Genetic analysis reveals candidate species in the Scinax catharinae clade (Amphibia: Anura) from Central Brazil.

Scinax (Anura: Hylidae) is a species-rich genus of amphibians (113 spp.), divided into five species groups by morphological features. Cladistic analyses however revealed only two monophyletic clades in these groups: Scinax catharinae and Scinax ruber. Most species from the S. catharinae clade are found in Atlantic rainforest, except for Scinax canastrensis,S. centralis, S. luizotavioi, S. machadoi,S. pombali and S. skaios. In the present work, specimens of Scinax collected in Chapada dos Guimarães, central Brazil, were morphologically compatible with species from theS. catharinae group. On the other hand, genetic analysis based on mitochondrial (16S and 12S) and nuclear (rhodopsin) sequences revealed a nucleotide divergence of 6 to 20% between Scinax sp. and other congeners from the Brazilian savannah (Cerrado). Accordingly, Bayesian inference placed Scinax sp. in the S. catharinae clade with high support values. Hence, these findings strongly indicate the presence of a new species in the S. catharinae clade from the southwestern portion of the Brazilian savannah. To be properly validated as a novel species, detailed comparative morphological and bioacustic studies with other taxa from Brazil such asS. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios are required.

The genus Scinax encompasses 113 species with a widespread distribution from southern Mexico to Argentina, Uruguay, St. Lucia and Trinidad and Tobago islands (Frost, 2015). Duellman and Wiens (1992) recognized seven species groups in this genus by means of morphological analyses (S. catharinae, S. perpusillus, S. rizibilis, S. rostratus, S. ruber, S. staufferi and S. x-signatus). Later, the groups S. rizibilis and S. x-signatus were regarded as synonyms of S. catharinae and S. ruber, respectively (Pombal ). Cladistic inferences however recovered only two monophyletic clades: S. catharinae (including the groups S. catharinae, S. staufferi and S. perpusillus) and S. ruber (encompassing the groups S. rostratus, S. ruber and some species within S. staufferi) (Faivovich, 2002; Faivovich ).

The S. catharinae group (Frost, 2015) is characterized by the lack of an anterior process in the suprascapula, m. depressor mandibulae without an origin at the dorsal fascia of the m. dorsalis scapulae, distal division of the middle branch of the m. extensor digitorum comunis longus, and insertion of this muscle at the medial side on the tendon of the m. extensor brevis medius digiti IV (Faivovich, 2002). The vocalization of frogs from this group is usually composed of short notes and, sometimes, displays harmonic structure (Pombal , b).

Most species in this group are distributed throughout the Atlantic rainforest (Faivovich ). The only exceptions reported so far include S. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios, which were observed in gallery forests within the Brazilian savannah (Cerrado) and in central and southeastern Brazil (Pombal and Bastos, 1996;Pombal ; Lourenço ).

During inventories of herpetofauna carried out for the Management Plan of Chapada dos Guimarães National Park in the southwestern Cerrado, some samples ofScinax morphologically compatible with species of S. catharinae group were collected, but these specimens were differentiated from all other species described so far. Therefore, the goal of the present study was to perform a molecular analysis of these samples as an additional tool to their taxonomic identification, besides verifying the presence of a putative new representative in theS. catharinae clade in areas distant from their center of origin.

Eight individuals of Scinax sp. were collected on April 04, 2006 in deep gallery forests alongside headwaters of the Coxipó River, in Chapada dos Guimarães, state of Mato Grosso, Brazil (Figure 1, Table 1). The specimens were deposited in the Vertebrate Collection of the Universidade Federal de Mato Grosso (UFMT). Approximately 25 mg of muscle were removed from the inner thigh of each specimen and preserved in ethanol 95% at – 20 °C for molecular analyses.

Figure 1

Map of Brazil showing the collection sites of Scinax sp. in Chapada dos Guimarães, Mato Grosso, Brazil (red triangle).

Table 1

Description of anuran samples used in the present study.

Voucher	Species	Clade	Country/Locality/State	Coordinates	GenBank Accession Number
					16S	12S	Rhodopsin
MACN 36999	Hypsiboas faber		Argentina: San Vicente, Misiones	26°37'S54°08'W	AY549333	AY549333	AY844607
MZUESC9759	Scinax agilis	S. catharinae	Brazil: Conceição da Barra, Espirito Santo	18°25'S, 39°42'W	KT438894	KT438883	KT438902
–	Scinax berthae	S. catharinae	Argentina: Buenos Aires	34°36'S 58°22'W	AY843754	AY843754	AY844740
MCP3734	Scinax catharinae	S. catharinae	Brazil: São Francisco de Paula, Rio Grande Do Sul	29°26'S 50°35'W	AY843756	AY843756	AY844742
MVZFC 14457	Scinax elaeochroa	S. ruber	Costa Rica: Heredia	10°07'N83°33'W	AY843757	AY843757	AY844743
WED 54071	Scinax garbei	S. ruber	Ecuador: Riobamba, Chimborazo	01°40'S78°38'W	AY326033	AY326033	DQ283759
MACN 38650	Scinax nasicus	S. ruber	Argentina: Buenos Aires	34°36'S 58°22'W	AY843759	AY843759	AY844745
LH401	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438886	KT438875	KT43889
LH905	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438887	KT438876	KT438898
LH900	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438888	KT438877	KT438899
LH902	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438889	KT438878	KT438900
LH908	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438890	KT438879	KT438901
LH909	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438891	KT438880	–
LH904	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438892	KT438881	–
LH903	Scinax sp.	S. catharinae	Brazil Chapada dos Guimarães, Mato Grosso	15°28' S, 55°48'W	KT438893	KT438882	–
MZUESC11079	Scinax strigilatus	S. catharinae	Brazil Camacan, Bahia	15°24'S, 39°30'W	KT438895	KT438884	–
MZUESC11080	Scinax strigilatus	S. catharinae	Brazil Camacan, Bahia	15°24'S, 39°30'W	KT438896	KT438885	–
CFBH 5788	Scinax uruguayas	S. ruber	Brazil Cambará do Sul, Rio Grande do Sul	29°02'S, 50°08'W	AY843681	AY843681	AY844674

Total DNA was extracted by using the Wizard® Genomic Purification kit (Promega), following manufacturer's instructions. The primer pairs used to amplify 16S, 12S, and rhodopsin, respectively, were: L1- 5'GCCTCGC TTGTTTACCAAAAAC −3 (Palumbi, 1996) and H1 – 5'CCGGTCTGAACTCAGATCACGT 3' (Varela ); L1- 5'AAAAAGCTTCAAACTGGGATTAGAT ACCCCACTAT3' and H1- 5'TGACTGCAGAGGGTGA CGGGCGGTGTGT3' (Kocher ), and Rhod-L1 5'ACCATGAACGGAACAGAAGGYCC 3' and Rhod-H1 5'GTAGCGAAGAARCTTCAAMGTA 3' (Bossuyt and Milinkovitch, 2000).

The PCR conditions consisted of an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C (12S and 16S) or 49 °C (rhodopsin) for 40 s and extension at 72 °C for 30 s, plus a final extension step at 72 °C for 7 min. Subsequently, the reaction products were purified and sequenced in an ABI 3500XL Genetic Analyzer automatic sequencer (Applied Biosystems). Sequencing reactions were carried out by using terminal dideoxynucleotides (Sanger ). The sequences were then aligned with Clustal W available in the software BioEdit v. 5.09 (Hall, 1999). The software GBlocks 0.91 (Castresana, 2000) was used to eliminate poorly aligned positions and divergent region portions of 16S, according to the following parameters: minimum number of sequences for a flank position to 10, maximum number of contiguous nonconserved positions to 08, minimum length of a block to 2, and allowed gap positions to within half.

To estimate the divergence matrix and phylogeny we added sequences of seven other anuran species from GenBank to our data set: S. catharinae, Scinax berthae, Scinax uruguayus, Scinax garbei, Scinax elaechroa, Scinax nasicus andHypsiboas faber (outgroup). Two other species from the S. catharinae clade collected in Bahia, northeastern Brazil and Espirito Santo, southeastern Brazil, were also included in our analysis: Scinax strigilatus and Scinax agilis (Table 1).

Genetic divergence was estimated using the Kimura-2-parameter (K2P) substitution model (Kimura, 1980) in the software MEGA v. 5.0 (Tamura ). The 16S, 12S and rhodopsin sequences were concatenated in the software DnaSP, v. 4.0 (Librado and Rozas, 2009).

A Bayesian phylogeny was inferred using the software MrBayes 3.1 (Ronquist and Huelsenbeck, 2003). The best mutation model was estimated according to Akaike Information Criteria – AIC in the software jModel Test 0.1 (Posada, 2008). Two runs (four chains each) with 20 million generations were performed with trees being sampled at every 1000 generations. Adequate burn-in was determined by examining likelihood scores of the heated chains for convergence on stationarity, as well as the effective sample size of values in Tracer 1.5 (Rambaut and Drummond, 2007). We discarded 10% of the generations/trees. We considered relationships strongly supported when posterior probabilities were equal to or higher than 0.95.

Eighteen sequences of 16S and 12S were obtained from each of the nineScinax species, comprising 423 bp (164 variable sites) and 386 bp (131 variable sites) for each fragment respectively. For rhodopsin, 13 sequences of 316 bp with 51 variable sites were obtained from eight Scinaxrepresentatives.

The intraspecific nucleotide divergence in Scinax sp. was 0.2% for 16S, 0.3% for 12S, 0.2% for combined 12S+16S, and 0% for the rhodopsin. The nucleotide divergence of Scinax sp. in relation to the other species ranged from 6 to 13%, 7 to 20%, 6 to 18% and 0.6 to 6% for 16S, 12S, 16S+12S and rhodopsin, respectively (Table 2).

Table 2

Interspecific nucleotide divergence within Scinax (Anura: Hylidae) based on K2P model of 16S (above diagonal), combined 12S+16S (above diagonal in parentheses), 12S (below diagonal) and Rhodopsin (below diagonal in parentheses) genes. The species 1 to 5 belong to the S. catharinae clade, while the species 6 to 9 belong to the S. ruber clade; H. faber (10) was used as outgroup.

	Species	1	2	3	4	5	6	7	8	9	10
S. catharinae clade	1. S. agilis	–	0.10	0.11	0.10	0.10	0.12	0.13	0.19	0.18	0.16
			(0.05)	(0.06)	(0.06)		(0.06)	(0.03)	(0.05)	(0.04)	(0.05)
	2. S. berthae	0.10	–	0.05	0.06	0.05	0.10	0.12	0.17	0.15	0.15
		(0.10)		(0.03)	(0.03)		(0.06)	(0.04)	(0.04)	(0.06)	(0.06)
	3. S. catharinae	0.10	0.04	–	0.05	0.06	0.10	0.12	0.18	0.14	0.15
		(0.10)	(0.04)		(0.01)		(0.06)	(0.05)	(0.06)	(0.07)	(0.05)
	4. Scinax sp.	0.10	0.06	0.06	–	0.07	0.12	0.15	0.21	0.16	0.15
		(0.10)	(0.06)	(0.05)			(0.05)	(0.04)	(0.05)	(0.06)	(0.04)
	5. S. strigilatus	0.10	0.06	0.06	0.07	–	0.10	0.13	0.17	0.15	0.16
		(0.10)	(0.06)	(0.06)	(0.07)
S. ruber clade	6. S. uruguayus	0.15	0.13	0.12	0.11	0.12	–	0.10	0.17	0.13	0.15
		(0.13)	(0.12)	(0.11)	(0.11)	(0.11)		(0.02)	(0.03)	(0.04)	(0.05)
	7. S. elaeochrous	0.13	0.13	0.13	0.13	0.12	0.11	–	0.16	0.12	0.15
		(0.13)	(0.12)	(0.12)	(0.13)	(0.12)	(0.10)		(0.01)	(0.02)	(0.04)
	8. S. nasicus	0.12	0.13	0.13	0.13	0.12	0.14	0.07	–	0.16	0.21
		(0.15)	(0.14)	(0.15)	(0.16)	(0.14)	(0.15)	(0.11)		(0.03)	(0.06)
	9. S. garbei	0.14	0.13	0.14	0.12	0.13	0.11	0.10	0.13	–	0.20
		(0.15)	(0.14)	(0.14)	(0.13)	(0.14)	(0.11)	(0.10)	(0.14)		(0.05)
	10. Outgroup	0.16	0.15	0.15	0.15	0.16	0.17	0.14	0.16	0.15	–
		(0.16)	(0.15)	(0.15)	(0.15)	(0.16)	(0.16)	(0.15)	(0.18)	(0.17)

The Bayesian consensus phylogeny (16S + 12S + rhodopsin) placed Scinaxsp. as a distinct clade with strong support, being closely related to S. berthae, S. catharinae, S. strigilatus and S. agilis, all belonging to the S. catharinae clade (Figure 2 and Table 2). The four species from the S. ruber clade also formed a monophyletic group with strong support.

Figure 2

Bayesian consensus phylogeny based on combined analysis of 12S, 16S and rhodopsin (1,123 bp) of Scinax species, using H. faber as outgroup. Posterior probabilities higher than 0.95 are shown. The S. catharinae clade is highlighted in red while theS. ruber clade is highlighted in black. Scinax sp. (Chapada dos Guimarães, Mato Grosso, Brazil) corresponds to the specimens collected in this study.

Even though the cytochrome C oxidase I (COI) gene has been elected as a universal DNA barcode in animals (Hebert ), the 16S gene seems to be more effective to discriminate amphibian species (Vences ), thus being used in the present study. Indeed, the genetic distances of 7 to 10% in 16S rDNA observed between Scinax sp. and the other known species in theS. catharinae clade (S. berthae, S. catharinae, S. strigilatus and S. agilis) (Table 2) are higher than the minimum value of 3% in nucleotide divergence proposed by Fouquet ) to discriminate anuran species. Moreover, sequences of 12S and rhodopsin (nuclear) were also included to provide additional support to our hypothesis of a new species in the S. catharinae clade occuring in the Chapada dos Guimarães.

Many researchers advocate the integration of multiple approaches (molecular, cytogenetic, morphological and ecological studies) for identifying species (Dayrat, 2005; Padial ). According to the nomenclature rules established byVieites ),Scinax sp. could be classified as an "unconfirmed candidate species" (UCS), depending on additional morphological, ecological and vocalization studies to confirm its taxonomic status.

In conclusion, our molecular data provide evidence of a new species in the S. catharinae clade occurring in the Chapada dos Guimarães region, central Brazil. However, further morphological and bioacoustical analyses should be performed and focused on comparative data with other species from the S. catharine clade from Brazilian savannah, such as S. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios.