Somayeh Pourpirali1, Cristina Valacca2, Paola Merlo3, Salvatore Rizza4, Silvia D'Amico1, Francesco Cecconi5. 1. Department of Biology, University of Rome Tor Vergata, Rome, Italy. 2. Department of Biology, University of Rome Tor Vergata, Rome, Italy; IRCCS Fondazione Santa Lucia, Rome, Italy. 3. IRCCS Fondazione Santa Lucia, Rome, Italy. 4. Unit of Cell Stress and Survival, Danish Cancer Society Research Center, Copenhagen, Denmark. 5. Department of Biology, University of Rome Tor Vergata, Rome, Italy; IRCCS Fondazione Santa Lucia, Rome, Italy; Unit of Cell Stress and Survival, Danish Cancer Society Research Center, Copenhagen, Denmark.
Abstract
Hypoxia has been associated with several pathological conditions ranging from stroke to cancer. This condition results in the activation of autophagy, a cyto-protective response involving the formation of double-membraned structures, the autophagosomes, in the cytoplasm. In this study, we investigated the cellular mechanisms regulating the autophagy gene Ambra1, after exposure to a hypoxia mimetic, cobalt chloride (CoCl2). We observed that, upon CoCl2 administration, activation of the apoptotic machinery was concomitant with down-regulation of the pro-autophagic factor Ambra1, without affecting transcription. Additionally, co-treating the cells with the caspase inhibitor z-VAD-FMK did not restore Ambra1 protein levels, this implying the involvement of other regulatory mechanisms. Partial re-localization of Ambra1 mRNA to non-translating fractions and cytoplasmic P-bodies was further detected. Thus, in this pseudohypoxic context, Ambra1 mRNA translocation to P-bodies and translational suppression correlated with increased cell death.
Hypoxia has been associated with several pathological conditions ranging from stroke to cancer. This condition results in the activation of autophagy, a cyto-protective response involving the formation of double-membraned structures, the autophagosomes, in the cytoplasm. In this study, we investigated the cellular mechanisms regulating the autophagy gene Ambra1, after exposure to a hypoxia mimetic, cobalt chloride (CoCl2). We observed that, upon CoCl2 administration, activation of the apoptotic machinery was concomitant with down-regulation of the pro-autophagic factor Ambra1, without affecting transcription. Additionally, co-treating the cells with the caspase inhibitor z-VAD-FMK did not restore Ambra1 protein levels, this implying the involvement of other regulatory mechanisms. Partial re-localization of Ambra1 mRNA to non-translating fractions and cytoplasmic P-bodies was further detected. Thus, in this pseudohypoxic context, Ambra1 mRNA translocation to P-bodies and translational suppression correlated with increased cell death.
Multicellular organisms have developed oxygen-sensing systems to maintain oxygen homeostasis, which is essential for survival of the organism [1]. In fact, hypoxia has been detected in many pathological conditions such as coronary heart disease, stroke, and organ transplant injection [2]. Hif-1α (Hypoxia-inducible factor alpha) is a transcription factor that is rapidly activated in response to decreased levels of O2; this switches on, in turn, a subset of genes ensuring cell survival in hypoxic conditions [3]. Among the genes controlled by Hif-1α are VEGF (Vascular Endothelial Growth Factor) and EPO (Erythropoietin), both involved in erythropoiesis and angiogenesis to increase oxygen delivery to the hypoxic site [4,5]. Hypoxia also generally activates the cyto-protective response of autophagy in a Hif-1α dependent manner [3].Autophagy is a highly conserved process of self-digestion through the lysosomal pathway. It involves the delivery of cytoplasmic components and organelles to the lysosomes through specific vesicles, termed autophagosomes [6]. Autophagy and the molecular components involved in this process have been widely studied. Ambra1 (Activating Molecule in Beclin 1-Regulated Autophagy) is a key molecule in autophagy upstream regulation and plays a role in neurodevelopment [7-9]. It encodes a 1,300 amino acid long protein that is highly conserved among vertebrates. Functional inactivation of the gene results in embryonic lethality due to severe neural tube defects [7].Considering the involvement of defective autophagy in various pathological conditions, such as cancer and neurodegenerative disorders, several mechanisms regulating this process have been intensively investigated [10]. The most studied mode of regulation occurs through protein-protein interactions and post-translational modifications; However, new regulatory mechanisms are emerging, such as mRNA localization and processing through the miRNA machinery [11,12].Once a stressor affects the cell, this should be able to respond rapidly by changing its proteome/transcriptome [13,14]. One mechanism suggested to this aim is mRNA localization. When one mRNA product is not required by the cell, it exits polysomes and assembles in an mRNP complex lacking translation initiation factor. This multi-protein RNA complex accumulates in processing bodies (P-bodies) to then proceed with decapping followed by degradation [15].P-bodies are cytoplasmic structures composed of several core proteins (Edc3, decapping enzymes Dcp1/2, exonuclease Xrn1, etc.), some additional factors (such as GW182 and Ago1-4, etc.) and various mRNAs [16]. P-bodies also act as a storage site for those mRNAs that are not needed for a certain period of time. These silent intact mRNAs can exit P-bodies upon various stimuli to enter the translation machinery [15].Cobalt Chloride (CoCl2) is a hypoxia mimetic which increases Reactive oxygen species (ROS) production and stabilizes HIF-1α protein through inhibition of prolyl hydroxylases [17], a process also known as pseudohypoxia. In this study we observed that prolonged exposure to CoCl2 resulted in a block of autophgy flux and induction of apoptosis, accompanied by gradual decrease of Ambra1 protein levels and re-localization of its transcripts to non-translating fractions and cytoplasmic P-bodies.
Materials and Methods
Chemicals and Antibodies
CoCl2 was purchased from Sigma-Aldrich. Caspase inhibitor z-VAD-FMK was obtained from BD Pharmingen. The following primary antibodies were used: rabbit anti-Hif1α (SCBT), rabbit anti-Ambra1 (SDI), rabbit anti-Actin (Sigma), rabbit anti-LC3 (Cell Signaling), rabbit anti-cleaved Caspase 3 (Cell Signaling), rabbit anti-p62 (MBL), rabbit anti-PARP. Goat anti-mouse and goat anti-rabbit HRP-conjugated secondary antibodies (Sigma) were used for western blotting. Alexa Fluor 488 and 555 conjugated secondary antibodies (Invitrogen) were used for immunofluorescence analysis.
RNA extraction and reverse transcription
RNA was extracted from HeLa cells using QIAGEN mini RNeasy kit following the manufacturer’s instruction. Two μg of extracted RNA was used for reverse transcription and 500 ng of random primers for each μg of RNA was added to each tube. Samples were heated to 70°C for 5 min followed by immediate incubation on ice. M-MLV reaction buffer (1X), dNTPs, RNase inhibitor (1U/μl), and M-MLV reverse transcriptase (8U/reaction) (Promega) were added to the mix and were incubated for one hour at 37°C. Real-time PCR was performed using ABI lightcycler. 0.5 μg cDNA were used with 10 μl SYBR Green Master Mix (ABI), and 200 nM of each primer were added in a 20 μl reaction mix. The following primers where used for quantitative real-time PCR: Ambra1 (F: AACCCTCCACTGCGAGTTGA, R: TCTACCTGTTCCGTGGTTCTCC), hLC3B (F: CGGTGATAATAGAACGATACAAGG, R: CTGAGATTGGTGTGGAGACG), hTub-α6 (F: CCCCTTCAAGTTCTACTCATGC, R: ATTGCCAATCTGGACACCA), hL34 (F: GTCCCGAACCCCTGGTAATAGA, R: GGCCCTGCTGACATGTTTCTT), hp62 (F: AGCTGCCTTGTACCCACATC, R: CAGAGAAGCCCATGGACAG), and hNqo1 (F: CATCACAGGTAAACTGAAGGACC, R: TCAGCCACAATATCTGGGCTC).
Cell cultures and Chemical Treatments
HeLa and HEK-293 cells were grown in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum (FCS), 100 units/ml penicillin, 100 mg/ml streptomycin, and 2 mM glutamine, in a 5% CO2 atmosphere at 37°C. For CoCl2 treatment, cells were incubated with 500 μM CoCl2 from 0 to 24 hours. For z-VAD-FMK (10 μM) and MG132 (5 μM) treatments cells were incubated for the indicated time-points. For autophagy flux evaluation, chloroquine was added for the last hour of the CoCl2 treatment in the medium at a concentration of 20 μM. For Actinomycin D treatment, the drug was added for the last 4 hours of the CoCl2 treatment at a final concentration of 10 μM. For NAC treatment, this was added for the last 4 hours of CoCl2 treatment at a final concentration of 1 and 5 mM, respectively.
ROS evaluation
To evaluate ROS relative concentration upon CoCl2 treatment, 30 min before the end of the experimental procedure, cells were incubated with 5μM DHE (Life Technologies) at 37°C. Cells were then washed twice in ice-cold PBS and collected. The fluorescence intensity of DHE, enhanced by the reaction with ROS, was analyzed by recording FL-2 fluorescence on a FACSVerse (BD Bioscences) flow cytometer.
Protein extraction and Western blotting
Cells were lysed by addition of lysis buffer containing 50 mM Tris pH 7.5, 150 mM NaCl, 1% Triton, 1 mM sodium orthovanadate, 10 mM NaF and protease inhibitor cocktail (Sigma). The samples were incubated for 30 min on ice and centrifuged at 4°C for 10 min at 14,000 rpm. The supernatant containing the proteins was recovered and, after quantification by Bio-Rad protein quantification kit according to instructions, Sample Buffer 4X was added. Protein samples were separated by SDS-polyacrylamide gel (8% or 13.5% polyacrylamide, depending on the experiment) and transferred to nitrocellulose membrane. After 1 hour of incubation with 5% non-fat milk, membranes were incubated either over night at 4°C or 2 hours at room-temperature with anti- LC3 (1:1000), anti-Ambra1 (1:2000), anti-HIF1-α (1:1000), anti-p62 (1:1000), anti-actin (1:1000), anti-caspase 3 (1:300), and anti-PARP (1:1000) primary antibodies. After extensive washing, the membranes were incubated for 1 hour at room temperature with secondary antibodies and immunoreatcive bands were visualized using an enhanced chemiluminescence reagent (Millipore). Acquisition was performed with Fluorchem SP (Alpha Innotech).
RNA-FISH
QuantiGene View RNA ISH cell assay kit was obtained from Affymetrix. The experiment was conducted as instructed. In brief, HeLa cells were grown on poly-lysine coated glass slides, 96-well plates, or 384-well plates to 70% confluence. Cells were washed with PBS and fixed in 4% formaldehyde for 30 min. After washing with PBS 1X, they were permeablized with Detergent Solution for 5 min followed by protease digestion (1:8000) for 10 min. Working Probe Sets were added and the slides were incubated at 40°C for 3 hours. Consequently, they were incubated with pre-Amplifier, Amplifier, and Label Probe Mix, each step for 30 min at 40°C. Finally, the slides were counterstained with DAPI and the images were acquired by using a confocal microscope (see below). RNA probes were designed by Affymetrix against human Ambra1 and human Beclin 1.
Immunocytochemistry
Cells were washed with PBS 1X and fixed with 4% paraformaldehyde for 15 min at room temperature. After several washes with PBS they were permeabilized with 0.5% Triton X-100 in PBS for 5 min before immunostaining. After incubation with 5% BSA for one hour at room temperature, the cells were incubated over night with anti-Ge-1 (1:400) primary antibodies. Detection of the primary antibodies was performed using 1:400 Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor 555 goat anti-mouse IgG secondary antibodies for 1 hour at room temperature. For nuclei detection, cells were counterstained with DAPI.Confocal images were acquired with Confocal laser scanning microscope Olympus FV 1000 using laser 405 nm (diode) for blue channel (DAPI), 488nm (argon) for green channel (FITC) and 543nm (HeNe) for red channel (TRITC). Oil objective 60x (NA 1,35) with optical zoom 3x were used. Fluorochrome unmixing was performed by automated-sequential collection of multi-channel images to reduce spectral cross-talk between channels. Ambra dots colocalization with GE-1 has been done using ImageJ software; For control and pseudohypoxia conditions 26 (5 fields) and 20 cells (4 fields) have been counted, respectively. For apoptotic nuclei analysis, DAPI was added in the medium of living cells; after 10 minutes of incubation, 10 random images per condition were taken and apoptotic and normal nuclei were counted.
Linear sucrose gradient fractionation
Polysome profile analysis was performed using linear sucrose gradient fractionation (LGS). First, cells were incubated with 100 μg/ml cycloheximide (Sigma) for 15 minutes at 37°C. Then, they were washed with PBS containing 100 μg/ml cycloheximide and lysed with 500 μl LGS buffer (100 mM KCl, 20 mM Tris, pH 7.5, 5 mM MgCl2, 0.4% NP-40, 100 μg/ml cycloheximide, 0.1 U RNase inhibitor (Promega) and complete EDTA-free protease inhibitor). Cell lysate were centrifuged at 14,000 rpm for 15 min at 4°C and supernatant was recovered. The supernatant was loaded onto 15–50% sucrose gradient. Ultra-centrifugation was performed for 110 min at 37,000 rpm at 4°C in a Beckman SW41 rotor. Each gradient was collected as 10 fractions (1 ml each) in a tube containing SDS with the final concentration of 1% and RNA-spike (20 pg/fraction). Fractions were monitored by continuous OD254 measurement; 100 μg/ml Proteinase K was added to the samples followed by 1 hour incubation at 37°C. Total RNA was extracted from each fraction using phenol-chloroform and isopropanol precipitation.
Results
To study the regulatory mechanisms of hypoxia-induced autophagy, HeLa cells were treated with 500μM CoCl2 for 24 hours, a condition termed ‘pseudohypoxia’. Induction of pseudohypoxia was confirmed by detecting in a time-course Hif1-α protein levels (Fig 1A), which were increased as early as 2-6h after treatment with CoCl2. To further verify hypoxia induction we performed a Real-Time PCR on p62 and Nqo1 mRNAs, two targets of the transcription factor Nfr2, known to be activated during hypoxia; Indeed, both after 8 and 18 hours of CoCl2 treatment, the two mRNAs are significantly upregulated (Fig 1B). Autophagy was then monitored by western blot analysis of two common markers, p62 and LC3. As shown in Fig 2A, p62 protein levels decreased with time, accompanied by more conversion of LC3I to LC3II. In order to understand whether the accumulation of LC3II was due to an activation of autophagy or rather to a block of this process, which would impair its degradation, we analyzed the autophagy on-rate/off-rate (autophagy flux) by using chloroquine, an inhibitor of the autophagosome/lysosome fusion. We found that 8 hours after treatment with CoCl2 there is no production of new autophagosomes; instead, the autophagy flux is blocked, leading to LC3II accumulation (Fig 2B). To further corroborate this data, we next analysed LC3 dots by immunofluoresce in cells treated with CoCl2, both in basal and autophagy-blocked conditions; as shown in Fig 2C, CoCl2 inhibits LC3 dots formation after chloroquine, this confirming a block of the autophagy flux (Fig 2C and S1 Fig). Of note, an expected ROS increase due to pseudohypoxic conditions, is induced only 16 hours after CoCl2 administration, this indicating that ROS are not responsible of the observed effects on autophagy, whose block is detectable as soon as 8 hours after treatment (Fig 3A). In agreement with this conclusion, treatement with the ROS scavenger NAC has modest if any effects on LC3II accumulation (Fig 3B).
Fig 1
CoCl2 induces pseudohypoxia.
HeLa cells were treated with 500 μM CoCl2; The induction of pseudohypoxia were detected by Hif1-α protein expression at 0, 2, 6, 8, 10, 15, 18, and 24 hr of treatment (A) and by p62 and Nqo1 mRNA expression at 8 and 18 hr of treatment (B). P-values <0.05 (*) and <0.005 (**) are considered statistically significant.
Fig 2
Persistent pseudohypoxia results in a block of autophagy flux.
HeLa cells were treated with 500 μM CoCl2 and autophagy (indicated by p62 and LC3II/Actin ratio) were analysed at 0, 2, 6, 8, 10, 15, 18, and 24 hr (A). Autophagy flux was monitored by LC3 II accumulation after adding chloroquine (CHQ) at a final concentration of 20 μM for the last 1 hr of treatment in presence of CoCl2 or not (NT) (8 hr total treatment) by W.B. (B) and IF (C). The graphs represent the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.
Fig 3
ROS production is not a direct consequence of CoCl2 treatment.
The presence of ROS was evaluated by FACS analysis in HeLa cells treated with 500 uM CoCl2 for 8 and 16 hr (A). Accumulation of LC3 II after 500 uM CoCl2 treatment for 8, 6 and 24 hours was monitored by W.B. adding the ROS scavenger NAC for the last 4 hours of treatment at a final concentration of 1 and 5 mM (B). The graphs represent the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.
CoCl2 induces pseudohypoxia.
HeLa cells were treated with 500 μM CoCl2; The induction of pseudohypoxia were detected by Hif1-α protein expression at 0, 2, 6, 8, 10, 15, 18, and 24 hr of treatment (A) and by p62 and Nqo1 mRNA expression at 8 and 18 hr of treatment (B). P-values <0.05 (*) and <0.005 (**) are considered statistically significant.
Persistent pseudohypoxia results in a block of autophagy flux.
HeLa cells were treated with 500 μM CoCl2 and autophagy (indicated by p62 and LC3II/Actin ratio) were analysed at 0, 2, 6, 8, 10, 15, 18, and 24 hr (A). Autophagy flux was monitored by LC3 II accumulation after adding chloroquine (CHQ) at a final concentration of 20 μM for the last 1 hr of treatment in presence of CoCl2 or not (NT) (8 hr total treatment) by W.B. (B) and IF (C). The graphs represent the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.
ROS production is not a direct consequence of CoCl2 treatment.
The presence of ROS was evaluated by FACS analysis in HeLa cells treated with 500 uM CoCl2 for 8 and 16 hr (A). Accumulation of LC3 II after 500 uM CoCl2 treatment for 8, 6 and 24 hours was monitored by W.B. adding the ROS scavenger NAC for the last 4 hours of treatment at a final concentration of 1 and 5 mM (B). The graphs represent the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.Since several studies show the activation of apoptosis following CoCl2 treatment [18], this process was also analyzed in treated cells. As shown in Fig 4A, at later time points, cleavage of caspase 3 (Casp3) indicates apoptosis induction. As a consequence of caspase activation, after 24 hours of CoCl2 treatment, we observe cleavage of PARP [Poly (ADP-ribose) polymerase], a hallmark of apoptosis (Fig 4B). In line with this finding, a count of apoptotic nuclei revealed an increased cell death following the treatement, confirming that, indeed, CoCl2 treatment leads to apoptosis (Fig 4C).
Fig 4
Hypoxia mimetic CoCl2, induces apoptosis.
HeLa cells were treated with 500 μM CoCl2. Apoptosis was analyzed by monitoring cleaved Caspase3 at 0, 2, 6, 8, 10, 15, 18, and 24 hr of treatment (A), cleaved PARP at 24 hr (B) and by counting apoptotic nuclei stained with DAPI at 24 hr of treatment (C);. Asterisks point to aspecific bands. Experiments have been repeated three times with similar results. Representative images of nuclei stained with DAPI are shown (scale bar 100 μm). The graph represents the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant.
Hypoxia mimetic CoCl2, induces apoptosis.
HeLa cells were treated with 500 μM CoCl2. Apoptosis was analyzed by monitoring cleaved Caspase3 at 0, 2, 6, 8, 10, 15, 18, and 24 hr of treatment (A), cleaved PARP at 24 hr (B) and by counting apoptotic nuclei stained with DAPI at 24 hr of treatment (C);. Asterisks point to aspecific bands. Experiments have been repeated three times with similar results. Representative images of nuclei stained with DAPI are shown (scale bar 100 μm). The graph represents the densitometric analysis of three different experiments ± SD. *: P-value < 0.05 is considered statistically significant.To investigate the regulation of autophagy genes upon hypoxia, the protein levels of Ambra1 and Beclin 1, two upstream proautophagic proteins, were analyzed by western blotting (WB; Fig 5A and 5B). A gradual decrease of Ambra1 and Beclin 1 protein levels was observed upon CoCl2 treatment. This finding is inversely related with what shown in Fig 2A, where we show an increase of LC3II protein levels starting at the 2h time-point and a continued increase until the final measurement at 24h. Next, we analyzed the Ambra1 mRNA levels to verify whether these changes were due to transcriptional or translational regulation. Quantitative real-time PCR was performed using primers against Ambra1 and Tubulin α-6 (Tuba6) (as a control). Interestingly, no significant changes in Ambra1 mRNA levels were observed at 18h, the time-point at which protein levels decreased (Fig 6A). In order to understand if Ambra1 mRNA was somehow stabilized or instead transcribed and then degraded in a continuous loop, we performed an experiment using Actinomycin D (ActD), a drug inhibiting mRNA transcription. In the control sample, a treatment of 4 hours of ActD is sufficient to observe a significant decrease of Ambra1 mRNA; However, on cells treated for 8 hours with CoCl2, ActD does not lead to a significant Ambra1 mRNA decrease, this indicating that upon CoCl2 treatment there is a block of Ambra1 mRNA production and degradation (Fig 6B).
Fig 5
Persistent pseudohypoxia results in a gradual decrease of Ambra1 and Beclin 1 protein levels.
HeLa cells were treated with 500 μM CoCl2 and Ambra1 and Beclin 1 protein were detected at 0, 2, 6, 8, 10, 15, 18, and 24 hr after treatment. The graph shows the densitometric quantification of Ambra1 (A) and Beclin 1 (B) related to Actin. Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant.
Fig 6
Ambra1 mRNA is stabilized after CoCl2 treatment.
Ambra1 mRNA level was analyzed by quantitative RT-PCR after 18 hr treatment. Tuba6 mRNA was used for normalization (A). Ambra1 mRNA level was analyzed by quantitative RT-PCR after adding Actinomycin D (ActD) for the last 4 hours of CoCl2 treatment; CoCl2 was left for 8 hours total at a concentration of 500 μM. Actin mRNA was used for normalization (B). a.u. = arbitrary units. Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.
Persistent pseudohypoxia results in a gradual decrease of Ambra1 and Beclin 1 protein levels.
HeLa cells were treated with 500 μM CoCl2 and Ambra1 and Beclin 1 protein were detected at 0, 2, 6, 8, 10, 15, 18, and 24 hr after treatment. The graph shows the densitometric quantification of Ambra1 (A) and Beclin 1 (B) related to Actin. Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant.
Ambra1 mRNA is stabilized after CoCl2 treatment.
Ambra1 mRNA level was analyzed by quantitative RT-PCR after 18 hr treatment. Tuba6 mRNA was used for normalization (A). Ambra1 mRNA level was analyzed by quantitative RT-PCR after adding Actinomycin D (ActD) for the last 4 hours of CoCl2 treatment; CoCl2 was left for 8 hours total at a concentration of 500 μM. Actin mRNA was used for normalization (B). a.u. = arbitrary units. Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant, n.s. = not significant.A recent study has shown that long-term stress, such as starvation or staurosporin treatment, leads to Ambra1 protein degradation through caspase cleavage, this inhibiting the pro-survival role of autophagy [19]. To exclude the involvement of this event on the decrease of Ambra1 protein during prolonged pseudohypoxia, cells were treated with the pan-caspase inhibitor z-VAD-FMK along with CoCl2 for 18h. Interestingly, as shown in Fig 7A, inhibition of caspases had little if any effects on Ambra1 protein levels, implicating that other mechanism(s) must be responsible for Ambra1 protein decrease. Thus, we checked if the proteasome could account for Ambra1 decrease, by adding to the cells the proteasome inhibitor MG132 together with CoCl2; after 18 hours we observed that Ambra1 protein levels are still low when the proteasome is inhibited, this suggesting that the proteasome system is not responsible for AMBRA1 decrease (Fig 7B).
Fig 7
Inhibition of caspases or proteasome does not restore Ambra1 protein levels.
HeLa cells were treated for 18h with 500 μM CoCl2 in the presence or absence of z-VAD-FMK (10 μM) (A) or MG132 (B). Induction of pseudohypoxia was confirmed by observing an increase in Hif1-α protein levels. The graph represents the densitometric analysis of Ambra1/Actin ratio in control and pseudohypoxic conditions with or without z-VAD-FMK (zVAD). Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant (A). Experiments with MG132 were repeated three times with similar results (B).
Inhibition of caspases or proteasome does not restore Ambra1 protein levels.
HeLa cells were treated for 18h with 500 μM CoCl2 in the presence or absence of z-VAD-FMK (10 μM) (A) or MG132 (B). Induction of pseudohypoxia was confirmed by observing an increase in Hif1-α protein levels. The graph represents the densitometric analysis of Ambra1/Actin ratio in control and pseudohypoxic conditions with or without z-VAD-FMK (zVAD). Values are mean ± SD of three independent experiments relative to control. *: P-value < 0.05 is considered statistically significant (A). Experiments with MG132 were repeated three times with similar results (B).In principle, an apparent discrepancy between protein and mRNA levels implies the involvement of a translational control in this phenomenon. Therefore, we investigated the localization of Ambra1 mRNA in normal and stress conditions. To check whether the transcription/translation rate of Ambra1 mRNA was impacted by its translational control, Ambra1 polysome profile was analyzed in both control conditions and 18h after induction of pseudohypoxia in HeLa cells. Ten fractions were obtained from each sample with continuous OD254nm measurement. As shown in Fig 8A, pseudohypoxia resulted in a general decrease in translation. RNA was extracted from each fraction and the RNAs obtained from ‘translating’ fractions (#1–5) were pooled together. The same was done for ‘non-translating’ fractions (#6–10), followed by reverse transcription. Q-PCR showed a significant decrease in the amount of translating Ambra1 mRNA after CoCl2 treatment, whilst control mRNA (tuba6) was unchanged in control and pseudohypoxic conditions (Fig 8B).
Fig 8
Accumulation of untranslated Ambra1 mRNA after hypoxia.
Polysome profiling was performed using control and hypoxic cells. Ten fractions were obtained from each sample by continuous OD254nm measurement (A). Quantitative RT-PCR was performed using mRNA extracted from translating (Translated) and non-translating (Untranslated) fractions (5 fractions each) using specific primers for Ambra1 (B). Data were normalized with RNA-Spike. Values obtained from three independent experiments ± SD. *: Statistical significance. P-value < 0.05.
Accumulation of untranslated Ambra1 mRNA after hypoxia.
Polysome profiling was performed using control and hypoxic cells. Ten fractions were obtained from each sample by continuous OD254nm measurement (A). Quantitative RT-PCR was performed using mRNA extracted from translating (Translated) and non-translating (Untranslated) fractions (5 fractions each) using specific primers for Ambra1 (B). Data were normalized with RNA-Spike. Values obtained from three independent experiments ± SD. *: Statistical significance. P-value < 0.05.Non-translating mRNAs are often stored in cytoplasmic P-bodies. P-bodies are cytoplasmic structures that are involved in storage and processing of mRNAs [20]. They also play a role in translational regulation in different conditions [3]. We thus analyzed the localization of Ambra1 mRNA in the cytoplasm before and after exposure to pseudohypoxic conditions (Fig 9). P-bodies were detected using an antibody against Ge-1 (a marker for this compartment) and appeared as fewer but much larger spots after CoCl2 treatment (Fig 9C and 9G). To analyze the localization of Ambra1 mRNA relative to P-bodies, RNA-FISH was followed by immunostaining of Ge-1 (Fig 9B and 9F). Interestingly, while there is no co-localization at all between Ambra1 mRNA and P-bodies in control conditions, pseudohypoxia induced by CoCl2 resulted in a partial re-localization of Ambra1 mRNA to these cytoplasmic structures (see arrows in Fig 9D and 9H, Figure B in S2 Fig, and quantification of co-localization in both conditions in Fig 9I and Figure B in S2B Fig). As a control we performed the same analysis on Beclin 1 mRNA, but, by contrast, no co-localization at all with P-bodies was observed (S3 Fig).
Fig 9
Translocation of Ambra1 mRNA to cytoplasmic P-bodies upon pseudohypoxia.
Left panels (A-D) represents control cells, whilst right panels (E-H) shows HeLa cells treated for 18 hr with 500 μM CoCl2. (C,G) Ge-1 protein; (B, F) Ambra1 mRNA; (D, H) Merge image. Arrows show P-bodies (G), Ambra1 mRNA (F), and co-localization of Ambra1 and Ge-1 (H). The corresponding quantification in both conditions is shown in the graph below the images (I). **: Statistical significance. P-value < 0.005. Scale bars: 7 μm.
Translocation of Ambra1 mRNA to cytoplasmic P-bodies upon pseudohypoxia.
Left panels (A-D) represents control cells, whilst right panels (E-H) shows HeLa cells treated for 18 hr with 500 μM CoCl2. (C,G) Ge-1 protein; (B, F) Ambra1 mRNA; (D, H) Merge image. Arrows show P-bodies (G), Ambra1 mRNA (F), and co-localization of Ambra1 and Ge-1 (H). The corresponding quantification in both conditions is shown in the graph below the images (I). **: Statistical significance. P-value < 0.005. Scale bars: 7 μm.
Discussion
Here we propose the existence of a translational regulation of Ambra1, a pro-autophagy molecule, upon pseudohypoxia induction. We observed that Ambra1 protein levels decreased upon prolonged exposure to the hypoxia mimetic CoCl2, without any significant changes in mRNA levels. Along with data previously reported, we observed induction of pseudohypoxia in our cell system upon treatment with CoCl2, as confirmed by stabilization of Hif1-α protein.Although it is widely accepted that Hif1-α activation leads to autophagy induction, after 8 hours of treatment with CoCl2 we found that LC3II accumulation is due to a block rather than to an induction of the autophagy flux, as revealed using chloroquine in western blot and in immunofluorescence experiments. This can be explained by the fact that, after a stress, autophagy is increased in order to preserve the cell, even though-if the stimulus persists for a long period, autophagy is blocked. Therefore, we can speculate that after 8 hours of pseudohypoxia, autophagy inhibition is due to the long exposure to CoCl2. On the contrary, p62 is slightly decreased after treatment, even if an increase in its transcription is observed, this being due, most likely, to hypoxia-mediated Nrf2 activation. This suggests a block in its translation or its protein degradation by caspases or the proteasome; alternatively, when autophagy is inhibited, p62 can forms aggregates that are insoluble in lysis buffer containing Triton. In addition, we show here that ROS are activated only after 16 hours of CoCl2 treatment, indicating that probably they are not early induced by CoCl2. Most likely, since an impaired degradation of damaged mitocondria leads to ROS production, we can speculate that the block of autophagy due to prolonged pseudohypoxia causes indirect ROS induction that, in turn, leads to apoptosis at later time points.Looking at autophagy genes, we detected a gradual decrease in Ambra1 and Beclin 1 protein levels. We then proceeded with the analysis of Ambra1, a more upstream regulator of autophagy. Since Ambra1 mRNA levels remain unchanged, the first hypothesis to test was degradation of the Ambra1 protein. A recent study by Piacentini and colleagues demonstrated that treating different cell lines such as HeLa and 2FGTH with Staurosporine, a DNA-damage inducer, resulted in a gradual decrease of Ambra1 protein over time, without affecting the mRNA levels [19]. Interestingly, this decrease happened concomitantly with an increase in the PARP cleaved form, a marker of apoptosis induction. They further observed that Ambra1 was a target of caspases, since treating the cells with the caspase inhibitor z-VAD-FMK together with staurosporine could partially restore the level of Ambra1. Ambra1 degradation occurs when the stress is too intense or prolonged and autophagy cannot rescue the cell; therefore, by degradation of Ambra1, the pro-survival machinery of autophagy switches to apoptosis [19]. Although the direct interaction of Ambra1 with caspases has been reported, and inhibition of caspases prevents Ambra1 degradation in overexpressing conditions, it does not completely restore the endogenous protein levels [19]. This suggests the involvement of other mechanisms in down-regulation of Ambra1.In this study, we have observed that long-term exposure to pseudohypoxic conditions results in the activation of apoptosis along with decreased Ambra1 protein levels, whilst mRNA level remains unchanged. Also, applying caspase inhibitor to the cells does not restore Ambra1 protein levels. We also showed that Ambra1 degradation is not due to the ubiqutine-proteasome system; in addition, we showed that MG132 together with CoCl2 leads to an almost complete depletion of Ambra1, suggesting that probably a protein involved in Ambra1 decrease is stabilized by blocking the proteasome-mediated degradation. Moreover, our experiments with ActD indicate that Ambra1 mRNA transcription and turnover are blocked after the treatment with CoCl2.Our data implies the involvement of a translational control in this phenomenon. To test this hypothesis, polysome profile analysis was performed and we observed translocation of Ambra1 mRNA from polysomes (translating fraction) to non-translating fraction upon pseudohypoxia, resulting in the decrease of Ambra1 protein levels. Since un-translating mRNAs are often stored in cytoplasmic P-bodies, we analyzed the localization of Ambra1 mRNA in the cytoplasm before and after exposure to hypoxic conditions. Even though Ambra1 mRNA is stable in stress conditions, our data suggest that, at least in part, it is sequestered and stabilized in P-bodies, thus becoming inaccessible to the protein translation machinery. This sequestration may then result in a decrease in protein levels, in time with activation of cell death and suppression of the pro-survival pathway of autophagy. By contrast, Beclin 1 mRNA does not relocate to P-bodies at all in similar conditions, indicating that the mechanism here described does not concern all autophagy regulators. Although in general the decay of mRNAs is a consequence of prolonged stress conditions that lead to apoptosis, it is plausible that the maintenance of a pool of Ambra1 mRNA may represent an important reserve for the cell in case normal conditions are restored. Indeed, this would allow Ambra1 prompt translation.As for the mechanism by which Ambra1 mRNA moves to P-bodies, it certainly needs further investigation. There is evidence for interaction of P-bodies with actin filaments and/or microtubule structures [21,22]. Also, association of certain RNAs with the dynein motor complex for dendritic localization has been postulated [23]. Therefore, the next step would be studying the effect of microtubule disruption on localization of Ambra1 mRNA with or without CoCl2 treatment and its effect on cell death and survival in hypoxic conditions. Furthermore, since the co-localization of Ambra1 mRNA and P-bodies after CoCl2 treatment is only partial, it would be interesting to know if this messenger can also localize in other specific foci, such as stress granules.
Autophagy flux is blocked after long exposure to CoCl2.
Representative images of HeLa cells not treated (NT) ore treated with CoCl2 500 μM for 8 hours in presence or not of chloroquine 20 μM (CHQ) for the last hour of treatment.(EPS)Click here for additional data file.
Detailed analysis of Ambra1 mRNA into cytoplasmic P-bodies after hypoxia.
(A) The image represents 3D-analysis of Ambra1 mRNA (red) and Ge-1 protein (green) co-localization after 18 hr treatment with CoCl2. Blue: Nuclear staining with DAPI. (B) total Ambra1-positive dots were counted in treated and untreated cells: the graph shows that their total number is unchanged.(EPS)Click here for additional data file.
Upon CoCl2 treatment Beclin 1 mRNA does not traslocate to P-bodies.
Left panels (A-C) represents control cells, whilst right panels (D-F) shows HeLa cells treated for 18 hr with 500 μM CoCl2. (B, E) Ge-1 protein; (A, D) Beclin 1 mRNA; (C, F) Merge image. Scale bars: 10 μm(EPS)Click here for additional data file.
Authors: Gian Maria Fimia; Anastassia Stoykova; Alessandra Romagnoli; Luigi Giunta; Sabrina Di Bartolomeo; Roberta Nardacci; Marco Corazzari; Claudia Fuoco; Ahmet Ucar; Peter Schwartz; Peter Gruss; Mauro Piacentini; Kamal Chowdhury; Francesco Cecconi Journal: Nature Date: 2007-06-24 Impact factor: 49.962
Authors: Allen M Andres; Joel A Kooren; Sarah J Parker; Kyle C Tucker; Nandini Ravindran; Bruce R Ito; Chengqun Huang; Vidya Venkatraman; Jennifer E Van Eyk; Roberta A Gottlieb; Robert M Mentzer Journal: Am J Physiol Heart Circ Physiol Date: 2016-05-06 Impact factor: 4.733
Authors: Miroslava Stastna; Amandine Thomas; Juliana Germano; Somayeh Pourpirali; Jennifer E Van Eyk; Roberta A Gottlieb Journal: J Vis Exp Date: 2018-08-29 Impact factor: 1.355
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Fig 1
Fig 2
Fig 3
Fig 4
Fig 5
Fig 6
Fig 7
Fig 8
Fig 9