mix (2.5 mM of each dNTP), 1 μl of 10x CoralLoad Concentrate (Qiagen), 1 μl of 5x Q-Solution (Qiagen), 0.4 μl of MgCl2 (25mM, Qiagen), 0.5 μl of each primer (10 pmol/μl), and 0.05 μl TopTaq polymerase (Qiagen) and 2.55 μl RNAse free water. We considered markers to be specific when gel electrophoresis showed a clear band in proximity to the fragment size of B. viridis used as positive control on the same gel with 1 kb DNA HyperLadder (Bioline). Double or multiple bands and much larger or smaller bands suggested unspecific amplification. If a band in the right size could be determined among multiple bands the marker was declared as inoperable. To determine exact marker sequences in B. bufo, we used the conditions described above for green toad sequences. Sequences of the markers which could be successfully cross-amplified in B. bufo were aligned to the B. viridis unigene using sequences homologous to X. tropicalis-LG1-genes. Mapping of the sequences was done in Geneious 7.0.6.

Amplification success versus divergence time

To test inverse correlation of amplification success and evolutionary divergence, we took the divergence times of systematic anuran families from www.timetree.org. Amplification success is measured by the proportion of markers that amplified in each species to the total number of tested markers (S3 Table) developed for B. viridis. Maximum amplification success would be 10 out of 10 markers. Because of the proportional nature of the data, we calculated a generalized linear model (GLM) with binomial errors and a logit link (ANOVA, χ2). Statistical analysis was carried out in R version 3.1.0 [29].

Results

Transcriptome

The complete transcriptome data comprise 22,421,688 reads with a total length of 2,242,168,800 bp. The GC-content of the reads was 46.83%, 92.33% of all bases had a quality score of at least Q20. Assembly and scaffolding resulted in 110264 unigenes with a total length of 45,245,144 bp. Unigenes had an average length of 411 bp and a N50 of 504 bp. A total of 86707 unigenes ranged in length from 150 to 7508 bp (S1 Fig)

Sequence Annotation

Sequence annotation revealed significant similarities to a large number of proteins from four protein databases (Table 1). Based on blast hits of the Nr database, 10541 unigenes (9.56%) were assigned to gene ontology terms.
Table 1

Unigenes with significant similarities to proteins from four different protein databases.

DatabaseUnigenes with significant similarity to ProteinsBlast hits with E-values lower than 1E-50
Swissprot35692 (32.57%)13130 (11.9%)
Nr40193 (36.45%)15220 (13.8%)
COG9654 (8.75%)1143 (1.03%)
Kegg34322 (31.13%)8418 (7.63%)
Regarding the molecular function ontology, the most common classifications were cellular processes (8156), metabolic processes (6713) and biological regulation. The most common categories for the cellular component ontology were cellular (10437), cell compartments (9976) and organelles (6529). In terms of the molecular function, most common categories involved binding (7609), catalytic activity (4663) and molecular transducer activity (897) (S2 Fig). Of a list 37 genes, ca. 87% (32) had significant blast hits in the B. viridis transcriptome, many of which providing the first sequence data for these genes in this non-model anuran species. Compared to the length of Xenopus mRNAs used as BLAST templates, the majority of the B. viridis unigenes is shorter (between 10 and 92%) and likely represents fragments. In contrast, several unigenes are also longer, which may be indicative of insertions, for example by the extension of repetitive regions (Table 2).
Table 2

Male and female sex-determining and sex differentiation gene inventory and homologous B. viridis transcripts.

Xenopus protein sequenceB. viridis transcriptRelative length of B. viridis unigenes compared to Xenopus mRNA
GeneOrganismAccessionLength of Protein (aa)Length of mRNA (nt)B. viridis unigeneE-ValueLength (nt)
AMHX. tropicalisXP_0049114806092567991591.97E-1145820.50
102116.06E-026690
AMHR2X. tropicalisXP_0128133075271793348206.63E-0277590.75
991631.05E-11582
ARX. tropicalisXP_0029418887883497919586.62E-1455830.17
NR0B1X. tropicalisXP_0029336612781298----
DHHX. tropicalisNP_0010906383994372770162.11E-73030.07
DMRT1X. tropicalisXP_012808036337244410627909760.39
DMRT3X. tropicalisAEM447794491416554601.35E-482270.16
DMRT6 /DMRTB1X. tropicalisXP_00293147324918491062754.58E-319750.53
FGF9X. tropicalisXP_002938621208928898817.09E-1194080.44
FGF16X. tropicalisXP_012823079202609347805.11E-511850.30
FGF20X. tropicalisACK586802081490236512.17E-111600.11
GATA-4X. tropicalisNP_00101694939415998207035172.20
PDGFaX. tropicalisNP_0011639682191574814891.5E-753300.34
450594.3E-57204
PDGFbX. tropicalisAAI6057524021401023814.44E-237030.33
SF-1X. tropicalisNP_0011392134681407109004015372.70
1303102260
SOX8X. tropicalisXP_0029323154662389131579.79E-15111180.56
543443.67E-42225
SOX9X. tropicalisAAT720004822538109733019670.78
SOX10X. tropicalisNP_001093691436289561926.63E-1345270.26
561202.83E-56229
SRD5A1X. tropicalisNP_0010068412571537999851.85E-726070.64
486586.04E-28211
287982.24E-13172
SRD5A2X. tropicalisNP_0010171132391730582352.57E-262360.24
346456.43E-14185
SRD5A3X. tropicalisAAH4225531912421063181.8E-429811.17
101215.88E-17469
WT1X. topicalisNP_0011356254136193----
CYP26A1X. tropicalisAAI71087492145815401012520.86
CYP26B1X. tropicalisAAI35552511613713284023960.39
CYP26C1X.tropicalisXP_0029391375334692----
CTNNB1X. tropicalisNP_001016958781338210433608110.59
10761401171
ESR1AX. laevisNP_001083086585-----
FOXL2X. tropicalisXP_004917868326-----
RSPO-1X. tropicalisNP_0011215002571946821892.44E-2910300.53
WNT1X. tropicalisXP_00293515237243231036971.43E-1217700.25
769241.18E-65302
WNT4X. tropicalisNP_0012390153511962605815.21E-482420.12
ALDH1A2X. tropicalisAAI575142113696576857.47E-632340.06
ALDH1A3X. tropicalisXP_0029393105124056990806.97E-1335790.26
291681.44E-27173
772874.42E-34304
CXCR4BX. laevisNP_0010806813582115----
HHIPX. tropicalisNP_001007191649271714309010010.65
981235.23E-176552
525561.96E-29220
LRPPRCX. tropicalisNP_00103920313914347156363.82E-8224720.92
1089981.25E-1701533
PTCH2X. tropicalisXP_00293712914236786859246.32E-813660.18
538922.53E-54223
384782.21E-42193
927632.69E-41447

Non-anonymous microsatellite markers and sex linkage

For comparative studies of sex chromosomes and autosomes, markers on several autosomal linkage groups, with emphasis on linkage group 2, were developed. In total, twenty-one microsatellite markers were generated from sequences with repetitive patterns found in the transcriptomic dataset (Fig 1, Table 3). Additionally, marker BvIno80b was generated to amplify an indel present in the transcriptome data. All of these microsatellites were polymorphic among B. viridis, B. balearicus, B. siculus and B. variabilis. Markers BvDMRT1, BvVLDLR and BvCHD1 were intron based indel-targeting markers, equally developed from transcriptome data by sequencing introns with primers matching flanking exons.
Fig 1

Genomic location of the newly developed transcriptome-based markers for Palearctic green toads (B. viridis subgroup) on X. tropicalis linkage groups.

For markers written in bold, sex linkage was confirmed in green toads (main text for details). Marker names include the gene name abbreviation according to Xenbase. Linkage group size is relative to the proportion of the respective scaffold represented in the X. tropicalis genome v. 7.1 [4]. In green toads, “(Ino80b)” was found to be unlinked to other scaffold 1-homologous markers.

Table 3

Non-Anonymous microsatellite markers.

NameGeneXenopus-LGPosition on Xenopus-LGFwd.-Sequence (5'-3')Rev.-Sequence (5'-3')Marker TypeTA (°C)
BvCwc27Cwc27113842820–13932924AAGTGATGACTTACGTAAAGAAGTACGTCCTTTGCTTTTTCAATTTCTTTTexonic-(TTCCTT)n-repeat56
BvChd1Chd1130554621–30590231TCCCTGCATTCTGTCAAGAACTGGACGGTATGAGGAACCATintronic-INDEL-targeting66.1
BvCamk4Camk4133230874–33269817CTCCTCTACCTCCCCGAGATCGGACTCCAGCTCGTAGTAAexonic-(CTC)n-repeat53.7
BvEll2Ell2136036707–36072713GACTGAAACTGTCCATGGGCTCTCATCTTACAAACAGGGTGCexonic-INDEL-targeting56.4
BvMed15Med15155139383–55188383CAGCAAATGTCTCAACAAATGGAGCAACTGCTGCTGACTCTGexonic-(CAACAG)n-repeat65
BvMed15_2Med15155139383–55188383TTTCAGCAGCAGCAAGTAGCGTTGCGGTTGCATCACATTexonic-(CAG)n-repeat65
BvPes1Pes1163613726–63635318AGGAAGAAGACGAGGAGGATGGCTCAGCAACTTGTGCTTTGexonic-(GAG)n-repeat68
BvMapkapk2Mapkapk2167440948–67481648GTTCCAGTGAGCGGTGACTCCAGGACTTTGCCGTTGATGexonic-(CAG)n-repeat56.4
BvDMRT1DMRT1196303907–96361376AACTTCCCTGCAGACCTCCTTGACTACTGGCAATTCATTCATintronic-INDEL-targeting66.1
BvVLDLRVLDLR196940006–96981704CCCTGTTAAGCATCAATTTGCCTTGCAGTTCCTGCCAAGATintronic-INDEL-targeting61
BvCherpCherp1129080135–129097850GCCAATCCTTATGGCGTTCCGCTGGTGGTTCGGGAATTGExonic-(AGCAACAGC)n-repeat56.4
BvHNRNPDHNRNPD1144610918–144625368AGCGTGATGGAGGCGGCCGCCAGCGCTTGCTGGCGTTGATCTTCExonic-(GCTTCT)n-repeat59
BvGar1Gar11152691377–152698987CTGGTGGTCCCTGGTCATAGTTTAATCGGGGAGGAGGTGGexonic-(TCC)n-Repeat64.1
BvIno80bIno80b1215879679–215880220ACTCCTGTGCTAAGACTCGCGGATTGTGTAGGACGCCCCINDEL-targeting in 3'-UTR66.1
BvKrt5.6Krt5.6292165215–92171759CAACACTGTATCCGCCTCCTTGTCTGGAGAGATCACAAATCCAexonic-(TCC)n repeat62.3
BvPvrl2Pvrl22100612435–100634031ATAGCAGTCCCAGCAGAAGGCTCATCCAAGGGCCAGAGA(CT)n-repeat in 3'-UTR66.2
BvDyrk1aDyrk1a2125823355–125869490TGGGTTGGACTGTCACTGAAGAATCTTGGGTGGAGGAGCTexonic-(CAC)n-repeat62.3
BvZnf295Znf2952139330501–139336431TGGAGTCACTTTCAGTCGCACTGGAACTGCTTTGCGTCTTexonic-(CCA)n-repeat64.5
BvKctd15Kctd15438249026–38281807GGGCTTGTGAAACCAGAGGATCCCGGCCAGATCGTTTexonic-(GAA)n-repeat64.5
BvSox2Sox2512355967–12358300TACATTCACGCAGCTTGGTGGTCAAAGGCGCAGGATGAAA(CT)n-repeat in 3'-UTR66.2
BvAnkrd12Ankrd12645482374–45522238AGAGCCACACTTCACCAACTTGACCATATGCTTGTCTTCCAexonic-(GAT)n-repeat62.3
BvAp2a1Ap2a17114600274–114627891GCAAACACTACAAGGAGGGTTTTCTCTTGGACTTTACTGGACGT(TG)n-repeat in 3'-UTR57.5
BvFam117bFam117b929130912–29142987CAATTCACCCCGCAGCAGCGGAGAGGTTGAGGTGGGexonic-(CAC)n-repeat63

Genes, their positions on X. tropicalis linkage groups, sequence of forward and reverse primers, marker type and optimal annealing temperature of the markers presented in this study.

Genes, their positions on X. tropicalis linkage groups, sequence of forward and reverse primers, marker type and optimal annealing temperature of the markers presented in this study.

Genomic location of the newly developed transcriptome-based markers for Palearctic green toads (B. viridis subgroup) on X. tropicalis linkage groups.

For markers written in bold, sex linkage was confirmed in green toads (main text for details). Marker names include the gene name abbreviation according to Xenbase. Linkage group size is relative to the proportion of the respective scaffold represented in the X. tropicalis genome v. 7.1 [4]. In green toads, “(Ino80b)” was found to be unlinked to other scaffold 1-homologous markers. Markers BvCamk4, BvDMRT1, BvCherp, BvHNRNPD and BvVLDLR show a signature of sex-specific transmission of alleles in the offspring of Si337 (mother, B. siculus) and Cr13 (father, B. siculus x B. balearicus). Sex-specific transmission is not perfect since single male specific alleles can be found in females and also single males without specific alleles are present. The marker BvIno80b showed no sex linkage in B. viridis and was therefore considered to be autosomal (S1 Table). For the sex-linked marker C223, allele 163 was perfectly linked to allele 225 of marker BvEll2, and allele 171 linked to allele 162 of the marker BvGar1 (S2 Table).

Cross-amplification

Cross-amplification trials in representatives from nine systematic anuran families showed variable success for different markers. The number of amplifying markers decreases with increasing evolutionary distance (Fig 2). In B. bufo (23.3 My divergence time to B. viridis) 9/11 markers amplified. In the second bufonid, Rhinella marina (37.3 My), 8/11 markers amplified. The amplification proportion for Dendrobatidae (58.6 My) was at a mean of 4.5/11 markers. For Hylidae and Ranidae (77.9 My) mean amplification success was 5.3/11 markers. In the most distant group consisting of Bombinatoridae and Pipidae (223.2 My) the mean amplification proportion was 3.5/11 and in Pelobates fuscus (Pelobatidae, 196.1 My) 2/11 markers amplified successfully.
Fig 2

Amplification success plotted against divergence time in million years (My).

The overall amplification success decreases with increasing evolutionary distance. Divergence time has a significantly negative effect on the cross-amplification success (df = 1, 9; deviance = 17.214, p < 0.001).

Amplification success plotted against divergence time in million years (My).

The overall amplification success decreases with increasing evolutionary distance. Divergence time has a significantly negative effect on the cross-amplification success (df = 1, 9; deviance = 17.214, p < 0.001).

Discussion

The present study aimed at testing whether a single transcriptome of a non-model anuran species may present a reasonable resource for amphibians, where whole genome sequencing remains unaffordable due to large genome size. We have first tested this by retrieving a list of candidate genes, known for their role in sex determination and sex differentiation, and second by the targeted development of non-anonymous microsatellite markers. In terms of completeness, i.e. the presence of at least a fragment of a certain gene, our approach has provided reasonably sufficient data, as we could retrieve 87% of the desired genes. However, and somewhat expected, we face two problems regarding this list: i) deep divergences (ca. 200 My) to the model species may generally lower the blast hit success due to strong sequence divergence, ii) some expected sequences are either completely missing from the transcriptome or have become only available in small portions. For the development of non-anonymous microsatellite markers, the single transcriptome has been useful. Since these markers are exonic (or UTR-linked), their genomic position can be mapped to the few available and only remotely related reference genomes. In this way, even in non-model species, genomic positions can be inferred based on structural conservation (synteny). Classical short polymorphic tandem-repeated DNA sequences (microsatellites) stem mostly from the non-coding, i.e. >98% of vertebrate genomes [30]. While these multiallelic markers can be easily genotyped, their genomic location usually remains unknown (“anonymous”). Thus, cross-amplification and consequently applicability to diverged lineages and species are often limited. Since exonic regions show a larger degree of sequence conservation, transcriptome-based microsatellites can ensure cross-amplification better than classical non-coding markers [31, 8]. Targeted development of green toad markers homologs on X. tropicalis LG 1, largely homologous to the B. viridis sex chromosome, has been successfully accomplished [23, 15]. For a subset of these markers, sex linkage could be demonstrated in genetic families: 7 out of 8 markers show expected sex-specific transmission in B. viridis (S1 and S2 Tables). Sex-specific transmission is not perfect in the genetic family Si337xCr13 (S1 Table), likely due to meiotic recombination along the B. viridis sex chromosomes, which has been shown in previous studies [28, 23]. Sex linkage of the 7 B. viridis microsatellites corroborates evidence for conserved synteny across the anuran LG 1 for Palearctic green toads. Only marker BvIno80b, located at the distal tip of X. tropicalis LG1 (Fig 1), shows no sex linkage, presumably a result of genome rearrangements. The new transcriptome-based microsatellite markers also show a high cross-amplification success in several representatives across the anuran phylogeny. In other bufonids, Bufo bufo and R. marina, most markers could be successfully genotyped. Even in Xenopus tropicalis, a species with more than 200 My of divergence to B. viridis, three markers have still amplified successfully (S3 Table). Cross-amplification success inversely correlates with evolutionary distance [8]. Similar results have been shown for anonymous microsatellites in other vertebrate groups such as fish [32], crocodiles [33], birds [34, 35] as well as in other amphibians [36, 37]. Cross-amplification success among tree frogs declines by 50% after about 40 My [8]. The ‘half-life’ of our marker set tested for cross-amplification is about 120 My (predicted from regression). Despite the relatively small number of data points to test this relationship, our results suggest that cross amplification trials for transcriptome-based PCR products may be a convenient alternative for developing nuclear markers in anurans.

Conclusions

Our data support the view that single, namely multiple-tissue based transcriptome sequencing is a reliable genomic resource and cost-efficient method for non-model amphibian species with large genome size and despite limitations, should be considered as long as genome sequencing remains unaffordable for most species.

Frequency length distribution of unigenes in the B. viridis transcriptome.

(TIF) Click here for additional data file.

Functional GO annotations of B. viridis transcriptome unigenes.

(TIF) Click here for additional data file.

Sex linkage of markers BvCamk4, BvDMRT1, BvCherp, BvHNRNPD, BvIno80b and BvVLDLR.

Genotypes of B. balearicus female (Si337) and F1-male (B. balearicus x B. siculus; Cr13) and their offspring. Phenotypic females are red colored, phenotypic males and alleles, which are expected to show sex-specific transmission, are marked in blue color. (DOCX) Click here for additional data file.

Sex linkage of markers BvEll2 and BvGar1.

Genotypes of Si335 and Si336 and the resulting offspring. Alleles, which show sex-specific transmission, are colored green and orange. (DOCX) Click here for additional data file.

Markers developed for B. viridis that cross-amplified in the tested anuran species.

In all ten examined species at least some of the markers showed bands in the agarose gel. Gradient PCRs were done with all markers to determine the optimal annealing temperature (T) and the T range, in which amplification is possible. The approximate fragment length is estimated from the gel pictures. (DOCX) Click here for additional data file.
  32 in total

1.  Homologous sex chromosomes in three deeply divergent anuran species.

Authors:  Alan Brelsford; Matthias Stöck; Caroline Betto-Colliard; Sylvain Dubey; Christophe Dufresnes; Hélène Jourdan-Pineau; Nicolas Rodrigues; Romain Savary; Roberto Sermier; Nicolas Perrin
Journal:  Evolution       Date:  2013-05-30       Impact factor: 3.694

2.  Allelic diversity in alligator microsatellite loci is negatively correlated with GC content of flanking sequences and evolutionary conservation of PCR amplifiability.

Authors:  T C Glenn; W Stephan; H C Dessauer; M J Braun
Journal:  Mol Biol Evol       Date:  1996-10       Impact factor: 16.240

3.  Low rates of X-Y recombination, not turnovers, account for homomorphic sex chromosomes in several diploid species of Palearctic green toads (Bufo viridis subgroup).

Authors:  M Stöck; R Savary; C Betto-Colliard; S Biollay; H Jourdan-Pineau; N Perrin
Journal:  J Evol Biol       Date:  2013-01-14       Impact factor: 2.411

4.  Convergent evolution of the genomes of marine mammals.

Authors:  Andrew D Foote; Yue Liu; Gregg W C Thomas; Tomáš Vinař; Jessica Alföldi; Jixin Deng; Shannon Dugan; Cornelis E van Elk; Margaret E Hunter; Vandita Joshi; Ziad Khan; Christie Kovar; Sandra L Lee; Kerstin Lindblad-Toh; Annalaura Mancia; Rasmus Nielsen; Xiang Qin; Jiaxin Qu; Brian J Raney; Nagarjun Vijay; Jochen B W Wolf; Matthew W Hahn; Donna M Muzny; Kim C Worley; M Thomas P Gilbert; Richard A Gibbs
Journal:  Nat Genet       Date:  2015-01-26       Impact factor: 38.330

5.  Inferring the degree of incipient speciation in secondary contact zones of closely related lineages of Palearctic green toads (Bufo viridis subgroup).

Authors:  C Dufresnes; L Bonato; N Novarini; C Betto-Colliard; N Perrin; M Stöck
Journal:  Heredity (Edinb)       Date:  2014-04-09       Impact factor: 3.821

6.  Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes.

Authors:  Yan-Bo Sun; Zi-Jun Xiong; Xue-Yan Xiang; Shi-Ping Liu; Wei-Wei Zhou; Xiao-Long Tu; Li Zhong; Lu Wang; Dong-Dong Wu; Bao-Lin Zhang; Chun-Ling Zhu; Min-Min Yang; Hong-Man Chen; Fang Li; Long Zhou; Shao-Hong Feng; Chao Huang; Guo-Jie Zhang; David Irwin; David M Hillis; Robert W Murphy; Huan-Ming Yang; Jing Che; Jun Wang; Ya-Ping Zhang
Journal:  Proc Natl Acad Sci U S A       Date:  2015-03-02       Impact factor: 11.205

7.  A cryptic heterogametic transition revealed by sex-linked DNA markers in Palearctic green toads.

Authors:  M Stöck; D Croll; Z Dumas; S Biollay; J Wang; N Perrin
Journal:  J Evol Biol       Date:  2011-02-21       Impact factor: 2.411

8.  Microsatellite analyses across three diverse vertebrate transcriptomes (Acipenser fulvescens, Ambystoma tigrinum, and Dipodomys spectabilis).

Authors:  Jacqueline M Doyle; Gregor Siegmund; Joseph D Ruhl; Soo Hyung Eo; Matthew C Hale; Nicholas J Marra; Peter M Waser; J Andrew Dewoody
Journal:  Genome       Date:  2013-08-20       Impact factor: 2.166

9.  Stronger transferability but lower variability in transcriptomic- than in anonymous microsatellites: evidence from Hylid frogs.

Authors:  Christophe Dufresnes; Alan Brelsford; Paul Béziers; Nicolas Perrin
Journal:  Mol Ecol Resour       Date:  2014-01-10       Impact factor: 7.090

10.  WEGO: a web tool for plotting GO annotations.

Authors:  Jia Ye; Lin Fang; Hongkun Zheng; Yong Zhang; Jie Chen; Zengjin Zhang; Jing Wang; Shengting Li; Ruiqiang Li; Lars Bolund; Jun Wang
Journal:  Nucleic Acids Res       Date:  2006-07-01       Impact factor: 16.971

View more
  7 in total

1.  Improving amphibian genomic resources: a multitissue reference transcriptome of an iconic invader.

Authors:  Mark F Richardson; Fernando Sequeira; Daniel Selechnik; Miguel Carneiro; Marcelo Vallinoto; Jack G Reid; Andrea J West; Michael R Crossland; Richard Shine; Lee A Rollins
Journal:  Gigascience       Date:  2018-01-01       Impact factor: 6.524

2.  A practical guide to build de-novo assemblies for single tissues of non-model organisms: the example of a Neotropical frog.

Authors:  Santiago Montero-Mendieta; Manfred Grabherr; Henrik Lantz; Ignacio De la Riva; Jennifer A Leonard; Matthew T Webster; Carles Vilà
Journal:  PeerJ       Date:  2017-09-01       Impact factor: 2.984

3.  Profound genetic divergence and asymmetric parental genome contributions as hallmarks of hybrid speciation in polyploid toads.

Authors:  Caroline Betto-Colliard; Sylvia Hofmann; Roberto Sermier; Nicolas Perrin; Matthias Stöck
Journal:  Proc Biol Sci       Date:  2018-02-07       Impact factor: 5.349

4.  Multi-Tissue Transcriptomes Yield Information on High-Altitude Adaptation and Sex-Determination in Scutiger cf. sikimmensis.

Authors:  Sylvia Hofmann; Heiner Kuhl; Chitra Bahadur Baniya; Matthias Stöck
Journal:  Genes (Basel)       Date:  2019-10-31       Impact factor: 4.096

5.  Evolutionary analyses of visual opsin genes in frogs and toads: Diversity, duplication, and positive selection.

Authors:  Ryan K Schott; Leah Perez; Matthew A Kwiatkowski; Vance Imhoff; Jennifer M Gumm
Journal:  Ecol Evol       Date:  2022-02-07       Impact factor: 2.912

6.  Identification and characterization of a new family of long satellite DNA, specific of true toads (Anura, Amphibia, Bufonidae).

Authors:  Katerina Guzmán; Álvaro S Roco; Matthias Stöck; Adrián Ruiz-García; Enrique García-Muñoz; Mónica Bullejos
Journal:  Sci Rep       Date:  2022-08-17       Impact factor: 4.996

7.  The transcriptome of the newt Cynops orientalis provides new insights into evolution and function of sexual gene networks in sarcopterygians.

Authors:  Maria Assunta Biscotti; Federica Carducci; Manfred Schartl; Adriana Canapa; Mateus Contar Adolfi; Marco Barucca; Marco Gerdol; Alberto Pallavicini
Journal:  Sci Rep       Date:  2020-03-25       Impact factor: 4.379

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.