Increase in resistance to extended-spectrum cephalosporins in Salmonella isolated from retail chicken products in Japan.

Extended-spectrum β-lactamase (ESBL)-producing Salmonella are one of the most important public health problems in developed countries. ESBL-producing Salmonella strains have been isolated from humans in Asian countries neighboring Japan, along with strains harboring the plasmid-mediated extended-spectrum cephalosporin (ESC)-resistance gene, ampC (pAmpC). However, only a few studies have investigated the prevalence of ESC-resistant Salmonella in chicken products in Japan, which are the main vehicle of Salmonella transmission. The aim of this study was to investigate the prevalence of ESBL-producing, pAmpC-harboring, or carbapenem-resistant Salmonella in chicken products in Japan. In total, 355 out of 779 (45.6%) chicken product samples collected from 1996-2010 contained Salmonella, resulting in 378 distinct isolates. Of these isolates, 373 were tested for resistance to ESCs, cephamycins, or carbapenems. Isolates that showed resistance to one or more of these antimicrobials were then examined by PCR and DNA sequence analysis for the presence of the bla(CMY), bla(CTX-M), bla(TEM), and bla(SHV) resistance genes. Thirty-five resistant isolates were detected, including 26 isolates that contained pAmpC (bla(CMY-2)), and nine ESBL-producing isolates harboring bla(CTX-M) (n = 4, consisting of two bla(CTX-M-2) and two bla(CTX-M-15 genes)), bla(TEM) (n = 4, consisting of one bla(TEM-20) and three bla(TEM-52) genes), and bla(SHV) (n = 1, bla(SHV-12)). All pAmpC-harboring and ESBL-producing Salmonella isolates were obtained from samples collected after 2005, and the percentage of resistant isolates increased significantly from 0% in 2004 to 27.9% in 2010 (P for trend = 0.006). This increase was caused in part by an increase in the number of Salmonella enterica subsp. enterica serovar Infantis strains harboring an approximately 280-kb plasmid containing bla(CMY-2) in proximity to ISEcp1. The dissemination of ESC-resistant Salmonella containing plasmid-mediated bla(CMY-2) in chicken products indicates the need for the development of continuous monitoring strategies in the interests of public health.

Introduction

Salmonella infection remains a significant public health concern worldwide. In many countries, the incidence of human infections caused by extended-spectrum cephalosporin (ESC)-resistant Salmonella has increased dramatically [1,2]. ESCs are administrated to treat salmonellosis caused by fluoroquinolone-resistant Salmonella, or in children and infants [3,4]. However, ESC-resistance genes such as bla CTX-M, bla TEM, and bla SHV, which contribute to extended-spectrum β-lactamase (ESBL) production, have been detected in Salmonella isolated from humans in Asian countries neighboring Japan [5,6]. Some of these isolates also contain plasmid-mediated ampC (pAmpC), another ESC-resistance gene [7]. In Japan, ESC-resistant Salmonella containing pAmpC or ESBL genes, such as bla CTX-M-14 and bla CTX-M-15, have been isolated from humans [8,9].

ESC-resistant Salmonella have also been isolated from food-producing animals and their products in many countries [10,11]. Reports from Japan over the last decade show that these isolates are especially prevalent in chickens [12]. Moreover, ESBL genes such as bla CMY, bla CTX-M, bla TEM, and bla SHV have been detected in Salmonella from food-producing-animal products in other Asian countries, and throughout the rest of the world [11,13]. In Japan, however, only a few studies have investigated the prevalence of ESC-resistant Salmonella in chicken products [14,15].

Because of the public health importance of these resistant salmonellae, it is imperative to determine their prevalence in chicken products in Japan. Therefore, the aim of this study was to investigate the prevalence of β-lactam antibiotic (cephalosporins or carbapenems) resistance in Salmonella from chicken products in Japan using molecular detection of ESBL genes and pAmpC.

Materials and Methods

Isolates and sampling

A total of 779 chicken product samples were collected, consisting of chicken meat (n = 683), giblets (n = 72), and processed chicken (tataki, thin slices of raw chicken with a minimally seared surface, n = 24). Of these samples, 622 samples originated from Japanese farms, and animals were slaughtered in Japan, 145 samples were from unrecorded origins, and 12 samples came from animals reared and slaughtered outside of Japan (11 samples were imported from Brazil, and one sample was from an unrecorded origin). All samples apart from two (described below) were collected in Fukuoka Prefecture, Japan, from 1996–2010. A total of 554 of the 779 samples were randomly collected from 282 retail outlets, including supermarkets and butcher shops, by Fukuoka prefectural food hygiene inspectors. A further 225 samples were randomly collected from 42 retail outlets by the authors from 2008–2010. Two of the 225 samples were collected in 2008 from two retail outlets in Nagasaki Prefecture, which neighbors Fukuoka Prefecture, while the remaining 223 samples were collected from 40 retail outlets in Fukuoka Prefecture, Japan.

The bacterial isolation method used for samples collected from 1996–1998 has been reported previously [16]. Isolations carried out from 1999–2010 were conducted in accordance with the method for isolating bacteria from meat samples described in our previous report [17], except for 85 samples collected in 2008. Salmonella isolation was carried out from these 85 samples using a previously described method [16] with a minor modification, as follows: Rappaport-Vassiliadis enrichment broth (Oxoid Ltd., Hampshire, UK) was used for the isolations, along with mannitol, lysine, crystal violet, brilliant green agar (Oxoid Ltd.) and Rimler-Shotts-Maeda agar (Kanto Chemical Co., Tokyo, Japan). The overall incidence of Salmonella isolation from the samples was 45.6% (355/779) (Table 1), with isolation rates of 45.5% (311/683), 54.2% (39/72), and 20.8% (5/24) from the chicken meat, giblets, and processed chicken samples, respectively. All salmonellae were isolated at the Fukuoka Institute of Health and Environmental Sciences, except for 52 isolates that were obtained from Nakamura Gakuen University Junior College in Fukuoka Prefecture. All the isolates were serotyped using somatic antisera and flagella antisera (Denka Seiken Co., Tokyo, Japan), as previously described [16].

Table 1

Number of tested chicken meat product samples, detected Salmonella isolates, resistant isolates, and resistance genes by year.

Isolation year	1996	1997	1998	1999	2000	2001	2002	2003
No. of samples tested	41	21	34	34	35	36	33	39
No. of Salmonella-positive samples	16	9	6	4	20	16	14	21
(%)	(39.0%)	(42.9%)	(17.6%)	(11.8%)	(57.1%)	(44.4%)	(42.4%)	(53.8%)
No. of Salmonella isolates	16	12	6	5	20	16	14	21
No. of samples from which multiple Salmonella serotypes were isolated	0	3	0	1	0	0	0	0
Salmonella serotypes isolated, (No. of isolate)	Corvallis (1)*,	Agona (1),	Corvallis (3),	Infantis (3),	Corvallis (1),	Haifa (2),	Infantis (12),	Cerro (1),
	Haifa (1),	Corvallis (1),	Enteritidis (1),	Untypeable with O7 (1),	Infantis (18),	Infantis (8),	Yovokome (1),	Haifa (1),
	Infantis (12),	Haifa (1),	Infantis (1),	Untypeable (1)	Untypeable with O7 (1)	Virchow (2),	Untypeable with O7:y:− (1)	Infantis (14),
	Typhimurium (1),	Infantis (5),	Typhimurium (1)			Untypeable with O18: Z4, Z23: − (3),		Manhattan (2),
	Untypeable with O4:i: (1)	Typhimurium (2),				Untypeable with O7 (1)		Untypeable (3)
		Untypeable with O4:b:− (1),
		Untypeable with O8:z4,z24 (1)
Untested isolates with antimicrobial susceptibility	-	-	-	-	-	-	-	-
No. of tested isolates	16	12	6	5	20	16	14	21
(No. of samples)	(16)	(9)	(6)	(4)	(20)	(16)	(14)	(21)
No. of resistant isolates	0	0	0	0	0	0	0	0
(Percentage of tested isolates)	(0.0%)	(0.0%)	(0.0%)	(0.0%)	(0.0%)	(0.0%)	(0.0%)	(0.0%)
Detected resistance genes and serotypes	-	-	-	-	-	-	-	-
Isolation year	2004	2005	2006	2007	2008	2009	2010	Total
No. of samples tested	35	40	40	40	157	88	106	779
No. of Salmonella-positive samples	13	22	13	22	76	48	55	355
(%)	(37.1%)	(55.0%)	(32.5%)	(55.0%)	(48.4%)	(54.5%)	(51.9%)	(45.6%)
No. of Salmonella isolates	13	25	14	24	81	50	61	378
No. of samples from which multiple Salmonella serotypes were isolated	0	3	1	2	4[†]	2	6	22
Salmonella serotypes isolated, (No. of isolate)	Enteritidis (1),	Enteritidis (1),	Dunkwa (1),	Corvallis (1),	Enteritidis (1),	Enteritidis (1),	Agona (1),	Infantis (180),
	Infantis (9),	Haifa (1),	Infantis (8),	Emek (1),	Eppendorf (2),	Infantis (14),	Infantis (20),	Schwarzengrund (70),
	Manhattan (1),	Corvallis (1),	Manhattan (3),	Enteritidis (1),	Infantis (33),	Manhattan (8),	Manhattan (19),	Manhattan (52),
	Yovokome (1),	Infantis (15),	Schwarzengrund (2)	Eppendorf (1),	Jamaica (1),	Schwarzengrund (21),	Schwarzengrund (18),	Untypeable (11),
	Untypeable (1)	Manhattan (2),		Infantis (8),	Manhattan (15),	Untypeable with O4 (3),	Virchow (1),	Corvallis (8),
		Montevideo (1),		Manhattan (2),	Schwarzengrund (21),	Untypeable (3)	Untypeable with O4 (1),	Enteritidis (6),
		Schwarzengrund (1),		Schwarzengrund (7),	Untypeable with O-untypeable:r:1,5 (3),		Untypeable (1)	Haifa (6),
		Typhimurium (1),		Typhimurium (1),	Unrecorded (5)			Typhimurium (6),
		Untypeable (2)		Untypeable with O4 (1),				Unrecorded (5),
				Untypeable with O7 (1)				and other serotypes[‡]
Untested isolates with antimicrobial susceptibility	-	-	-	-	Unrecorded (5)	-	-	5
No. of tested isolates	13	25	14	24	76	50	61	373
(No. of samples)	(13)	(22)	(13)	(22)	(71)	(48)	(55)	(350)
No. of resistant isolates	0	2	0	1	8	7	17	35
(Percentage of tested isolates)	(0.0%)	(8.0%)	(0.0%)	(4.2%)	(10.5%)	(14.0%)	(27.9%)	(9.4%)
Detected resistance genes and serotypes	-	CMY-2 (Infantis, n = 1) § ,	-	CMY-2 (Infantis, n = 1)	CMY-2 (Infantis, n = 5),	CMY-2 (Infantis, n = 6),	CMY-2 (Infantis, n = 11),	CMY-2 (Infantis, n = 24),
		TEM-20 (Infantis, n = 1)			CMY-2 (O-untypeable:r:1,5, n = 1),	TEM-52 (Manhattan, n = 1)	CMY-2 (Manhattan, n = 1),	CTX-M-15 & TEM-1 (Manhattan, n = 2),
					TEM-52 (Infantis, n = 1),		TEM-52 (Manhattan, n = 1),	TEM-52 (Manhattan, n = 2),
					CTX-M-2 (Manhattan, n = 1)		CTX-M-2 (Infantis, n = 1)	CMY-2 (Manhattan, n = 1),
							CTX-M-15 & TEM-1 (Manhattan, n = 2),	CMY-2 (O-untypeable:r:1,5, n = 1),
							SHV-12 (Manhattan, n = 1)	CTX-M-2 (Infantis, n = 1),
								CTX-M-2 (Manhattan, n = 1),
								SHV-12 (Manhattan, n = 1),
								TEM-20 (Infantis, n = 1),
								TEM-52 (Infantis, n = 1)

*Corvallis, Salmonella enterica subsp. enterica serovar Corvallis.

†One sample contained three serotypes, while other multi-Salmonella samples contained two serotypes.

‡Other serotypes, untypeable with O4 (5), untypeable with O7 (4), Eppendorf (3), untypeable with O18: Z4, Z23: − (3), untypeable with O-untypeable:r:1,5 (3), Virchow (3), Agona (2), Yovokome (2), Cerro (1), Dunkwa (1), Emek (1), Jamaica (1), Montevideo (1), untypeable with O4:b:− (1), untypeable with O4:i: (1), untypeable with O7:y:− (1), anduntypeable with O8:z4,z24 (1).

§CMY-2, bla CMY-2.

A total of 378 distinct Salmonella isolates were collected from 355 of the 779 chicken product samples. Twenty-one and one samples yielded two and three distinct isolates, respectively (Table 1). Of the 378 Salmonella isolates, 186 (49.2%) were isolated over the first 12 years (1996–2007), while the remaining 192 (50.8%) isolates consisted of 81 (21.4%), 50 (13.2%), and 61 (16.1%) isolates collected in 2008, 2009, and 2010, respectively. Of the 378 isolates, 373 (from 350 samples) were examined in the following assays (Table 1). The remaining five isolates were not tested because of damage incurred during the storage process. The tested isolates were obtained from chicken meat (n = 310), giblets (n = 35), and processed chicken (n = 5) that had been collected from 195 different outlets. The susceptibility-tested Salmonella isolates constituted 16 serovars, along with 28 untypeable strains. The dominant serovars were Salmonella enterica subsp. enterica serovar (S.) Infantis (n = 180), S. Schwarzengrund (n = 70), and S. Manhattan (n = 52) (Table 1). The incidences of Salmonella from the samples collected from 1996 to 1997, and those from 85 samples collected in 2008, have been reported previously [16,18].

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [19,20]. The following 11 antimicrobials were used: cefpodoxime (10 μg), cefotaxime (30 μg), ceftazidime (30 μg), cefepime (30 μg), cefoxitin (30 μg), cefmetazole (30 μg), cefotetan (30 μg), moxalactam (30 μg), imipenem (10 μg), meropenem (10 μg), and panipenem (10 μg). Disks containing these antimicrobials were purchased from Becton Dickinson (Franklin Lakes, NJ). Escherichia coli ATCC 25922 was used as a quality control strain in accordance with CLSI guidelines [19,20]. Klebsiella pneumoniae ATCC 700603 and E. coli ATCC 35218 were used as reference strains. We used the CLSI criteria for resistance breakpoints for further resistance gene detection analyses [21], except for panipenem, which we defined in this study (23 mm in diameter). Isolates that were resistant to one or more of these antimicrobials were then examined by PCR to determine the presence of β-lactamase genes (bla CMY, bla CTX-M, bla TEM, and bla SHV), as previously described (Table 2) [22-25]. The resistant isolates with a zone diameter less than or equal to the breakpoints for cefpodoxime, cefotaxime, ceftazidime, or cefepime were also examined to identify ESBL production, using the phenotypic confirmatory test [21] with cefotaxime (30 μg)-clavulanic acid (Becton Dickinson), ceftazidime (30 μg)-clavulanic acid (Becton Dickinson), and cefpodoxime (10 μg)-clavulanic acid (10 μg) (Nissui Pharmaceutical Co., Tokyo, Japan) disks.

Table 2

Sequences of primers used in this study.

bla gene	Purpose	Primer Name	Nucleotide Sequence 5′–3′	Reference
bla CMY	Detection	cmy-F	GACAGCCTCTTTCTCCACA	[22]
		cmy-R	TGGAACGAAGGCTACGTA	[22]
	Sequencing	CMY2-outF	GTTACAATGTGTGAGAAGCAGTC	This study
		CMY2-outR	ATGGGATTTTCCTTGCTGTA	This study
		CMY2-R0	CAGTATTTCGTGACCGGA	This study
		CMY2-F3	CTGGATTACGGTTCCGCA	Thi0073 study
bla CTX-M	Detection and Sequencing	CTX-MU1	ATGTGCAGYACCAGTAARGT	[23]
		CTX-MU2	TGGGTRAARTARGTSACCAGA	[23]
	Sequencing	bla CTX-M-1, forward	CTTCCAGAATAAGGAATCCC	[26]
		bla CTX-M-1, reverse	CGTCTAAGGCGATAAACAAA	[26]
		CTX-outF2	GCCAAGGGATAATACTAATAGAGG	This study
		CTX-outR	GCGGAATGATAGAAAGAGATGAG	This study
		CTX-F2	ACAATACTGCCATGAATAAGCTG	This study
		CTX-R0	CAATCAGCTTATTCATGGCA	This study
bla TEM	Detection	MAb/F	GGGGAGCTCATAAAATTCTTGAAGAC	[24]
		MAb/R	GGGGGATCCTTACCAATGCTTAATCA	[24]
	Sequencing	MAb-F2	AGCCCTCCCGTATCGTAGTT	This study
		MAb-F1	GAGGACCGAAGGAGCTAACC	This study
		MAb-outR	AACTACGATACGGGAGGGCT	This study
bla SHV	Detection	SHV-F	AGGATTGACTGCCTTTTTG	[25]
		SHV-R	ATTTGCTGATTTCGCTCG	[25]
	Sequencing	SHV-forw	CAAAACGCCGGGTTATTC	[27]
		SHV-rev	TTAGCGTTGCCAGTGCT	[27]
		SHVseq-forw	GGATTGACTGCCTTTTTGC	[27]
		SHVseq-rev	GCAAAAAGGCAGTCAATCC	[27]

DNA sequence analysis of resistance genes

Nucleotide sequences of the resistance genes were determined using the DNA sequencing primers listed in Table 2 [26,27]. PCR products were purified using Microcon filters (Millipore Corporation, Bedford, MA) and were sequenced using a BigDye Terminator Cycle Sequencing Reaction v. 3.1 kit (Applied Biosystems, Carlsbad, CA) on a 3500 Genetic Analyzer (Applied Biosystems). The complementary sense and antisense sequences were aligned using the SeqManII program within the Lasergene software package (DNASTAR, Madison, WI). The DNA sequences and deduced amino acid sequences were examined using the BLAST program at the DNA Data Bank of Japan (DDBJ) [28], and the “β-Lactamase Classification and Amino Acid Sequences for TEM, SHV, and OXA Extended-Spectrum and Inhibitor Resistant Enzymes” website [29].

Pulsed-field gel electrophoresis and large plasmid profile analysis

S. Infantis isolates (n = 26), S. Manhattan isolates (n = 7), and one O-untypeable:r:1,5 isolate that were shown to carry resistance genes (bla CMY, bla TEM, bla CTX-M, and/or bla SHV) were further examined using pulsed-field gel electrophoresis (PFGE) profiling and large-plasmid profile (LPP) analysis. To compare isolates with and without resistance genes, S. Infantis isolates (n = 18) and S. Manhattan isolates (n = 18) showing susceptibility to 11 antimicrobials were also examined. Two, three, five, four, and four susceptible S. Infantis isolates were collected in 2006, 2007, 2008, 2009, and 2010, respectively. Of the 18 susceptible S. Manhattan isolates, two, one, two, three, two, two, three, and three were collected in 2003, 2004, 2005, 2006, 2007, 2008, 2009, and 2010, respectively. PFGE using BlnI restriction digestion was conducted as previously described [30]. Similarity and cluster analyses were performed using the Dice coefficients of similarity and an unweighted pair group method with average linkage, respectively, using FPQuest Software (Bio-Rad Laboratories, Hercules, CA). For LPP analysis, total DNA was treated with 2 U/ml of S1 nuclease (incubated at 37°C for 45 min), followed by PFGE separation [30].

Detection of ISEcp1 and other genes related to bla CMY-2

Genetic variation in the regions upstream and downstream of bla CMY-2 was identified by restriction fragment length polymorphism (RFLP) and sequence analysis. Twenty-five bla CMY-2-harboring isolates (23 S. Infantis, one S. Manhattan, and one O-untypeable:r:1,5) were tested. A PCR fragment containing part of bla CMY-2 and its upstream region was generated by PCR using a forward primer located in ISEcp1 (ISEcp1-F: 5′-CTATCCGTACAAGGGAGTGT-3′) [31] and a reverse primer located in bla CMY (cmy-R) (Table 2). A PCR fragment containing part of the bla CMY-2 gene and its downstream region was generated with a forward primer located in bla CMY (cmy-F) (Table 2) and a reverse primer located in sugE (SugE-R: 5′- ATTGCAGGTTTGCTCGAAGT-3′). PCR was conducted using a HotStarTaq Plus Master Mix Kit (Qiagen, Hilden, Germany), and products were digested with MseI (New England BioLabs, Ipswich, MA) at 37°C for 1 h. Digested fragments were separated by electrophoresis on 1% (w/v) agarose gels at 100 V for 30 min. Additionally, the PCR products of three S. Infantis isolates harboring bla CMY-2 (isolates 1993, 2127, and 2150) and one S. Manhattan isolate harboring bla CMY-2 (isolate 2179) were sequenced as described above. These three S. Infantis isolates were chosen for sequence analysis of the ISEcp1 region because they showed the dominant PFGE profiles (PFP) and LPP characteristics.

Localization of bla CMY-2 by Southern blot analysis

To determine whether bla CMY-2 was located in the chromosome or on a plasmid, S1 nuclease (New England BioLabs) and BlnI (Takara Bio, Otsu, Japan) digestions were prepared from the total DNA of the four isolates selected for ISEcp1 analysis (harboring bla CMY-2) (S. Infantis isolates 1993, 2127, and 2150, and S. Manhattan isolate 2179), as well as two susceptible isolates (S. Infantis isolate 1737 and S. Manhattan isolates 2129) for use as bla CMY-2-negative controls. Total DNA was treated with 2 U/ml of S1 nuclease (incubated at 37°C for 45 min) or BlnI (incubated at 37°C for 16 h), followed by PFGE separation [30]. Separated fingerprints were transferred to positively-charged Nylon membranes (Roche Applied Science, Penzberg, Germany) and hybridized with PCR-generated bla CMY-2 digoxigenin-labeled probes (Roche Diagnostics, Basel, Switzerland) using hybridization solution (Roche Diagnostics) according to the manufacturer’s instructions and a previous report [32].

Results

Antimicrobial susceptibility testing, PCR and sequence analysis of bla genes, and extended-spectrum β-lactamase phenotyping

Of the 373 tested isolates, 35 isolates from 31 chicken meat and four giblet samples showed resistance to one or more antimicrobials. These 35 chicken product samples included 27 samples originating from Japanese farms and 8 samples from unrecorded origins. Testing showed that 35 (9.4%), 24 (6.4%), 19 (5.1%), 13 (3.5%), and four (1.1%) isolates were resistant to cefpodoxime, cefoxitin, cefotaxime, ceftazidime, and cefepime, respectively. No isolates were resistant to cefmetazole, cefotetan, moxalactam, imipenem, meropenem, or panipenem. All 35 resistant isolates harbored one or two of the resistance genes tested, with 26 pAmpC (bla CMY-2)-harboring isolates (24 S. Infantis, one S. Manhattan, and one O-untypeable:r:1,5) and nine ESBL-producing isolates, harboring bla CTX-M (n = 4, consisting of two bla CTX-M-2 and two bla CTX-M-15), bla TEM (n = 4, consisting of one bla TEM-20 and three bla TEM-52), and bla SHV (n = 1, bla SHV-12) (Tables 1 and 3). Two of the nine ESBL isolates harbored the non-ESBL gene bla TEM-1 as well as bla CTX-M-15.

Table 3

Antimicrobial-resistance patterns, pulsed-field profiles, and plasmid profiles of resistance genes in Salmonella enterica subsp. enterica serovar (S.) Infantis, S. Manhattan, and Salmonella O-untypeable isolates.

Serovars	Resistance genes detected	Antimicrobial- resistance patterns*	Pulsed-field profiles	Large plasmid profiles	No. of isolates
S. Infantis[†]	bla CMY-2	CPDX-CFX	C	1	6
(n = 45)	(n = 24)		B	1	2
			A	1	1
			E	1	1
			G	1	1
			I	1	1
			Loss[‡]	Loss	1
		CPDX-CTX-CAZ-CFX	C	1	4
			D	1	1
		CPDX-CTX-CFX	C	1	2
			B	1	1
		CPDX-CAZ-CFX	F	1	1
		CPDX-CTX	J	1	1
		CPDX	I	1	1
	bla CTX-M-2	CPDX-CTX-CFPM	K	2	1
	bla TEM-20	CPDX	L	1	1
	bla TEM-52	CPDX-CTX	L	1	1
	−[§] (n = 18)	No resistance detected	H	1	5
	-		H	3	1
	-		L	1	4
	-		N	1	3
	-		P	1	1
	-		P	4	1
	-		I	1	1
	-		M	1	1
	-		Q	1	1
S. Manhattan[†]	bla CMY-2	CPDX-CTX-CAZ-CFX	R	5	1
(n = 25)	bla CTX-M-2	CPDX-CTX-CFPM	R	7	1
	bla CTX-M-15& bla TEM-1	CPDX-CTX-CAZ-CFPM	R	8	2
	bla TEM-52	CPDX-CTX-CAZ	R	6	2
	bla SHV-12	CPDX-CTX-CAZ	R	6	1
	−[§] (n = 18)	No resistance detected	R	6	17
			S	6	1
O-untypeable:r:1,5 (n = 1)	bla CMY-2	CPDX-CTX-CAZ-CFX	E	1	1

*Determined with CPDX, cefpodoxime; CTX, cefotaxime; CAZ, ceftazidime; CFPM, cefepime; CFX, cefoxitin; CTT, cefotetan; CMZ, cefmetazole; MOX, moxalactam; IPM, imipenem; MEPM, meropenem; and PAPM, panipenem.

† S. Infantis, Salmonella enterica subsp. enterica serovar Infantis; S. Manhattan, Salmonella enterica subsp. enterica serovar Manhattan.

‡Loss, an isolate that lost resistance during storage.

§These isolates were susceptible to all antimicrobial agents tested.

An analysis of the most common resistance genes harbored by each of the serotypes showed that S. Infantis with bla CMY-2 (n = 24) was the most common serotype/resistance gene combination. No other combination occurred in more than two isolates (Table 1, 3). Of the 26 isolates harboring bla CMY-2, 24 showed resistance to cefoxitin and two showed intermediate sensitivity to cefoxitin (15–17 mm), based on the CLSI criteria [21]. All 26 isolates harboring bla CMY-2 were susceptible to other cephamycins (cefmetazole, cefotetan, and moxalactam). Furthermore, six isolates harboring only bla CMY-2, which does not contribute to ESBL production, also showed ESBL phenotypes when tested with cefpodoxime-clavulanic acid (n = 5) or ceftazidime-clavulanic acid disks (n = 1).

Chicken product isolates harboring pAmpC and ESBL genes first appeared in 2005, and the percentage of resistant isolates increased significantly from 0% in 2004 to 27.9% in 2010 (P for trend = 0.006) (Table 1).

Pulsed-field gel electrophoresis and large plasmid analysis

One S. Infantis isolate that harbored bla CMY-2 could not be subtyped by PFGE, LPP, and the following assays because of losses in resistance incurred during storage. Therefore, only 26 of 27 S. Infantis isolates that harbored bla genes (23 bla CMY-2, one bla CTX-M-2, one bla TEM-20, and one bla TEM-52) and 18 S. Infantis isolates showing susceptibility to the antimicrobials were tested (Table 3), along with the O-untypeable:r:1,5 and S. Manhattan isolates. PFPs are shown in Table 3 and Fig. 1. S. Infantis (n = 44) and O-untypeable:r:1,5 isolates (n = 1) generated 16 PFPs (A–Q, except for O), and S. Manhattan (n = 25) generated two PFPs (R and S). S. Infantis isolates carrying bla CMY-2 that were isolated in 2008 (n = 5), 2009 (n = 6), and 2010 (n = 10) generated three, two, and six PFPs, respectively. PFP C was the predominant PFP (n = 12) for S. Infantis isolates amongst the 16 PFPs. All isolates displaying PFP C harbored bla CMY-2. S. Manhattan carrying bla CMY-2 (n = 1) that was isolated in 2010 generated PFP R, as did the other 23 S. Manhattan isolates.

Figure 1

Pulsed-field gel electrophoresis profiles (PFPs) of 70 Salmonella isolates harboring bla and non-bla genes.

The isolates consisted of 25 isolates harboring bla CMY-2 (23 Salmonella enterica subsp. enterica serovar Infantis, one S. Manhattan, and one O-untypeable:r:1,5), nine isolates harboring other bla genes (three S. Infantis and six S. Manhattan), and 36 isolates susceptible to 11 antibiotics (18 S. Infantis and 18 S. Manhattan). One S. Infantis isolate that harbored bla CMY-2 could not be analyzed by PFGE because of damage that occurred during storage. The letters, names, and figures in parentheses on the right of the dendrogram are PFPs, resistance genes, and sampling year of isolates, respectively. The 44 S. Infantis isolates were subtyped as: PFP A (n = 1), PFP B (n = 3), PFP C (n = 12), PFP D (n = 1), PFP E (n = 1), PFP F (n = 1), PFP G (n = 1), PFP H (n = 6), PFP I (n = 3), PFP J (n = 1), PFP K (n = 1), PFP L (n = 6), PFP M (n = 1), PFP N (n = 3), PFP P (n = 2), and Q (n = 1). The 25 S. Manhattan isolates belonged to subtypes PFP R (n = 24) and PFP S (n = 1). One O-untypeable:r:1,5 isolate was PFP E. The scale indicates the percent similarity, as determined by the Dice coefficients.

LPPs are shown in Table 3 and Fig. 2. S. Infantis (n = 44) generated four different LPPs (LPP 1-LPP 4). Forty-one out of the 44 S. Infantis isolates, including bla CMY-2-positive isolates, were classified as LPP 1. One O-untypeable:r:1,5 isolate harboring bla CMY-2 was classified as LPP 1. S. Manhattan (n = 25) generated four different LPPs (LPP 5-LPP 8). One S. Manhattan isolate carrying bla CMY-2 was classified as LPP 5.

Figure 2

Large plasmid profiles of 70 Salmonella isolates.

These isolates consisted of 25 isolates harboring bla CMY-2 (23 Salmonella enterica subsp. enterica serovar Infantis, one S. Manhattan, and one O-untypeable:r:1,5), nine isolates harboring other bla genes (three S. Infantis and six S. Manhattan), and 36 isolates susceptible to 11 antibiotics (18 S. Infantis and 18 S. Manhattan). The 70 isolates generated eight large plasmid profiles (LPPs). The S. Infantis isolates generated LPPs 1 (n = 41), 2 (n = 1), 3 (n = 1), and 4 (n = 1). All S. Infantis isolates harboring bla genes showed LPP 1, except for one S. Infantis isolate carrying bla CTX-M-2 that was classified as LPP 2. All 18 susceptible S. Infantis isolates showed LPP 1, except for two isolates that were collected in 2009 and 2008 showing LPP 3 and LPP 4, respectively. One O-untypeable:r:1,5 isolate was classified as LPP 1. S. Manhattan isolates generated four different LPPs (LPP 5-LPP 8). LPPs 5, 6, 7, and 8 were found in one, 21, one, and two S. Manhattan isolate(s), respectively. S. Infantis, O-untypeable:r:1,5, and S. Manhattan are expressed as S. I, OUT, and S. M in the figure, respectively.

Confirmation of ISEcp1 and other genes related to bla CMY-2

MseI-RFLP profiles of the regions upstream and downstream of bla CMY-2 were identical in all 25 isolates harboring bla CMY-2. S. Infantis isolates 1993, 2127, and 2150, showing the dominant PFP C and LPP 1 characteristics, and S. Manhattan isolate 2179, the only S. Manhattan isolate harboring bla CMY-2, were also used for sequencing of the bla CMY-2 upstream and downstream regions and for Southern blot analysis. A 2,389-bp fragment containing the bla CMY-2 gene from the selected isolates was sequenced. Results showed that these fragments from S. Infantis and S. Manhattan were identical. The fragments contained partial ISEcp1, bla CMY-2, blc, and partial sugE genes. The ISEcp1 sequences from the four selected isolates were 100% identical to the sequence reported for pNF4565 (GenBank accession AY581207; 2,389/2,389 bp, 100%), a plasmid carrying bla CMY-2 from S. Typhimurium (isolated from a human in 1999) [33].

All the S. Infantis isolates harboring bla CMY-2 carried plasmids of approximately 280 kb, as did the bla CMY-2-negative S. Infantis isolate (isolate 1737, LPP 1) (Fig. 3). Southern blot analysis using a bla CMY-2 gene probe only produced a hybridization signal for the plasmids from the three S. Infantis isolates in which bla CMY-2 was detected by PCR (Fig. 3). As a result, these plasmids of approximately the same size were classified on the basis of the presence/absence of bla CMY-2. Southern hybridization using a bla CMY-2 gene probe with BlnI-digested genomic DNA from these isolates showed hybridization signals at approximately 54 kb in the three isolates harboring bla CMY-2.

Figure 3

Pulsed-field gel electrophoresis (PFGE) and Southern hybridization images of Salmonella enterica subsp. enterica serovar Infantis.

Selected Salmonella enterica subsp. enterica serovar (S.) Infantis isolates were selected to demonstrate the plasmid location of bla CMY-2. (A) PFGE separation of S1 nuclease-digested genomic DNA from selected S. Infantis isolates, followed by Southern hybridization with a bla CMY-2 probe. Lane 1, Lambda ladder marker; lane 2, isolate 1993; lane 3, isolate 2127; lane 4, isolate 2150; and lane 5, isolate 1737, which does not harbor bla CMY-2. (B) BlnI-digested whole-genomic DNA from selected S. Infantis isolates, followed by Southern hybridization with a bla CMY-2 probe. Lane 1, Lambda ladder marker; lane 2, isolate 1993; lane 3, isolate 2127; lane 4, isolate 2150; and lane 5, isolate 1737, which does not harbor bla CMY-2.

One S. Manhattan isolate that contained bla CMY-2 showed two hybridization signals (approximately 310 kb and 60 kb) (Fig. 4). The 310-kb hybridization signal appeared to be hybridization background; however, the point was confirmed as a small peak of density using densitometric analysis (FPQuest Software, Bio-Rad Laboratories) (Fig. 4). Therefore, the S. Manhattan isolate was confirmed to harbor two bla CMY-2 genes in putative plasmids of 310-kb and 60-kb in size. No hybridization signal was observed for the bla CMY-2-negative S. Manhattan isolate. Southern blot analysis of the S. Manhattan isolate was carried out on two separate occasions, with the same result obtained each time.

Figure 4

Location of bla CMY-2 in Salmonella enterica subsp. enterica serovar (S.) Manhattan.

(A) Pulsed-field gel electrophoresis (PFGE) separation of S1 nuclease- or BlnI-digested genomic DNA from S. Manhattan isolates, followed by Southern hybridization with a bla CMY-2 probe. Lane 1, Lambda ladder marker; lanes 2 and 4, isolate 2179, which harbors bla CMY-2; lanes 3 and 5, isolate 2129, which does not harbor bla CMY-2. Lanes 2 and 3, S1 nuclease-digested genomic DNA; lanes 4 and 5, BlnI-digested genomic DNA. (B) Densitometric curves of PFGE separation with S1 nuclease- and BlnI-digested genomic DNA from S. Manhattan isolate 2179. The arrows show hybridization signals and corresponding positions of densitometric curves. Lambda ladder marker consisted of concatemers starting at 48.5 kb.

Discussion

In the present study, pAmpC (bla CMY-2)-harboring and ESBL-producing (resulting from carriage of bla CTX-M-2, bla CTX-M-15, bla TEM-20, bla TEM-52, or bla SHV-12) Salmonella were isolated from chicken product samples collected after 2005 in Japan. The incidence of Salmonella in these samples was 45.6%, showing that Salmonella contamination of chicken products is very common in this region of Japan. The percentage of resistant isolates also increased significantly from 0% in 2004 to 27.9% in 2010. This can be attributed in part to the increase in the number of S. Infantis isolates harboring bla CMY-2. We determined that the bla CMY-2 gene was located close to an ISEcp1 element in an approximately 280-kb plasmid, pAmpC, in S. Infantis. The presence of pAmpC in S. Infantis from chicken meat and giblets is a significant public health concern because S. Infantis is one of the main causes of human salmonellosis [34], and chicken meat is the main source of human S. Infantis infection in Japan [35].

Interestingly, Taiwan is often the first Asian country in which CMY-2-type β-lactamase-producing bacteria are isolated from humans. Fourteen, two, and one human Salmonella isolates harboring bla CMY-2 were isolated in Taiwan in 2000–2002, in Korea in 2002, and in Japan in 2007, respectively [1,36,37]. In the case of other Enterobacteriaceae, six, 12, and 17 human E. coli isolates harboring bla CMY-2 were isolated in Taiwan in 1999, in China in 2003–2005, and in Japan in 2007–2009, respectively [38-40]. Moreover, 32, 21, and one human K. pneumoniae isolates harboring bla CMY-2 were also isolated in Taiwan in 1999–2002 [41], in Korea in 2002–2003 [42], and in China in 2004 [39], respectively. The reason for this apparent first emergence of bla CMY-2-carrying isolates in Taiwan is unknown, and may just be a result of differences in monitoring and reporting protocols; however, this phenomenon warrants further enquiry considering the international circulation of livestock and their products, especially chickens.

The first Salmonella harboring bla CMY-2 were isolated from chicken meat in Japan, and were reported in the mid-2000s by Taguchi et al. [15]. The isolation years (2004 or 2005, exact date unknown) of the Taguchi study coincided with the first year of detection (2005) of CMY-2 β-lactamase-producing Salmonella in the present study. Therefore, it could be surmised that bla CMY-2-harboring Salmonella began to appear in chicken meat in Japan from around 2004. Interestingly, Hiki et al. also reported that the incidence of bla CMY-2-containing E. coli isolated from broiler chickens in Japan increased after 2004 [43]. CMY-2 β-lactamase-producing E. coli from chicken meat were reported in Taiwan in 2002 [44], but were not reported in Japan until 2006 [45,46]. The possibility of interspecies transmission of bla CMY-2 between Salmonella and other Enterobacteriaceae populations like E. coli in Japanese chicken birds cannot be denied. However, Shahada et al. reported that no interspecies transmission was detected in Japanese broilers when they compared Salmonella and E. coli isolates from Japanese chickens in 2010 and 2011 [47]. Therefore, further research is required to determine when and where the interspecies transmission of bla CMY-2 from other Enterobacteriaceae to Salmonella is occurring.

The presence of bla CMY-2 genes on both the putative 310-kb plasmid and the 60-kb plasmid in the S. Manhattan isolate identified in this study might play a role in the relatively strong ESC-resistance of this isolate. The inhibition zone diameters for cefotaxime and ceftazidime (16 and 12 mm, respectively) for this isolate were the smallest of all 26 isolates harboring bla CMY-2 (averaged 23 mm and 18 mm, respectively). In addition, the zone diameters for cefpodoxime and cefoxitin for the S. Manhattan isolate were also amongst the smallest for the 26 isolates. Again, the presence of two copies of the bla CMY-2 gene in this isolate may contribute to this high level of resistance; however, further studies are needed to confirm the presence and structure of the putative 310-kb plasmid.

In this study, a 2,389-bp fragment surrounding bla CMY-2 was identical to a partial sequence of previously reported plasmids, including pNF4656 (S. Newport, >100 kb) [33], pNF1358 (S. Typhimurium, >100 kb) [33], pCVM29188 (S. Kentucky, 101,461 bp) [48], and pUMNK88 161 (E. coli, 161,081 bp) [49]. These studies reported that the mobile element ISEcp1 in the plasmids led to acquisition of various resistance genes in addition to bla CMY-2. As S. Infantis plasmids from both the resistant and susceptible isolates (Fig. 2) were indistinguishable in size, the transfer of bla CMY-2 between these plasmids should be studied.

The present study suggests some flaws in common screening approaches for ESBL detection. We identified an isolate carrying bla TEM-20 that was only resistant to cefpodoxime and cefepime. Such a strain could escape detection by traditional ESBL tests, which use only cefotaxime and ceftazidime [1,10,50]. Furthermore, this isolate showed intermediate sensitivity (20 mm) to ceftiofur (30 μg) (data not shown), which supports previous findings by Rodriguez et al. [11]. Therefore, routine ESBL screening may be improved by the use of cefpodoxime, cefepime, and/or ceftiofur.

In conclusion, we found that S. Infantis isolates harboring plasmid-borne bla CMY-2 were prevalent in chicken products in Japan after 2005. None of the studied isolates showed resistance to carbapenem antibiotics; however, the dissemination of ESC-resistant Salmonella containing plasmid-mediated bla CMY-2 demands the development of continuous monitoring strategies in the interests of public health.