Literature DB >> 26039698

Antimicrobial Resistance of Shigella flexneri Serotype 1b Isolates in China.

Xianyan Cui1, Chaojie Yang2, Jian Wang2, Beibei Liang2, Shengjie Yi2, Hao Li2, Hongbo Liu2, Peng Li2, Zhihao Wu2, Jing Xie2, Leili Jia2, Rongzhang Hao2, Ligui Wang2, Yuejin Hua3, Shaofu Qiu2, Hongbin Song2.   

Abstract

Shigella flexneri serotype 1b is among the most prominent serotypes in developing countries, followed by serotype 2a. However, only limited data is available on the global phenotypic and genotypic characteristics of S. flexneri 1b. In the present study, 40 S. flexneri 1b isolates from different regions of China were confirmed by serotyping and biochemical characterization. Antimicrobial susceptibility testing showed that 85% of these isolates were multidrug-resistant strains and antibiotic susceptibility profiles varied between geographical locations. Strains from Yunnan were far more resistant than those from Xinjiang, while only one strain from Shanghai was resistant to ceftazidime and aztreonam. Fifteen cephalosporin resistant isolates were identified in this study. ESBL genes (blaSHV, blaTEM, blaOXA, and blaCTX-M) and ampC genes (blaMOX, blaFOX, blaMIR(ACT-1), blaDHA, blaCIT and blaACC) were subsequently detected among the 15 isolates. The results showed that these strains were positive only for blaTEM, blaOXA, blaCTX-M, intI1, and intI2. Furthermore, pulsed-field gel electrophoresis (PFGE) analysis showed that the 40 isolates formed different profiles, and the PFGE patterns of Xinjiang isolates were distinct from Yunnan and Shanghai isolates by one obvious, large, missing band. In summary, similarities in resistance patterns were observed in strains with the same PFGE pattern. Overall, the results supported the need for more prudent selection and use of antibiotics in China. We suggest that antibiotic susceptibility testing should be performed at the start of an outbreak, and antibiotic use should be restricted to severe Shigella cases, based on resistance pattern variations observed in different regions. The data obtained in the current study might help to develop a strategy for the treatment of infections caused by S. flexneri 1b in China.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26039698      PMCID: PMC4454585          DOI: 10.1371/journal.pone.0129009

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Shigella, the causative agent of human shigellosis, is a significant public health burden. Worldwide, 164.7 million Shigella episodes per year are estimated, of which 163.2 million are in developing countries. The majority of the infections and deaths caused by Shigella are in children <5 years old [1]. Moreover, a surveillance study in six Asian countries showed the global disease burden caused by shigellosis might be much higher than these estimates [2]. In China, shigellosis is one of the top four notifiable infectious diseases, with nearly half a million cases annually [3]. Shigella species are in fact clones of Escherichia coli [4]. Based on biochemical and serological properties, the genus Shigella is divided into four species or subgroups: S. dysenteriae, S. flexneri, S. boydii, and S. sonnei, among which, S. flexneri is the predominant species in developing countries [1]. A previous study showed that the annual shigellosis morbidity rate was 20.3 cases per 100,000 people in China using the national surveillance data from 2009, and S. flexneri (67.3%) and S. sonnei (32.7%) were two major causative species [5]. Because Shigella strains are all negative for H antigen, Shigella serotyping is based on the O antigen only. To date, 20 S. flexneri serotypes (1a, 1b, 1c (or 7a), 1d, 2a, 2b, 2v, 3a, 3b, 4a, 4av, 4b, 5a, 5b, X, Xv, Y, Yv, 6, and 7b) have been recognized [6,7]. Some S. flexneri serotypes are more prevalent than others, and S. flexneri 1b is among the most commonly encountered serotypes in developing countries, followed by serotype 2a [1]. Pickering LK showed that antimicrobial susceptibility patterns of Shigella species, were influenced by geographic location and other factors (year, classes of antimicrobial agents, pressure exerted by antimicrobial use, source of isolates) in endemic regions [8]. However, comparisons of associations between geographical diversity and antimicrobial resistance of serotype 1b strains are largely lacking. The objective of the present study was to evaluate the antimicrobial resistance profiles of S. flexneri 1b isolates from different regions of China, and guide the selection of the most effective antimicrobial agents for shigellosis treatment.

Materials and Methods

Bacterial isolates, serotyping, and biochemical characterization

During our routine surveillance of bacillary dysentery, fecal samples from individual outpatients with diarrhea or dysentery were collected and screened for Shigella species in sentinel hospitals based on a national pathogen monitoring system. Samples were streaked directly onto Salmonella-Shigella (SS) agar and incubated overnight at 37°C. Resultant colonies were picked and streaked directly onto SS agar and again incubated overnight at 37°C. The colonies were subcultured on Luria–Bertani agar plates and incubated overnight at 37°C, and were then sent to our laboratory for further confirmation. This study was approved by the ethics committee of the Academy of Military Medical Sciences (China). Written informed consent was obtained from the patients involved in this study. The isolates were confirmed using API 20E test strips (bioMerieux Vitek, Marcy-l’Etoile, France) following the manufacturer’s recommendations. Serotype identification was performed using two serotyping kits: a kit including antisera specific for all type and group-factor antigens (Denka Seiken, Tokyo, Japan), and a monoclonal antibody reagent kit (Reagensia AB, Stockholm, Sweden), specific for all S. flexneri type and group-factor antigens. Serological reactions were performed using the slide agglutination test, as described previously [9].

Antimicrobial susceptibility testing

MICs of 21 antimicrobial agents including ceftazidime (CAZ), ceftriaxone (CRO), cefepime (FEP), cefoperazone (CFP), cefazolin (CFZ), cefoxitin (FOX), imipenem (IPM), nitrofurantoin (NIT), piperacillin (PIP), ampicillin (AMP), ticarcillin (TIC), tetracycline (TE), tobramycin (TO), gentamicin (GEN), amikacin (AK), aztreonam (ATM), chloramphenicol (C), ticarcillin/clavulanic acid (TIM), levofloxacin (LEV), norfloxacin (NOR), and trimethoprim/sulfamethoxazole (SXT) were tested for each of the isolates. MICs were determined by broth microdilution using a 96-well microtiter plate (Sensititre, Thermo Fisher Scientific Ine, West Sussex, United Kingdom) according to the recommendations of the Clinical and Laboratory Standards Institute. E. coli ATCC 25922 was used as the control strain for susceptibility studies.

Pulsed-field gel electrophoresis (PFGE)

The isolates were analyzed by PFGE following digestion with NotI to generate DNA fingerprinting profiles according to the procedures developed by the CDC PulseNet program [10]. Salmonella enterica serotype Braenderup H9812 was used as the molecular size marker. PFGE patterns were interpreted using BioNumerics (Version 6.0) software (Applied Maths, Sint-Martens-Latem, Belgium). A tree indicating relative genetic similarity was constructed based on the unweighted pair group method of averages (UPGMA) and a position tolerance of 1.2%.

PCR amplification of the antibiotic-resistance determinants and integrons

PCR assays were carried out as described previously [11-16] to detect ESBL genes (bla SHV, bla TEM, bla OXA, and bla CTX-M) and ampC genes (bla MOX, bla FOX, bla MIR(ACT-1), bla DHA, bla CIT and bla ACC) which are responsible for resistance to cephalosporins. We also amplified the variable regions of class 1 and 2 integrons using primers listed in Table 1. The reverse primers aadA1, aadA2, aadA5, and cmlA1 were used with forward primer hep58 to amplify the gene cassettes of class 1 integron-positive strains. Forward primer hep74 and reverse primer hep51 were used to amplify the gene cassettes of class 2 integron-positive strains. Resultant PCR products were fully sequenced and analyzed by comparison with sequences in GenBank.
Table 1

Primers for detection of antibiotic-resistance determinants and integrons.

TargetPrimer sequence (5′ to 3′)Reference
β-lactamases (bp)
bla CTX-M-1 group (873 bp)F: GGTTAAAAAATCACTGCGTC Matar et al. [15]
R: TTACAAACCGTCGGTGACGA Matar et al. [15]
bla CTX-M-9 group (868 bp)F: AGAGTGCAACGGATGATG Matar et al. [15]
R: CCAGTTACAGCCCTTCGG Matar et al. [15]
bla CTX-M-2/8/25 group (221 bp)F: ACCGAGCCSACGCTCAA This study
R: CCGCTGCCGGTTTTATC This study
bla TEM (1080 bp)F: ATGAGTATTCAACATTTCCG Tariq et al. [11]
R: CCAATGCTTAATCAGTGAGG Tariq et al. [11]
bla OXA (890 bp)F: ATTAAGCCCTTTACCAAACCA Ahmed et al. [12]
R: AAGGGTTGGGCGATTTTGCCA Ahmed et al. [12]
bla MOX (520 bp)F: GCTGCTCAAGGAGCACAGGAT F. Javier et al. [16]
R: CACATTGACATAGGTGTGGTGC F. Javier et al. [16]
bla FOX (190 bp)F: AACATGGGGTATCAGGGAGATG F. Javier et al. [16]
R: CAAAGCGCGTAACCGGATTGG F. Javier et al. [16]
bla MIR(ACT-1) (302 bp)F: TCGGTAAAGCCGATGTTGCGG F. Javier et al. [16]
R: CTTCCACTGCGGCTGCCAGTT F. Javier et al. [16]
bla DHA (405 bp)F: AACTTTCACAGGTGTGCTGGGT F. Javier et al. [16]
R: CCGTACGCATACTGGCTTTGC F. Javier et al. [16]
bla CIT (462 bp)F: TGGCCAGAACTGACAGGCAAA F. Javier et al. [16]
R: TTTCTCCTGAACGTGGCTGGC F. Javier et al. [16]
bla ACC (346 bp)F: AACAGCCTCAGCAGCCGGTTA F. Javier et al. [16]
R: TTCGCCGCAATCATCCCTAGC F. Javier et al. [16]
Integrons
IntI1 (569 bp)F: ACATGTGATGGCGACGCACGA Pan et al. [14]
R: ATTTCTGTCCTGGCTGGCGA Pan et al. [14]
Class 1 integron variable regionhep58: TCATGGCTTGTTATGACTGT This study
hep59: GTAGGGCTTATTATGCACGC This study
Class 1 integron variable regionhep58: TCATGGCTTGTTATGACTGT This study
aadA1: TGTCAGCAAGATAGCCAGAT This study
Class 1 integron variable regionhep58: TCATGGCTTGTTATGACTGT This study
aadA2: TGATCTCGCCTTTCACAAA This study
Class 1 integron variable regionhep58: TCATGGCTTGTTATGACTGT This study
aadA5: CATCTAACGCATAGTTGAGC This study
Class 1 integron variable regionhep58: TCATGGCTTGTTATGACTGT This study
cmlA1: CAACGATTGGGATTTGACGTACTTT This study
IntI2 (789 bp)F: CACGGATATGCGACAAAAAGGT This study
R: GTAGCAAACGAGTGACGAAATG This study
Class 2 integron variable regionhep74: CGGGATCCCGGACGGCATGCACGATTTGTA This study
hep51: GATGCCATCGCAAGTACGAG This study

Results

Bacterial isolation and biochemical characterization

We isolated and identified 40 S. flexneri 1b isolates from patients with either diarrhea or dysentery over the period from 2005 to 2013. The strain information is detailed in Table 2. Among them, 28 isolates were collected from Xinjiang from 2005–2012, 11 from Yunnan in 2009, and one from Shanghai in 2013. All S. flexneri serotype 1b strains examined possessed typical S. flexneri biochemical characteristics, and analysis of biochemical reactions indicated the presence of four biotypes among these serotype 1b strains (Table 3).
Table 2

Strain information of S. flexneri serotype 1b isolates from diarrheal patients.

Original NoSpeciesSerotypeSourceOriginIsolation time
SH13sh024 S. flexneri 1bHumanShanghai2013
2005126 S. flexneri 1bHumanXinjiang2005
2005173 S. flexneri 1bHumanXinjiang2005
2006230 S. flexneri 1bHumanXinjiang2006
2008026 S. flexneri 1bHumanXinjiang2008
2008046 S. flexneri 1bHumanXinjiang2008
2008076 S. flexneri 1bHumanXinjiang2008
2009158 S. flexneri 1bHumanXinjiang2009
2009378 S. flexneri 1bHumanXinjiang2009
2010026 S. flexneri 1bHumanXinjiang2010
2010144 S. flexneri 1bHumanXinjiang2010
2010230 S. flexneri 1bHumanXinjiang2010
2010236 S. flexneri 1bHumanXinjiang2010
2010294 S. flexneri 1bHumanXinjiang2010
2010297 S. flexneri 1bHumanXinjiang2010
2010315 S. flexneri 1bHumanXinjiang2010
2011032 S. flexneri 1bHumanXinjiang2011
2011033 S. flexneri 1bHumanXinjiang2011
2011052 S. flexneri 1bHumanXinjiang2011
2011065 S. flexneri 1bHumanXinjiang2011
20110163 S. flexneri 1bHumanXinjiang2011
20110176 S. flexneri 1bHumanXinjiang2011
20110187 S. flexneri 1bHumanXinjiang2011
2012059 S. flexneri 1bHumanXinjiang2012
2012061 S. flexneri 1bHumanXinjiang2012
2012063 S. flexneri 1bHumanXinjiang2012
2012073 S. flexneri 1bHumanXinjiang2012
2012133 S. flexneri 1bHumanXinjiang2012
2012147 S. flexneri 1bHumanXinjiang2012
CDSF2 S. flexneri 1bHumanYunnan2009
CDSF3 S. flexneri 1bHumanYunnan2009
CDSF4 S. flexneri 1bHumanYunnan2009
CDSF5 S. flexneri 1bHumanYunnan2009
CDSF6 S. flexneri 1bHumanYunnan2009
CDSF7 S. flexneri 1bHumanYunnan2009
CDSF8 S. flexneri 1bHumanYunnan2009
CDSF9 S. flexneri 1bHumanYunnan2009
CDSF10 S. flexneri 1bHumanYunnan2009
CDSF11 S. flexneri 1bHumanYunnan2009
CDSF12 S. flexneri 1bHumanYunnan2009
Table 3

Biochemical patterns of S. flexneri serotype 1b strains.

BiotypeTotal No. % (n = 40)Xinjiang No. % (n = 28)Yunnan No. % (n = 11)Shanghai No. % (n = 1)
B14 (10%)3 (10.7%)01 (100%)
B220 (50%)20 (71%)00
B32 (5%)2 (7%)00
B414 (35%)3 (10.7%)11 (100%)0

Biotype B1: mannose-, glucose-, and melibiose-positive; biotype B2: mannose-, glucose-, arabinose-, and melibiose-positive; biotype B3: mannose-, glucose-, and sucrose-positive; biotype B4: mannose-, glucose-, and arabinose-positive.

Biotype B1: mannose-, glucose-, and melibiose-positive; biotype B2: mannose-, glucose-, arabinose-, and melibiose-positive; biotype B3: mannose-, glucose-, and sucrose-positive; biotype B4: mannose-, glucose-, and arabinose-positive. The 40 S. flexneri 1b isolates were tested for susceptibility to 21 antimicrobials (Table 4). Resistance to TIC or AMP was the most common (36/40, 90%), followed by TE (35/40, 87.5%), C (33/40, 82.5%), SXT (20/40, 50%), PIP (16/40, 40%), TIM (12/40, 30%), and ATM (1/40, 2.5%). None of the isolates were resistant to NIT, IPM, FEP, FOX, AK, TO, or GEN. In addition, strains with intermediate resistance to TIM, ATM, and PIP were also observed.
Table 4

Comparison of susceptibility to 21 antibiotics among S. flexneri 1b isolates from different regions.

Antimicrobial resistance rate No. (%)
AntibioticTotal (n = 40)Xinjiang (n = 28)Yunnan (n = 11)Shanghai No. %(n = 1)
CAZ1 (2.5%)001 (100%)
CRO14 (35%)3 (10.7%)11 (100%)0
PIP16 (40%)4 (14%)11 (100%)1 (100%)
TE36 (90%)24 (85.7%)11 (100%)1 (100%)
CFP14 (35%)3 (10.7%)11 (100%)0
CFZ14 (35%)3 (10.7%)11 (100%)0
TIC35 (87.5%)24 (85.7%)11 (100%)0
TIM12 (30%)1 (3.6%)11 (100%)0
ATM1 (2.5%)001 (100%)
AMP36 (90%)24 (85.7%)11 (100%)1 (100%)
C34 (85%)22 (78.5%)11 (100%)0
SXT20 (50%)9(32.1%)11 (100%)0
LEV0000
FEP0000
IPM0000
NIT0000
FOX0000
TO0000
GEN0000
NOR0000
AK0000
Multidrug resistance (MDR; resistant to three or more classes of antimicrobials) was detected in 85% of the S. flexneri 1b isolates, and these isolates had diverse antibiotic-resistance profiles. About 78% of the isolates from Xinjiang were MDR isolates, dominated by resistance to AMP/TIC/TE/C (10/28, 35.7%), followed by AMP/TIC/TE/C/SXT (7/28, 25%), and CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM (3/28, 10.7%). All of the isolates from Yunnan presented the same resistance pattern, CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT, and the single strain from Shanghai exhibited a resistance profile of CAZ/CFP/CRO/CFZ/PIP/AMP/TIC/ATM (Table 5).
Table 5

Dominant antimicrobial resistance profiles of 40 S. flexneri 1b isolates from different regions of China.

Antimicrobial resistance profilesTotalXinjiangSichuan
No. % (n = 40)No. % (n = 28)No. % (n = 11)
Sensitive (n = 2)2 (5%)2 (7%)0
TE (n = 2)2 (5%)2 (7%)0
AMP/TIC (n = 1)1 (2.5%)1 (3.6%)0
AMP/TIC/C (n = 1)1 (2.5%)1 (3.6%)0
AMP/TIC/TE/C (n = 10)10 (25%)10 (35.7%)0
AMP/TIC/TE/C/SXT (n = 7)7 (17.5%)7 (25%)0
PIP/AMP/TIC/TE/SXT (n = 1)1 (2.5%)1 (3.6%)0
AMP/TIC/TE/C/TIM/SXT (n = 1)1 (2.5%)1 (3.6%)0
CAZ/CFP/CRO/CFZ/PIP/AMP/TIC/ATM (n = 1)1 (2.5%)00
CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM (n = 3)3 (7.5%)3 (10.7%)0
CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT (n = 11)11 (27.5%)011 (100%)

Molecular analysis of antibiotic-resistance determinants and integrons

In this study, fifteen isolates were found to be resistant to cephalosporin antibiotics, and these strains were tested for antibiotic-resistance determinants and integrons, including the bla SHV, bla TEM, bla OXA, bla CTX-M, bla MOX, bla FOX, bla MIR(ACT-1), bla DHA, bla CIT, bla ACC, intI1, and intI2 gene regions (Table 6). PCR results showed that all 15 tested isolates were negative for bla SHV, bla MOX, bla FOX, bla MIR(ACT-1), bla DHA, bla CIT, bla ACC, but positive for bla TEM, bla OXA, bla CTX-M, intI1, and intI2 gene regions. Sequencing results of the bla TEM showed 100% identity with bla TEM-1. All isolates harbored bla OXA-1, except the only one isolate from Shanghai. Thirteen isolates harbored bla CTX-M-14; the only one strain from Shanghai contained bla CTX-M-79. Notably, one isolate, collected from Xinjiang, simultaneously harbored both bla CTX-M-28 and bla CTX-M-14. All isolates, except for the Shanghai isolate, contained class 1 integrons, among which, three strains from Xinjiang and two strains from Yunnan harbored both the bla OXA-30 and aadA1 gene cassettes. The bla OXA-30 and bla OXA-1 genes, which are contained on the Tn1409 and Tn2603 transposons respectively, differed by only a single nucleotide [17]. All 15 isolates harbored class 2 integrons with dfrA1, sat1, and aadA1 gene cassettes.
Table 6

Antibiogram and molecular analysis of the antibiotic-resistance determinants and integrons of 15 cephalosporin resistant isolates.

Strain no.AntibiogramAntibiotic-resistant determinants and integrons present
SH13sh024CAZ/CFP/CRO/CFZ/PIP/AMP/TIC/ATM IntI2 (dfrA1+sat1+aadA1), bla TEM-1, blactx-M-79
2010294CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM IntI1 (bla OXA-30 +aadA1), IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
2010297CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM IntI1 (bla OXA-30 +aadA1), IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14 and 28
2010315CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM IntI1 (bla OXA-30 +aadA1), IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF2CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF3CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF4CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1 (bla OXA-30 +aadA1), IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF5CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla TEM-1, bla CTX-M-14
CDSF6CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla TEM-1, bla CTX-M-14
CDSF7CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF8CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF9CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF10CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1 (bla OXA-30 +aadA1), IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF11CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14
CDSF12CFP/CRO/CFZ/PIP/AMP/TIC/TE/C/TIM/SXT IntI1, IntI2 (dfrA1+sat1+aadA1), bla OXA-1, bla TEM-1, bla CTX-M-14

PFGE analysis

PFGE was performed to determine the genetic diversity of the S. flexneri 1b isolates. The 40 S. flexneri 1b isolates generated 18 PFGE patterns (Fig 1). All isolates could be divided into five main groups (A–E), with approximately 82% similarity. Notably, there was a high level of variation in the PFGE profiles of serotype 1b isolates between different regions of China, which contrasted with a previous study showing that 70 S. flexneri 1b strains isolated in Bangladesh shared the same PFGE profile [7]. In the present study, isolates from Xinjiang belonged to groups A, D, and E, whereas isolates from Yunnan and Shanghai belonged to groups B and C, respectively. Twenty-eight isolates from Xinjiang showed 14 different PFGE patterns; 26 of the 28 isolates formed a single cluster, with the two remaining isolates forming separate branches. Eleven isolates from Yunnan showed three different PFGE patterns, and the single isolate from Shanghai displayed a distinct PFGE pattern. Interestingly, the PFGE patterns of Xinjiang isolates were distinct from Yunnan and Shanghai isolates by one obvious, large, missing band indicated with a red border in Fig 1.
Fig 1

PFGE dendrogram and antibiotic resistance profile of 40 S. flexneri 1b isolates.

The original number, origin, and isolation year are indicated for each strain. The missing band of Xinjiang isolates was indicated with a red border and 15 cephalosporin resistant isolates were marked with triangles. Among the isolates in different PFGE clusters, the prevalence of antibiotic resistance in clusters A, D, and E (Xinjiang) was much lower than that of isolates in cluster B (Yunnan). All 15 cephalosporin resistant isolates (marked with triangles in Fig 1) belonged to clusters B (Yunnan), C (Shanghai), and a small branch of cluster A (Xinjiang). All isolates in cluster B were resistant to cephalosporins, such as CFP, CRO, and CFZ, while the resistance rate of isolates in clusters A, D, and E (Xinjiang) to these antibiotics was 10.7%. Higher resistance rates to SXT, PIP, AMP, TIC, TE, C, and TIM were also observed in isolates from Xinjiang than in those from Yunnan. The isolate in cluster C (Shanghai) was the only isolate showing resistance to CAZ and ATM. In summary, similarities in resistance patterns were observed in strains with the same PFGE pattern.

Discussion

Approximately 85% of the strains in our study showed MDR profiles, and were highly resistant to the older-generation antimicrobials, such as AMP, C, TE, and TIC. So the treatment should be based on susceptibility patterns and antimicrobials with current resistance may turn to be effective in the future. This rapid accumulation of resistance in Shigella is probably the result of inappropriate prescription of, and easy access to, antimicrobials among outpatients in China [18]. Besides, the PFGE dendrogram showed that the S. flexneri type 1b isolates from Yunnan are closely related (95% similarity), indicating that they are possibly derived from a common parental strain. In contrast, the isolates from Xinjiang shared lower degrees of similarity, suggesting that they are likely derived from divergent sources. The antibiotic susceptibility profiles of the isolates also varied between the geographical locations; the antimicrobial resistance situation in Xinjiang does not seem to be as serious as that in Yunnan and Shanghai. Among the 40 isolates, only the isolate from Shanghai was resistant to CAZ and ATM, and isolates from Yunnan were more resistant to antibiotics CFP, CRO, CFZ, PIP, AMP, TIC, TE, C, TIM, and SXT than those from Xinjiang and Shanghai. The diverse antibiotic susceptibility may be attributed to the fact that mainland China covers a large territory and has many nationalities, with more than 1.3 billion people living in diverse areas, hence many varying factors such as customs, climates, economies, geographies may affect the antimicrobial susceptibility patterns. In the present study, all 15 cephalosporin resistant isolates harbored bla CTX-M genes, most of which were bla CTX-M-14, followed by bla CTX-M-79, and bla CTX-M-28. A previous study indicated that plasmids carrying different bla CTX-M genes were introduced into isolates at different times [18]. The bla CTX-M-14 subtype was identified in 14 of these isolates, which indicated that these genes might have been circulating among Shigella isolates for a long time. In addition, bla TEM was detected in all 15 cephalosporin resistant isolates, and bla OXA was amplified in all such isolates, except the isolate from Shanghai. OXA-type β-lactamases are characterized by high hydrolytic activity against cloxacillin and oxacillin, which confer resistance to cephalothin and ampicillin [19]. Notably, all bla OXA isolates in this study carried bla OXA-1, suggesting a host specificity for this subtype in S. flexneri, which is consistent with a previous study by Siu et al. [17]. bla OXA-30 and aadA1 were also detected in the gene cassettes of class 1 integrons in five of the 15 cephalosporin resistant isolates in our study. These two gene cassettes appear to be coordinately excised or integrated, as described by a previous study [3]. Pan et al. reported that class 2 integrons were present in 87.9% of S. flexneri isolates [14]. In our study, all of the 15 strains examined harbored class 2 integrons, which followed the dfrA1+sat1+aadA1 gene cassette, conferring resistance to trimethoprim and streptomycin [20]. All of these various resistance genes facilitate the dissemination of resistance determinants and the survival of bacteria under the selective pressure of various antibiotics. Fluoroquinolones and third-generation cephalosporins were two popular empirical options to treat severe gastrointestinal infections caused by pathogenic bacteria [21]. Ciprofloxacin is currently the first-line antibiotic recommended by the World Health Organization for treating shigellosis [22]. Fortunately, limited resistance to fluoroquinolones was observed in our study. The control of resistance to quinolones could be attributed to a relevant study on quinolone-induced cartilage toxicity [23]. Third-generation cephalosporins are considered alternative drugs for shigellosis treatment [22], but in our study, the isolates from Yunnan and Shanghai were all resistant to CFP, CRO, and CFZ, and the rate of resistance of isolates from Xinjiang to these cephalosporins was 10.7%. According to the literature, strains may acquire resistance to multiple antibiotics if exposed to a resistant gastrointestinal pathogen following antibiotic therapy [24]. Therefore, these ESBL-producing isolates, especially those from Yunnan and Shanghai, would put patients at high risk if third-generation cephalosporins were still used for empirical therapy. Moreover, the isolate from Shanghai also exhibited resistance to ATM and CAZ, which clearly raises the perennial issue of strict control of antimicrobial prescription in China. In the present study, diverse antimicrobial resistance patterns were observed in different endemic areas, which support the need for prudent selection and use of antibiotics. Therefore, we suggest that antibiotic susceptibility testing should be performed at the start of an outbreak, and antibiotic use should be restricted to severe Shigella cases, based on variations in resistance patterns in different regions. Furthermore, resistance patterns should be recorded timely and locally, and empiric antibiotic therapy for Shigella cases should be changed accordingly. The data that we obtained here might provide a strategy for the treatment of infections caused by S. flexneri serotype 1b strains in China.
  22 in total

1.  Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR.

Authors:  F Javier Pérez-Pérez; Nancy D Hanson
Journal:  J Clin Microbiol       Date:  2002-06       Impact factor: 5.948

2.  Molecular characteristics of class 1 and class 2 integrons and their relationships to antibiotic resistance in clinical isolates of Shigella sonnei and Shigella flexneri.

Authors:  Jing-Cao Pan; Rong Ye; Dong-Mei Meng; Wei Zhang; Hao-Qiu Wang; Ke-Zhou Liu
Journal:  J Antimicrob Chemother       Date:  2006-06-09       Impact factor: 5.790

3.  Epidemiology and genetic characterization of Shigella flexneri strains isolated from three paediatric populations in Egypt (2000-2004).

Authors:  S F Ahmed; M S Riddle; T F Wierzba; I Abdel Messih; M R Monteville; J W Sanders; J D Klena
Journal:  Epidemiol Infect       Date:  2006-05-11       Impact factor: 2.451

4.  Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet.

Authors:  Efrain M Ribot; M A Fair; R Gautom; D N Cameron; S B Hunter; B Swaminathan; Timothy J Barrett
Journal:  Foodborne Pathog Dis       Date:  2006       Impact factor: 3.171

Review 5.  Epidemiology and molecular mechanism of integron-mediated antibiotic resistance in Shigella.

Authors:  Xing Ke; Bing Gu; Shiyang Pan; Mingqing Tong
Journal:  Arch Microbiol       Date:  2011-08-14       Impact factor: 2.552

6.  Global burden of Shigella infections: implications for vaccine development and implementation of control strategies.

Authors:  K L Kotloff; J P Winickoff; B Ivanoff; J D Clemens; D L Swerdlow; P J Sansonetti; G K Adak; M M Levine
Journal:  Bull World Health Organ       Date:  1999       Impact factor: 9.408

7.  Molecular profiling of antimicrobial resistance and integron association of multidrug-resistant clinical isolates of Shigella species from Faisalabad, Pakistan.

Authors:  Aaysha Tariq; Abdul Haque; Aamir Ali; Saira Bashir; Muhammad Asif Habeeb; Muhammad Salman; Yasra Sarwar
Journal:  Can J Microbiol       Date:  2012-08-20       Impact factor: 2.419

Review 8.  Fluoroquinolone antibiotics in infants and children.

Authors:  Urs B Schaad
Journal:  Infect Dis Clin North Am       Date:  2005-09       Impact factor: 5.982

Review 9.  Antimicrobial resistance among enteric pathogens.

Authors:  Larry K Pickering
Journal:  Semin Pediatr Infect Dis       Date:  2004-04

10.  Identification and characterization of a novel Shigella flexneri serotype Yv in China.

Authors:  Qiangzheng Sun; Ruiting Lan; Jianping Wang; Shengli Xia; Yiting Wang; Yan Wang; Dong Jin; Bo Yu; Yuriy A Knirel; Jianguo Xu
Journal:  PLoS One       Date:  2013-07-30       Impact factor: 3.240

View more
  11 in total

Review 1.  Shigella flexneri: an emerging pathogen.

Authors:  Iqbal Nisa; Muhammad Qasim; Nusrat Yasin; Rafi Ullah; Anwar Ali
Journal:  Folia Microbiol (Praha)       Date:  2020-02-05       Impact factor: 2.099

2.  Antibiofilm Activity of Lactobacillus plantarum 12 Exopolysaccharides against Shigella flexneri.

Authors:  Yinglong Song; Mengying Sun; Lu Feng; Xue Liang; Xing Song; Guangqing Mu; Yanfeng Tuo; Shujuan Jiang; Fang Qian
Journal:  Appl Environ Microbiol       Date:  2020-07-20       Impact factor: 4.792

3.  Molecular characterization of antimicrobial resistance in clinical Shigella isolates during 2014 and 2015: trends in South India.

Authors:  Shalini Anandan; Dhiviya Prabaa Muthuirulandi Sethuvel; Revathi Gajendiren; Valsan Philip Verghese; Kamini Walia; Balaji Veeraraghavan
Journal:  Germs       Date:  2017-09-01

4.  A Waterborne Outbreak of Shigella sonnei with Resistance to Azithromycin and Third-Generation Cephalosporins in China in 2015.

Authors:  Qiuxia Ma; Xuebin Xu; Ming Luo; Jian Wang; Chaojie Yang; Xiaofeng Hu; Beibei Liang; Fuli Wu; Xiaoxia Yang; Jinyan Wang; Hongbo Liu; Wen Li; Yu Zhong; Peng Li; Jing Xie; Leili Jia; Ligui Wang; Rongzhang Hao; Xinying Du; Shaofu Qiu; Hongbin Song; Yansong Sun
Journal:  Antimicrob Agents Chemother       Date:  2017-05-24       Impact factor: 5.191

5.  Antimicrobial Resistance of Shigella flexneri in Pakistani Pediatric Population Reveals an Increased Trend of Third-Generation Cephalosporin Resistance.

Authors:  Iqbal Nisa; Mohammad Haroon; Arnold Driessen; Jeroen Nijland; Hazir Rahman; Nusrat Yasin; Mubashir Hussain; Taj Ali Khan; Amjad Ali; Saeed Ahmad Khan; Muhammad Qasim
Journal:  Curr Microbiol       Date:  2022-02-27       Impact factor: 2.188

6.  Novel mutations in quinolone resistance-determining regions of gyrA, gyrB, parC and parE in Shigella flexneri clinical isolates from eastern Chinese populations between 2001 and 2011.

Authors:  T Qin; R Bi; W Fan; H Kang; P Ma; B Gu
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2016-09-12       Impact factor: 3.267

7.  Epidemic characterization and molecular genotyping of Shigella flexneri isolated from calves with diarrhea in Northwest China.

Authors:  Zhen Zhu; Mingze Cao; Xuzheng Zhou; Bing Li; Jiyu Zhang
Journal:  Antimicrob Resist Infect Control       Date:  2017-09-06       Impact factor: 4.887

8.  Antimicrobial resistance and genetic characterization of Shigella spp. in Shanxi Province, China, during 2006-2016.

Authors:  Yang Wang; Qiuxia Ma; Ruie Hao; Qiuxiang Zhang; Suxia Yao; Jiting Han; Binzhi Ren; Ting Fan; Limin Chen; Xuebin Xu; Shaofu Qiu; Hongxia Yang
Journal:  BMC Microbiol       Date:  2019-05-29       Impact factor: 3.605

9.  Genotypic Diversity of Multidrug Resistant Shigella species from Iran.

Authors:  Sajjad Zamanlou; Mohammad Ahangarzadeh Rezaee; Mohammad Aghazadeh; Reza Ghotaslou; Hossein Hosseini Nave; Younes Khalili
Journal:  Infect Chemother       Date:  2018-03

10.  Dominant serotype distribution and antimicrobial resistance profile of Shigella spp. in Xinjiang, China.

Authors:  Hongbo Liu; Binghua Zhu; Shaofu Qiu; Yidan Xia; Beibei Liang; Chaojie Yang; Nian Dong; Yongrui Li; Ying Xiang; Shan Wang; Jing Xie; Muti Mahe; Yansong Sun; Hongbin Song
Journal:  PLoS One       Date:  2018-04-03       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.