Liverworts are the most basal group of extant land plants. Nonetheless, the molecular biology of liverworts is poorly understood. Gene expression has been studied in only one species, Marchantia polymorpha. In particular, no microRNA (miRNA) sequences from liverworts have been reported. Here, Illumina-based next-generation sequencing was employed to identify small RNAs, and analyze the transcriptome and the degradome of Pellia endiviifolia. Three hundred and eleven conserved miRNA plant families were identified, and 42 new liverwort-specific miRNAs were discovered. The RNA degradome analysis revealed that target mRNAs of only three miRNAs (miR160, miR166, and miR408) have been conserved between liverworts and other land plants. New targets were identified for the remaining conserved miRNAs. Moreover, the analysis of the degradome permitted the identification of targets for 13 novel liverwort-specific miRNAs. Interestingly, three of the liverwort microRNAs show high similarity to previously reported miRNAs from Chlamydomonas reinhardtii. This is the first observation of miRNAs that exist both in a representative alga and in the liverwort P. endiviifolia but are not present in land plants. The results of the analysis of the P. endivifolia microtranscriptome support the conclusions of previous studies that placed liverworts at the root of the land plant evolutionary tree of life.
Liverworts are the most basal group of extant land plants. Nonetheless, the molecular biology of liverworts is poorly understood. Gene expression has been studied in only one species, Marchantia polymorpha. In particular, no microRNA (miRNA) sequences from liverworts have been reported. Here, Illumina-based next-generation sequencing was employed to identify small RNAs, and analyze the transcriptome and the degradome of Pellia endiviifolia. Three hundred and eleven conserved miRNA plant families were identified, and 42 new liverwort-specific miRNAs were discovered. The RNA degradome analysis revealed that target mRNAs of only three miRNAs (miR160, miR166, and miR408) have been conserved between liverworts and other land plants. New targets were identified for the remaining conserved miRNAs. Moreover, the analysis of the degradome permitted the identification of targets for 13 novel liverwort-specific miRNAs. Interestingly, three of the liverwort microRNAs show high similarity to previously reported miRNAs from Chlamydomonas reinhardtii. This is the first observation of miRNAs that exist both in a representative alga and in the liverwort P. endiviifolia but are not present in land plants. The results of the analysis of the P. endivifolia microtranscriptome support the conclusions of previous studies that placed liverworts at the root of the land plant evolutionary tree of life.
Land colonization by plants probably began in the Early Middle Ordovician period, and liverworts are the most likely basal group of land colonizers (Supporting Information Fig. S1) (Qiu et al., 2007; Rubinstein et al., 2010; Ruhfel et al., 2014). Embryophytes are generally accepted to have originated from charophycean green algae, similar to extant charophytes (Charales, Coleochaetales or Zygnematales). Thus, charophytes are probably the closest living green algal relatives to liverworts (Karol et al., 2001; Qiu et al., 2007; Timme et al., 2012; Bowman, 2013). The basal status of liverworts as land plants suggests that they share common molecular traits linking algae and vascular plants.Liverworts (phylum Marchantiophyta) are divided into three classes: Haplomitriopsida, Jungermanniopsida, and Marchantiopsida. The Jungermanniopsida represent > 80% of living liverwort taxa, which include the dioecious Pellia endiviifolia (subclass Pelliidae, order Pelliales). The representatives of the genus Pellia are recognized as the most basal lineage of the simple thalloid liverworts with respect to many plesiomorphic features, such as cuneate apical cell, a thallus without a midrib, a spherical capsule and massive seta (Pacak et al., 1998; He-Nygrén et al., 2006; Crandall-Stotler et al., 2009). Only a few examples of the regulation of gene expression have been reported in liverworts (Qiu et al., 1998; Nishiyama et al., 2000; Yamato et al., 2007; Sierocka et al., 2011; Sharma et al., 2013, 2014). However, none of these studies were devoted to small RNAs (sRNAs), noncoding 19–25-nucleotide (nt)-long RNA molecules that are of particular interest as key regulators of eukaryotic gene expression (Voinnet, 2009; Khraiwesh et al., 2010). MicroRNAs (miRNAs) are a class of sRNAs that are transcribed by RNA polymerase II. Primary miRNA transcript (pri-miRNA) derived from the MIcroRNA (MIR) gene typically forms an imperfect fold-back structure that is processed into a stem-loop precursor (pre-miRNA) and further excised as an miRNA/miRNA* duplex (Kim, 2005). The mature miRNA molecule is then incorporated into an effector complex named the RNA-induced silencing complex (RISC) to guide target mRNA cleavage or translation inhibition (Lee et al., 2004; Tang et al., 2003; Brodersen et al., 2008). The final output of miRNA activity is the down-regulation of expression for a given protein.The first sRNA studies which were performed in Arabidopsis thaliana and Oryza sativa discovered miRNA families, the majority of which were conserved between these plant species (Llave et al., 2002; Park et al., 2002; Reinhart et al., 2002; Jones-Rhoades & Bartel, 2004; Sunkar & Zhu, 2004). However, the experimental approach was based on low-depth sequencing or genome-based computational predictions of fold-backs and complementary target sequences, which preferentially captured the most abundant miRNAs belonging to conserved families. The development of high-throughput sequencing technologies has permitted an increase in the sequencing depth for various angiosperm species. This technology also opened a window of opportunity to broaden miRNA research beyond the scope of spermatophytes and permitted the exploration of the miRNA repertoire in nonseed plants. Comparative studies on the miRNA repertoire of the representatives of three evolutionarily distant plant lineages (the moss Physcomitrella patens, the lycopod Selaginella moellendorffii and the angiosperm A. thaliana) have revealed that only a small fraction of the identified miRNAs are conserved and highly expressed across basal plants and angiosperms. The majority of miRNAs in both mosses and lycopods tend to be lineage-specific, exhibiting features that are characteristic of young, recently evolved miRNA species in A. thaliana: they are weakly expressed, tend to originate from a single genomic locus and have few predicted mRNA targets (Axtell et al., 2007; Fattash et al., 2007; Banks et al., 2011). The analyses of combined high-throughput sequencing data sets for different representatives of embryophytes have identified eight miRNA families that are common to all of the land plants studied thus far. Ten families are present in all angiosperm lineages, while the other families display more restricted taxonomic distributions. Moreover, a high proportion of species-specific miRNA genes have been observed not only in P. patens and S. moellendorffii but also in rice, Medicago truncatula and Glycine max (Cuperus et al., 2011). The predominance of young miRNA families with restricted taxonomic distribution, which is characteristic of unique groups of plants, strongly supports the hypothesis that the MIR genes are born and lost at a high frequency. Nonconserved miRNAs represent an evolutionarily flexible set of regulatory molecules that can appear and disappear on relatively short evolutionary time-scales with no or minor functional consequences, and with only a few being stabilized during their brief existence by recruitment into beneficial regulatory interactions (Rajagopalan et al., 2006; Fahlgren et al., 2007, 2010; Cuperus et al., 2011).Interestingly, no miRNA families that have been identified in land plants have been discovered to date in the unicellular green alga Chlamydomonas reinhardtii or the colonial green alga Volvox carteri. The lack of universally conserved miRNA genes between land plants and green algae suggests that miRNA genes have evolved independently in these two eukaryotic lineages (Molnar et al., 2007; Zhao et al., 2007; Li et al., 2013). However, attention should be paid to the effect of disparities in taxonomic sampling on our understanding of miRNA evolution. Entire divisions either have no coverage (Marchantiophyta, Anthocerophyta, Psilophyta, Sphenophyta, Cycadophyta, Ginkgophyta, and Gnetophyta) or have had only a single taxon surveyed (Bryophyta, Lycophyta and Pteridophyta) (Taylor et al., 2014).Here, we present the first analysis of the liverwort miRNA repertoire (microtranscriptome) from P. endiviifolia, which enables the identification of conservative plant miRNAs and new, liverwort-specific miRNAs. Combined analyses of the transcriptome, sRNAs and degradome data provide experimental evidence for a target mRNA turnover by identified conserved and novel miRNAs. Moreover, we demonstrate for the first time the existence of common miRNAs between algae and land plants, supporting the hypothesis of liverworts being the basal lineage of land plant evolution.
Materials and Methods
Plant material
Female and male thalli of Pellia endiviifolia (Dicks.) Dumort. producing sex organs were collected from Kopanina, Poznan, Poland (herbarium number 40 228 in POZW) from 2006 to 2012 in September–December. This approach permitted experiments to be conducted on a large range of P. endiviifolia material. The plants that were collected during the three 2006, 2007 and 2008 seasons were used to start an in vitro collection on mineral medium (Fiedorow & Szweykowska-Kulinska, 1998) and subsequently grown on half-strength Gamborg medium (Sigma-Aldrich). Plants from axenic culture were grown under continuous light from white fluorescent lamps at 21–23°C. Plant material that is collected in the field can potentially contain endophytic fungi and algae. To check for the presence of biological contamination in P. endiviifolia thalli that were collected from natural habitats and grown in vitro (Fiedorow et al., 2001), aniline blue-stained thalli were examined for the presence of fungal hyphae using a Zeiss Axioskop 2 plus microscope that was equipped with a Power Shot G5 Canon Digital Camera (Liberato et al., 2005). Fig. S2 shows the presence of endophytic fungi in the P. endiviifolia thalli cells that were collected from the natural habitat. No hyphae were observed in the case of the P. endiviifolia in vitro culture. Additionally, we tested for the presence of fungal and algal DNA using PCR with primers that were specific for the amplification of the ribosomal protein S11 (rps11)–ribosomal protein L2 (rpl2) plastid gene cluster across Chlorophyta species and primers for the amplification of a portion of the small subunit rRNA that is specific to arbuscular endomycorrhizal fungi (Table S1) (Simon et al., 1992; Provan et al., 2004). The PCR analysis showed that P. endiviifolia thalli that were collected from the natural habitat contained DNA products that are specific for fungi and algae, while the thalli that were grown in vitro did not harbor any detectable traces of fungal or algal DNA (Fig. S3). Therefore, we considered the P. endiviifolia thalli that were grown in vitro as fungus- and alga-free. Subsequently, the identification of conservative miRNAs was approved only if a given miRNA sequence was identified in the next-generation sequencing (NGS) data derived from liverwort thalli that were introduced and grown in vitro and for new miRNAs when they were also detectable in northern hybridization when RNA was derived from P. endiviifolia axenic culture.
RNA and DNA isolation
Total RNA for sRNA detection was isolated using a method that permits the enrichment of sRNAs (Kruszka et al., 2013) with several modifications (see Methods S1).
Northern blot analysis of mature miRNAs
The procedure for the northern blot analyses has been previously described (Szarzynska et al., 2009). Up to 60 μg of RNA enriched in sRNAs per line was loaded on denaturing polyacrylamide gels. The oligonucleotide sequences that were used as probes in the northern analyses are shown in Table S1.
pri-miRNA RACE experiments and genome walking
Detailed information about rapid amplification of cDNA ends (RACE) and genome walking experiments is included in Methods S1.The nucleotide sequences obtained in this study have been deposited in GenBank under the following accession numbers: KM001698–KM001707.
Deep-sequencing and bioinformatic analyses
Total RNA was isolated from the male antheridia-producing gametophytes and female archegonia-producing gametophytes that were collected from the field and from both female (twice) and male thalli that were grown in vitro, which had no reproductive organs. Isolated RNA was used for the construction of five independent sRNA libraries. The sRNA libraries were generated using a modified protocol as previously described (Pant et al., 2009). Adaptor sequences were identified and trimmed from each read using a customized Perl script. More detailed procedures for library preparation and bioinformatic analyses are included in Methods S1. The sRNA and transcriptome sequencing data are available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive database under accession numbers SRP043263 and SRP048691.
Transcriptome and degradome sequencing
To ensure the best representation of the P. endiviifolia transcriptome and a sufficient variability of plant material, five different liverwort developmental stages from two growth conditions were used for total RNA isolation: antheridia-producing male gametophytes, archegonia-producing female gametophytes, sporophytes that were collected from the field and female and male thalli that were grown in vitro with no reproductive organs. DNA was removed by digestion using RNase-free TURBO™ DNase (Ambion, Austin, TX, USA). The lack of genomic DNA contamination was confirmed by PCR using primers that were designed for the P. endiviifolia S-Phase Kinase-Associated Protein 1 (SKP1) gene (accession number FJ266076) promoter sequence. RNA integrity was confirmed on 1.2% agarose gels before and after DNase digestion. RNA isolates were combined, and a high-quality RNA sample (22 μg) was shipped on dry ice to the Beijing Genome Institute (BGI) (Beijing, China) for cDNA library preparation and sequencing. cDNA transcriptome library preparation and pair-end (PE) 90-nt NGS were performed on an Illumina HiSeq 2000 system (Illumina Inc., San Diego, CA, USA). PE-read sequence quality estimation was performed by the BGI to permit reliable transcriptome assembly. The assembled transcript data quality was assessed by sequence annotation using the NCBI nr database.The same total RNA isolation procedure was used to prepare degradome libraries. The degradome libraries were prepared as previously described (Addo-Quaye et al., 2009a,b; German et al., 2009). For more detailed information, please see Methods S1. The final libraries of 26-27-mer 5′-ends of the 5′-end phosphorylated mRNAs were sequenced by Fasteris (Plan-les-Ouates, Switzerland) on Illumina HiSeq 2500, with the number of cycles being 1 × 50 + 7, using TruSeq SBS Kit v3 (Illumina). The adapters were trimmed with the cutadapt program (minimum overlap = 19), and only reads with identified adapters that were longer than 13 nt were selected for subsequent analyses.Detailed analysis of the transcriptome and degradome data will be published in a separate paper.
Identification of new miRNAs from the NGS results
Because of the specificity of the experimental model, we developed a new, non-reference-based computational approach to identify novel miRNAs. The procedure involved the creation of grouped sequence reads based on sequences that were aligned perfectly to each other, which we termed ‘clusters’; size and expression profiling of clustered reads; and the identification of functional sRNA features that are characteristic for previously described sequences from other plants (GC content and first nucleotide occupation).From the mapping results, 204 979, 279 332, 361 479, 495 396 and 284 390 18–26-nt clusters of a minimum of two sRNAs in each group were built for all five sRNA-seq samples. Each cluster was then described as a sequence-length profile, where counts of reads of the same size were summarized. Abundance-ranked clusters with a read size distribution similar to that of known miRNAs and with a clearly dominant signal, preferably at 20–21-nt read size, were selected for further analyses. To address the possible origin of the sRNA sequences and to remove contamination, the clustered reads were compared with the Rfam and NCBI databases representing sequences from Bacteria, Archaea, Glomeromycota fungi and Chlorophyta. For experimental validation, based on the cluster read size profile, abundance, GC content and overall nucleotide composition, we selected the 71 top unannotated clusters that were present in at least one of the in vitro libraries.
miRNA target identification
To select transcripts for target prediction, we performed protein coding sequence identification using the ESTScan program (Iseli et al., 1999). The program was trained on P. patens coding sequences that were obtained from the NCBI database to build codon usage matrices for P. endiviifolia prediction. The number of isochores was set to one, as suggested by the ESTScan developers. The target identification procedure was based on three publicly available programs: miRanda,tapir, and psRNAtarget (John et al., 2004; Bonnet et al., 2010; Dai & Zhao, 2011). All of the protein coding transcripts from P. endiviifolia that were predicted by ESTScan were used as the input. The results produced by the prediction software were subsequently scored based on the mismatches that were present in the predicted sRNA:target duplex alignments, where G:U pairing was counted as 0.5 point, and other mismatches were given one point according to Jones-Rhoades & Bartel (2004) and Schwab et al. (2005). Duplexes with a total mismatch score of ≥ 4 and a substitution score in positions 1–12 of sRNA > 2.5 points were discarded. All of the predicted targets that passed the mismatch score filtering were passed for further cleavage site evaluation based on the degradome data.A degradome analysis was performed on predicted targets using target plots (T-plots) (German et al., 2008). For each target nucleotide position, the sum of the tagged 5′-ends that were aligned to the position was calculated. All of the tag counts were normalized by the library size, multiplied by one million to represent tags per million (TPM) and then divided by the total number of transcripts that they were mapped to, as suggested by Addo-Quaye et al. (2009a,b). The cleavage signal threshold was calculated for each T-plot, representing the mean TPM counts from the total tags that were aligned to the transcript. Signals greater than the mean TPM counts were selected for further analysis. The putative cleavage signal position that was indicated by the tags was compared with the predicted 9–11 position of the miRNA:target duplex. T-plots with a tag position that matched the predicted cleavage site of the miRNA:target duplex were analyzed manually and divided into three groups based on their TPM value compared with other tag TPM values and its positional proximity.Protein domain prediction analysis using the hmmer3 tool was performed on targets with degradome-confirmed cleavage sites (Eddy, 2011). The functional annotation of the predicted targets was based on protein families database (Pfam) gene ontology annotations and/or best protein hits that were extracted from BLASTx results in the nr NCBI database (Altschul et al., 1997; Sonnhammer et al., 1997). Homologous proteins corresponding to the targets with a similarity that was equal to or lower than an E-value of 0.001 with at least 70% coverage of the known protein were selected.
Results
Liverwort P. endiviifolia shares conservative miRNAs with land plants
To identify miRNAs in P. endiviifolia, five independent sRNA libraries reflecting four different P. endiviifolia thalli were sequenced with the high-throughput Illumina system. After filtering out the adapter sequences and sequences with a low quality or low copy number, only those sequences in the range of 18–26 nt were selected, giving final reads of 1880 538, 3389 639 and 3133 111 for one male and two female sRNA in vitro libraries and 5048 417 and 3448 623 for one male and one female sRNA environmental library, respectively. A dominating class of 21-nt-long reads was observed for all libraries, which is consistent with the typical sRNA distribution of angiosperms, such as barley (Hordeum vulgare) (Kruszka et al., 2013), rice (Oryza sativa) (Morin et al., 2008) and cucumber (Cucumis sativus) (Mao et al., 2012). A maximum of two nucleotide mismatches within the overlapping regions were allowed when conservative miRNAs were selected from the NGS results using known plant mature miRNA sequences as a query.Altogether, 311 of the miRNA families that were identified in P. endiviifolia were also present in land plant representatives that have been studied to date (Table S2; Fig.1). Overall, 25.3% of the known miRNA families that are specific for Bryophyta and Pteridophyta, 35.2% of those that are specific for Coniferophyta, 15.6% of those that are specific for eudicotyledons and 15.6% of those that are specific for monocotyledons were identified in the liverwort P. endiviifolia when miRBase release 20 was used as a reference for miRNA sequences (Griffiths-Jones, 2004; Kozomara & Griffiths-Jones, 2014). Eleven conserved miRNA families are common to all land plants (Table1). The miR156 (a–j), miR160 (a–c), miR166 (a–g), and miR390 (a, b) multimember families are represented in P. endiviifolia by all of the members that have been identified in A. thaliana. By contrast, rice miR156, miR160 and miR166 families are more complex and contain additional members that were not identified in P. endiviifolia. Only three members of the miR156 family have been found in P. patens (miR156a–c), a representative of bryophytes, while the P. patens miR160 family is represented by a higher number of miRNA species (miRNA160a–i) (Kozomara & Griffiths-Jones, 2014). The quality and reliability of the sequencing results were confirmed by northern hybridization, which was performed for selected conservative miRNAs that were selected based on their count number and northern hybridization signal strength. Fig.2(a) shows the hybridization results for P. endiviifolia miR408-5p (pen-miR408-5p), and a corresponding graph presenting the read counts for the miR408-5p cluster (see the Materials and Methods section). Fig.2(b) shows the northern blots for the three additional selected conservative miRNAs (pen-miR166, pen-miR168, and pen-miR319) with the closely corresponding number of NGS reads for 21-nt-long species and the intensity of the hybridization signals (for other selected conservative miRNAs, see Fig. S4). The identified repertoire of P. endiviifolia miRNA families indicates that this liverwort shares the majority of its miRNAs with other land plants.
Figure 1
Venn diagram showing the identification of Pellia endiviifolia conservative microRNA (miRNA) families within land plants according to miRBase [http://www.mirbase.org/].
Table 1
Common land plant microRNAs (miRNAs) that were identified in Pellia endiviifolia
miR family
miR member
Sequence
Length (nt)
miR length (nt)
Mn
Mean count
ath-miR156
a
tgacagaagagagtgagcac
20
21
0
2247.09
ath-miR156
g
ggacagaagagagtgagcac
20
20
0
13.01
vvi-miR156
h
ttgacagaagagagagagcat
21
20
1
5.73
ath-miR156
i
tgacagaagagagagagca
19
21
0
1.92
ath-miR156
j
tgacagaagagagagagcac
20
21
0
4.43
ath-miR159
a
tttggattgaagggagct
18
21
0
1.28
ath-miR160
a
tgcctggctccctgtatgcca
21
21
0
3125.22
ath-miR166
a
tcggaccaggcttcattcccc
21
21
0
309522.05
osa-miR171
i-5p
aggtattggcgcgcctcaatt
21
21
1
0.97
ath-miR319
a
cttggactgaagggagctcccttt
24
21
0
8.34
ath-miR390
a
aagctcaggagggatagcg
19
21
0
235.63
bdi-miR395
d
tccaagtgtttcgggtactctagg
24
21
2
1.77
ath-miR396
b
ttccacagctttcttgaactt
21
21
0
13.79
ath-miR408
atgcactgcctcttccctggc
21
21
0
388.61
osa-miR535
-5p
tgacaacgagagagagcacgc
21
21
0
4374.19
ath, Arabidopsis thaliana; bdi, Brachypodium distachyon; vvi, Vitis vinifera; osa, Oryza sativa; Mn, number of mismatches in sequence-overlapping regions.
Figure 2
Selected conservative microRNAs (miRNAs) in the liverwort Pellia endiviifolia as detected by northern hybridization. Above the blots, the name of each miRNA is provided along with the length of the dominating cDNA fragment in a given cluster and the mean counts (k, kilo) from all of the deep-sequencing results for all family members (up to two mismatches in the overlapping region to the probe sequence were considered; see Supporting Information Table S2). (a) pen-miRNA 408. The graph on the right presents the distribution of reads within the miR408 cluster. The read counts represent a single next-generation sequencing (NGS) experiment. (b) miRNA166, miR168, and miR319. The left side of the northern blots shows the RNA decade marker depicting 30-nucleotide (nt)- and 20-nt-long RNAs.
Common land plant microRNAs (miRNAs) that were identified in Pellia endiviifoliaath, Arabidopsis thaliana; bdi, Brachypodium distachyon; vvi, Vitis vinifera; osa, Oryza sativa; Mn, number of mismatches in sequence-overlapping regions.Venn diagram showing the identification of Pellia endiviifolia conservative microRNA (miRNA) families within land plants according to miRBase [http://www.mirbase.org/].Selected conservative microRNAs (miRNAs) in the liverwortPellia endiviifolia as detected by northern hybridization. Above the blots, the name of each miRNA is provided along with the length of the dominating cDNA fragment in a given cluster and the mean counts (k, kilo) from all of the deep-sequencing results for all family members (up to two mismatches in the overlapping region to the probe sequence were considered; see Supporting Information Table S2). (a) pen-miRNA 408. The graph on the right presents the distribution of reads within the miR408 cluster. The read counts represent a single next-generation sequencing (NGS) experiment. (b) miRNA166, miR168, and miR319. The left side of the northern blots shows the RNA decade marker depicting 30-nucleotide (nt)- and 20-nt-long RNAs.
Novel liverwort-specific miRNAs
Data from the previously sequenced plant genomes indicate that the majority of identified miRNAs belong to nonconserved or species-specific miRNA families that are present only in a given plant family or species, respectively (Kozomara & Griffiths-Jones, 2014). A careful analysis of P. endiviifolia sRNA NGS data resulted in the identification of novel, potentially liverwort-specific miRNAs. Using an original approach, we selected a number of sRNA reads that fulfilled the criteria for potential miRNAs. Table2 shows the sequences of the 42 selected putative miRNAs (belonging to the 34 new miRNA families) that were found in our search, while Fig. S5 presents the distribution of the read length for each miRNA cluster (see the Materials and Methods section). In each cluster, there are dominating RNA species within a length range that is typical for miRNAs. We confirmed the presence of these potential miRNA species in P. endiviifolia using northern hybridization (Fig.3). All of the tested miRNA species gave a clear signal in the range of 19–23 nt in length, with the majority of the novel potential miRNA species being 21 nt. As a negative control for the hybridization-based evaluation, we selected an sRNA cluster without the domination of any particular RNA fragment size (see Fig. S5, control). In this case, the northern hybridization did not reveal any clear signal. The similarity search for the novel liverwort miRNA species in the sRNA NGS results and the genome of P. patens did not produce positive results. Thus, we conclude that the identified sRNAs represent liverwort-specific miRNAs.
Table 2
Novel, putative microRNAs (miRNAs) that were identified in Pellia endiviifolia
miRNA name
Sequence
Length (nt)
Mean count
pen-miR8156a
tctcccacacatcgtctagga
21
19879060.23
pen-miR8156b
tctcccacacatcgtctaggc
21
58077.70
pen-miR8156c
tctgccacacatcgtctagga
21
22901.49
pen-miR8156d
tcgcccacacatcgtctagga
21
9325.45
pen-miR8157
tttcccagacatcgtcgatga
21
2780091.24
pen-miR8158
tgaaggacgcattctgctcga
21
320926.69
pen-miR8159a
ttaccttgaagagtctggaag
21
298119.06
pen-miR8159b
ttaccttgaagagtctggaa
20
116532.20
pen-miR8160
tccctaaagactcgggcaata
21
127680.15
pen-miR8161
ttcgagcagagaggtggagcc
21
424963.43
pen-miR8162-5p
tttgtaagaattggaaccgga
21
75985.52
pen-miR8162-3p
tggatccatttcttacagacg
21
65120.30
pen-miR8163
ccccgtggaagaaaacaatctca
23
191569.82
pen-miR8164
caatttgtggcaaacttcccc
21
103523.36
pen-miR8165
ttgctagagaggactttcctt
21
59900.20
pen-miR8166
ttgctttgggagacatcagttc
22
245117.49
pen-miR8167
ccatgcctactatacccaatc
21
31174.82
pen-miR8168
ggggacgtagctcaatcgg
19
228305.93
pen-miR8169
tgcgataagaagggttgagct
21
52738.45
pen-miR8170
tgcttcacagaggagatgcat
21
35621.35
pen-miR8171
caatagaagcatgggactgag
21
30129.15
pen-miR8172.1
tcggacgttatcacgccttgg
21
14799.01
pen-miR8172.2
tctaagtcgggaagccaaggc
21
57485.07
pen-miR8173
ccagtaggagatgtgatcgta
21
132404.08
pen-miR8175
ccatgcctgctatatccaatc
21
17454.77
pen-miR8176
tctgtgtttcaggacctcaaa
21
11953.24
pen-miR8177
tctgatggactgcagggcatg
21
24212.20
pen-miR8178
tggggtcctataagtcatcaa
21
26231.57
pen-miR8179
tgggatacagtaggcataact
21
65510.02
pen-miR8180
tacagacttgcactcgtcgtc
21
51215.78
pen-miR8181
ggcccgtgcggtcggatggacc
22
5743.34
pen-miR8182
tctctcagtctggcacttaca
21
89872.87
pen-miR8183.1
gaaccgggactggaaggaggc
21
4846.39
pen-miR8183.2a
gggactggaaggaggctgaga
21
111970.03
pen-miR8184
tggaggaagagacattgtgac
21
32.62
pen-miR8185a
taaagatgatgggttttgttg
21
21593.70
pen-miR8186
cttgcagcaagcagatcccag
21
29270.63
pen-miR8187
acaaggtatgggaggtatggaatg
24
7878.44
pen-miR8188
agaaacgctgcaacggaacca
21
23546.63
pen-miR8189
aggaggatagtacagggttgt
21
2151.33
pen-miR8190
gagggttgcagagtggttttgg
22
9799.49
pen-miR408-5pb
ctagggtgaggcatggcatg
20
94669.44
sRNA homologs that were found in Chlamydomonas reinhardtii NGS data with one and two mismatches in the overlapping regions;
Primarily discovered as a novel miRNA; after the pre-miRNA structure prediction, it was identified as miR408-5p.
Figure 3
Forty-two novel microRNAs (miRNAs) in the liverwort Pellia endiviifolia as detected by northern hybridization. Above the blots, the length of the dominating cDNA fragment in a given cluster and the mean counts (k, kilo) from all of the deep-sequencing results are provided. (a) pen-miRNA8165. The graph on the right shows the distribution of the reads within the pen-miR8165 cluster. The read counts represent a single next-generation sequencing (NGS) experiment. (b) Additional novel pen-miRNAs. The left side of the northern blots shows the RNA decade marker depicting a 20-nucleotide (nt)-long RNA. The numbers above the blots represent the numerical part of the novel miRNA ID. Open circle, pen-miR8156a, pen-miR8156b, pen-miR8156c and pen-miR8156d form one miRNA family and differ from each other by 1 nt; closed circles, sRNA homologs that were found in the Chlamydomonas reinhardtii NGS data with one and two mismatches in the overlapping regions. Open square, pen-miR408-5p*. miR408-5p* was originally identified as a novel miRNA and then identified as miR* in pre-miRNA408-5p.
Novel, putative microRNAs (miRNAs) that were identified in Pellia endiviifoliasRNA homologs that were found in Chlamydomonas reinhardtii NGS data with one and two mismatches in the overlapping regions;Primarily discovered as a novel miRNA; after the pre-miRNA structure prediction, it was identified as miR408-5p.Forty-two novel microRNAs (miRNAs) in the liverwortPellia endiviifolia as detected by northern hybridization. Above the blots, the length of the dominating cDNA fragment in a given cluster and the mean counts (k, kilo) from all of the deep-sequencing results are provided. (a) pen-miRNA8165. The graph on the right shows the distribution of the reads within the pen-miR8165 cluster. The read counts represent a single next-generation sequencing (NGS) experiment. (b) Additional novel pen-miRNAs. The left side of the northern blots shows the RNA decade marker depicting a 20-nucleotide (nt)-long RNA. The numbers above the blots represent the numerical part of the novel miRNA ID. Open circle, pen-miR8156a, pen-miR8156b, pen-miR8156c and pen-miR8156d form one miRNA family and differ from each other by 1 nt; closed circles, sRNA homologs that were found in the Chlamydomonas reinhardtii NGS data with one and two mismatches in the overlapping regions. Open square, pen-miR408-5p*. miR408-5p* was originally identified as a novel miRNA and then identified as miR* in pre-miRNA408-5p.
Pellia endiviifolia contains miRNAs that are similar to the miRNAs that have been identified in the alga C. reinhardtii
Previous studies on the origin and evolutionary dynamics of miRNA genes indicated that no miRNA gene is currently shared between green algae and land plants (Cuperus et al., 2011; Nozawa et al., 2012). However, this previous analysis did not consider representatives of the phylum Marchantiophyta. Thus, we compared the data that were deposited in miRBase, as published by Molnar et al. (2007), Zhao et al. (2007), and Li et al. (2013), and sRNA NGS data for C. reinhardtii and V. carteri with our microtranscriptome sequencing data. These analyses, intriguingly, revealed the presence of three miRNAs (representing distinct families) from the liverwort P. endiviifolia with high sequence similarity to the sRNAs of the green alga C. reinhardtii. Up to two mismatches were permitted in this miRNA sequence similarity comparison. One of the miRNAs (pen-miR1444) was already annotated as cre-miR1144b, while two of the identified novel miRNAs in P. endiviifolia (pen-miR8183.2 and pen-miR8185) revealed the presence of highly homologous sRNAs within the deep sequencing data that were deposited for C. reinhardtii (which we reanalyzed) but not recognized by previous studies as miRNAs. Table3 shows the miRNAs that were found in P. endiviifolia species with high homology to green algal sRNAs.
Table 3
Three Pellia endiviifolia novel microRNAs (miRNAs) with homologous sRNA sequences that were found in Chlamydomonas reinhardtii next-generation sequencing (NGS) data
miR family
miR member
P. endiviifolia versus C. reinhardtii sequence
Length (nt)
Mn
Mean counts
pen-miR8183
.2
gggactggaaggaggctgaga
21
2
111970.03
acctggaaggaggctgag
18
pen-miR8185
taaagatgatgggttttgttg
21
1
21593.70
aatgatgatgggttttgt
18
pen-miR1144
b
gtagggtggaggcaggca
18
2
0.97
tgggtagtgtggcggcaggcag
22
One of the homologs represents the previously reported C. reinhardtii miRNA miR1144b. Short RNA sequences of C. reinhardtii homologs were identified in GSM803105, GSM803104 and GSM573523 samples from the NCBI GEO database. Mn, number of mismatches that were found in the overlapping regions. The bold letters indicate the mismatches that were present in overlapping region of the P. endiviifolia- and C. reinhardtii-aligned sequences.
Three Pellia endiviifolia novel microRNAs (miRNAs) with homologous sRNA sequences that were found in Chlamydomonas reinhardtii next-generation sequencing (NGS) dataOne of the homologs represents the previously reported C. reinhardtii miRNA miR1144b. Short RNA sequences of C. reinhardtii homologs were identified in GSM803105, GSM803104 and GSM573523 samples from the NCBI GEO database. Mn, number of mismatches that were found in the overlapping regions. The bold letters indicate the mismatches that were present in overlapping region of the P. endiviifolia- and C. reinhardtii-aligned sequences.We confirmed the presence of the liverwort P. endiviifolia miRNAs that were homologous to C. reinhardtii miRNAs and sRNAs using northern hybridization (Fig.4). Total RNA for this experiment was isolated from P. endiviifolia thalli that were grown in vitro and were thus free from fungal and algal contamination (Figs S2, S3). Our results suggest that the two C. reinhardtii sRNAs may represent green algal miRNAs and belong to an miRNA category that is common for liverworts and green algae. To our knowledge, the C. reinhardtii and V. carteri miRNAs represent the only currently available source of green algal miRNAs.
Figure 4
Selected Pellia endiviifolia microRNAs (miRNAs) that were homologous to Chlamydomonas reinhardtii miRNAs as detected by northern hybridization. The left side of the northern blots shows the RNA decade marker. Above the blots, the name of each miRNA is provided along with its length and mean counts (k, kilo). nt, nucleotide.
Selected Pellia endiviifolia microRNAs (miRNAs) that were homologous to Chlamydomonas reinhardtii miRNAs as detected by northern hybridization. The left side of the northern blots shows the RNA decade marker. Above the blots, the name of each miRNA is provided along with its length and mean counts (k, kilo). nt, nucleotide.Our results provide the first line of evidence for the existence of miRNA species that are conserved across algae and land plants and suggest that liverworts are an ancestral lineage for all embryophytes.
Liverwort miRNA genes and precursors have a similar structure to those of other land plants
One of the fundamental features defining plant miRNAs is the precise excision of an miRNA/miRNA* duplex from the stem-loop pre-miRNA (Meyers et al., 2008). Stem-loop precursors are predicted using genomic DNA or known expressed sequence tags (ESTs)/transcripts as the input for RNA secondary structure prediction software. Because the genome of P. endiviifolia has not been sequenced, we performed transcriptome sequencing for P. endiviifolia (see the Materials and Methods section), the results of which were used as a reference database to search for miRNA precursors using the obtained P. endiviifolia miRNA data set as a query.We found 26 pri-miRNA candidates. Some of the miRNAs are encoded by one pri-miRNA (miR536 and miR7732), and some are encoded by up to five different precursors (pri-miR408 encoding three mature miRNAs with different sequences), while the other miRNAs may be encoded within one precursor (pri-miR156 encodes two miRNAs (miRNA156i and miR156j), and pri-miR390 generates miR390 and miR390a). In total, nine pri-miRNAs encode nine conservative miRNAs, and 17 pri-miRNAs encode 15 novel miRNAs (Table S3; Fig. S6). The low number of identified unigenes representing potential miRNA primary transcripts can be explained by previously reported studies for angiosperms that show the fast and efficient processing of pri-miRNAs during miRNA biogenesis (Szarzynska et al., 2009; Bielewicz et al., 2012; Kruszka et al., 2013, 2014). The bioinformatic characterization of pri-miRNA candidates was validated using 5′ and 3′ RACE and genome walking using cDNA that was obtained from total RNA or genomic DNA that was isolated from in vitro-grown plants. Altogether, we were able to define the structure of 10 P. endiviifolia miRNA (MIR) genes and their precursors. These genes represent the first known liverwort MIR genes with fully characterized gene organization and transcripts with a predicted pre-miRNA stem-loop structure (Table4; Fig. S6). Among 10 P. endiviifolia MIR genes, two encode conservative miRNAs (miR408-5p and miR536), while eight encode newly identified liverwort-specific miRNAs. One of the MIR genes (MIR pen-8185) encodes the novel P. endiviifolia miRNA that was also identified in the C. reinhardtii sRNA library (Table4; Fig. S6) (Molnar et al., 2007). All of the genes that have been described represent independent transcriptional units containing one miRNA molecule that is embedded within a classical stem-loop structure (Fig. S6). Three MIR genes contain one intron, while one MIR gene contains two introns. All of these introns exhibit signatures that are typical of a U2-type intron. In all of the intron-containing MIR genes, the miR/miR* stem-loop structure was found in the last exon. This result is unusual compared with angiosperms, where MIR genes typically represent independent transcriptional units with an miRNA-containing hairpin structure that is located in the first exon (Szarzynska et al., 2009; Kruszka et al., 2013).
Table 4
Schematic representation of the identified Pellia endiviifolia MIcroRNA (MIR) genes and their precursors
Schematic representation of the identified Pellia endiviifolia MIcroRNA (MIR) genes and their precursorsAmong the 42 newly identified P. endiviifolia-specific miRNAs, we found a pair of miRNA sequences (pen-miR8162-5p and pen-miR8162-3p) that are derived from the same transcript (Fig.5). Interestingly, both of these sequences were highly and equally represented in almost all of the sRNA data sets from both the NGS results and northern hybridization (Fig.5; Table S4). The alignment pattern of the sRNAs that were identified in the NGS results along with their corresponding transcript excludes the possibility of pen-miR8162-5p and pen-miR8162-3p representing a class of small interfering RNAs (siRNAs; data not shown). The high stability of both miRNA and miRNA* species indicates their possible functionality as miRNA, and in some of the previously published cases, such functions have been confirmed (Guo & Lu, 2010; Shao et al., 2013; Kruszka et al., 2013). Because both of these miRNAs are highly abundant in the same samples, they could play an important role in the cell by targeting actively transcribed genes. Therefore, putative targets for pen-miR8162-5p and pen-miR8162-3p have been predicted. The pen-miR8162-5p target encodes the putative transcription factor pen_C74-1, which contains the Myb/SANT -like DNA-binding domain (Myeloblastosis DNA-binding domain/acronym for ‘Swi3, Ada2, N-Cor, and TFIIIB’) that is specific for the guanine thymine 1 (GT-1) protein family of trihelix transcription factors. The predicted target of pen-miR8162-3p encodes a putative protein pen_U20592 containing the P-type ATPase ATP-binding domain and the haloacid dehalogenase-like hydrolase domain, suggesting that this target possesses nucleotide binding and hydrogenase activity. In the degradome data, we detected a very weak slicing product for the pen_U20592 transcript (data not shown) but were unable to confirm the cleavage site for the putative transcription factor mRNA.
Figure 5
miR8162-5p and miR8162-3p derive from the same transcript, generating a stem-loop structure. The left panel shows the stem-loop structure of the pen-miR8162 precursor. Both of the microRNA (miRNA) species are marked in green because both are present at similar levels, and putative targets were found for both. The right panel shows northern hybridization for both miRNA species. nt, nucleotide; k, kilo.
miR8162-5p and miR8162-3p derive from the same transcript, generating a stem-loop structure. The left panel shows the stem-loop structure of the pen-miR8162 precursor. Both of the microRNA (miRNA) species are marked in green because both are present at similar levels, and putative targets were found for both. The right panel shows northern hybridization for both miRNA species. nt, nucleotide; k, kilo.
Conserved and new targets for P. endiviifolia miRNAs
The conservation of mature miRNA sequences between P. endiviifolia and other land plants raised the question of whether their corresponding target mRNAs had been preserved. For this analysis, we selected experimentally verified targets from plants whose microtranscriptomes were studied. As a result of the degradome data analysis, we found evolutionarily conserved mRNA targets for three miRNAs: miR160, miR166 and miR408 (Table5; Fig.6). Auxin Response Factor 16 (ARF 16) mRNA is targeted by miR160; phavoluta mRNA is targeted by miR166; and three different targets, plantacyanin, heavy metal ATPase 8, and ppa004802 m (found in Prunus persica), are all targeted by miR408 (Rhoades et al., 2002; Axtell et al., 2007; Abdel-Ghany & Pilon, 2008; Chorostecki et al., 2012; Zhu et al., 2012). All of the mRNAs were efficiently cleaved precisely in the predicted positions with respect to their cognate miRNAs. Moreover, for miR160 and miR408, we found new additional targets – one for each miRNA (see Table5; Fig.6). However, we were unable to show that the other conserved miRNAs target the homologous mRNAs as in the case of other studied land plants. In the transcriptome data, we found orthologous transcripts that are targeted by the members of 75 conserved miRNA families in embryophytes (data not shown). However, we did not find their cleavage products within the P. endiviifolia degradome data. For the conservative miRNA miR536, which is found in P. patens and vascular plants, as well as miR472, miR482, and miR2118, which were identified solely in vascular plants, one new target was found for each individual miRNA (Fig.6; Table5). Altogether, 65 new targets have been found for 70 conservative plant microRNAs. Table S5 presents all of the degradome results that were obtained for the evolutionarily conserved miRNAs.
Table 5
Known and novel targets of conservative microRNA (miRNA) families that were identified in Pellia endiviifolia and confirmed by the degradome data for the in vitro samples
Plastocyanin-like (Cu ion binding, electron carrier)
203
CDS
pen_C6396-2b
203
CDS
pen-miR408,a,d,e
pen_C7408-1b
Heavy metal ATPase 8 (HMA8) AT5G21930 (Arabidopsis thaliana)
P-type ATPase ATP binding domainc (nucleotide binding); heavy-metal-associated (metal ion binding)
2814
CDS
pen_C7408-2b
2786
CDS
pen-miR408,a,b,d,e
pen_C7900-2b
ppa004802m (Prunus persica)
56-kDa selenium binding protein (SBP56)
252
5′ UTR
pen-miR408-5p,d
pen_U15272
–
Common central domain of tyrosinase; Polyphenol oxidase middle domain
1375
3′ UTR
miR472/482/2118
pen-miR472
pen_C190-3
–
Nucleotide binding-ARC domain (acronym for ‘Apaf1, R proteins, and CED4’)
1336
CDS
pen-miR482a.1, c
pen-miR2118
miR536
pen-miR536,c
pen_C8300-2
–
–
902
3′ UTR
Based on Pfam domains and gene ontology (GO) terms;
Conserved miRNA targets;
Cu-transporting P-type ATPase (HMA8) delivers Cu to plastocyanin in the thylakoid lumen. CDS, coding DNA sequence; StAR, steroidogenic acute regulatory protein.
Figure 6
Target plots (T-plots) for Pellia endiviifolia microRNA (miRNA) targets. T-plots (German et al., 2008) are shown for known P. endiviifolia miRNA targets that are (a) conserved across the land plants and (b) new, validated using degradome data and corresponding to the targets that are presented in Table5. Each T-plot is accompanied by a duplex of miRNA and its target mRNA. For miR408 targeting homologous mRNAs and recognizing/cleaving the same sequence, only one example of each group of targets is shown (four T-plots). TP1M is the normalized abundance based on the formula TP1M = (raw abundance/library size) × 106. Additionally, the normalized TP1M value was divided by the number of targets to which it perfectly matched. The red line indicates the position of the predicted cleavage site as confirmed by an aligned degradome tag.
Known and novel targets of conservative microRNA (miRNA) families that were identified in Pellia endiviifolia and confirmed by the degradome data for the in vitro samplesBased on Pfam domains and gene ontology (GO) terms;Conserved miRNA targets;Cu-transporting P-type ATPase (HMA8) delivers Cu to plastocyanin in the thylakoid lumen. CDS, coding DNA sequence; StAR, steroidogenic acute regulatory protein.Target plots (T-plots) for Pellia endiviifolia microRNA (miRNA) targets. T-plots (German et al., 2008) are shown for known P. endiviifolia miRNA targets that are (a) conserved across the land plants and (b) new, validated using degradome data and corresponding to the targets that are presented in Table5. Each T-plot is accompanied by a duplex of miRNA and its target mRNA. For miR408 targeting homologous mRNAs and recognizing/cleaving the same sequence, only one example of each group of targets is shown (four T-plots). TP1M is the normalized abundance based on the formula TP1M = (raw abundance/library size) × 106. Additionally, the normalized TP1M value was divided by the number of targets to which it perfectly matched. The red line indicates the position of the predicted cleavage site as confirmed by an aligned degradome tag.We also used the degradome data to search for mRNA targets for novel, liverwort-specific miRNAs. For 13 of 42 novel P. endiviifolia miRNAs, we found 14 target mRNAs. Two targets represent unknown sequences encoding putative proteins. For 12 of these targets, we were able to predict polypeptide sequences and annotate known protein domains (Table6). At least two of the targets contain domains that are typical for transcription factors (APetala2 and Auxin/Indole-3-Acetic Acid (AUX/IAA)). In the case of pen_U16671 cDNA, we found three miRNAs that recognized the same target site and represent a new family of miRNAs. In our data set, we also found a single miRNA (pen-miR8164) that targets three different mRNAs. These examples mirror very well the properties of the miRNA-target networks that have been reported in land plants (for a review, see Rubio-Somoza & Weigel, 2011). According to the gene ontology – a molecular function classification based on Pfam domain annotations – the newly identified targets for the conservative and novel miRNAs encode mostly proteins, nucleic acids, and nucleotide-binding proteins or proteins having various catalytic activities (data not shown). Fig.7 shows T-plots of validated target mRNAs for novel P. endiviifolia miRNAs using the degradome data that correspond to the targets that are shown in Table6. Additionally, Table S6 contains all of the degradome data that have been obtained for the newly identified miRNAs.
Table 6
Coding DNA sequence (CDS) targets of 13 novel microRNAs (miRNAs) from Pellia endiviifolia as confirmed by the degradome data from the in vitro samples
miRNA family
miRNA species
Target
Domain descriptiona
Cleavage site
Cleavage region
pen-miR8156
a,b,c
pen_U16671
–
1432
CDS
A
pen_U37136
Armadillo/beta-catenin-like repeat and U-box (ubiquitin-protein ligase)
1325
CDS
B
pen_C1236-1
Nucleotide binding-ARC (ADP binding)
1229
CDS
pen-miR8158
pen_U7542
Auxin response factor, AUX/IAA, and B3 DNA binding
CBS/SIS and adenyl nucleotide/carbohydrate binding
1290
CDS
pen-miR8165
pen_U41210
BRCA1 C terminus (BRCT)
1978
CDS
pen-miR8166
pen_U2587b
APetala2 (DNA binding)
242
CDS
pen-miR8176
pen_C11045-1
TPR repeat
448
CDS
pen-miR8170
pen_U38378
HAUS augmin-like complex subunit 4
2062
3′ UTR
pen-miR8171
pen_U30616
PDZc (protein binding)
996
CDS
pen-miR8173
pen_U31475
NUDIX (hydrolase activity)
1074
CDS
Based on Pfam domains and gene ontology (GO) terms;
Transcript with weak similarity to known miR172 target AT4G36920 from Arabidopsis thaliana;
Acronym for PSD-95 (a 95 kDa protein involved in signaling in the post-synaptic density), Dlg (the Drosophila discs large protein), and ZO1 (the zonula occludens 1 protein involved in maintaining epithelial cell polarity); gray color indicates miRNA-target examples for which T-plots are presented in Fig.7. BRCA1, BReast CAncer 1; CBS/SIS, Cystathionine Beta Synthase/Sugar Isomerase; HAUS, Human AUgmin-like complex Subunit; NUDIX, NUcleoside DIphosphate linked to X; TPR, Tetratrico Peptide Repeat superfamily.
Figure 7
Target plots (T-plots) of validated target mRNAs for novel Pellia endiviifolia miRNAs using degradome data corresponding to the targets that are presented in Table6. The first T-plot shows the target coding sequences for three new microRNAs (miRNAs) representing a new miRNA family, pen-miR8156. The next two plots show the predicted slicing site for miR8158 and miR8166, representing the putative transcription factor mRNAs. TP1M abundance is normalized based on the formula TP1M = (raw abundance/library size) × 106. Additionally, the normalized TP1M value was divided by the number of targets to which it perfectly matched. Each T-plot is accompanied by a duplex of miRNA and its target mRNA. The nucleotides that are shown in red represent nucleotide mismatches within the miR8156 family. bp, base pairs.
Coding DNA sequence (CDS) targets of 13 novel microRNAs (miRNAs) from Pellia endiviifolia as confirmed by the degradome data from the in vitro samplesBased on Pfam domains and gene ontology (GO) terms;Transcript with weak similarity to known miR172 target AT4G36920 from Arabidopsis thaliana;Acronym for PSD-95 (a 95 kDa protein involved in signaling in the post-synaptic density), Dlg (the Drosophiladiscs large protein), and ZO1 (the zonula occludens 1 protein involved in maintaining epithelial cell polarity); gray color indicates miRNA-target examples for which T-plots are presented in Fig.7. BRCA1, BReast CAncer 1; CBS/SIS, Cystathionine Beta Synthase/Sugar Isomerase; HAUS, Human AUgmin-like complex Subunit; NUDIX, NUcleoside DIphosphate linked to X; TPR, Tetratrico Peptide Repeat superfamily.Target plots (T-plots) of validated target mRNAs for novel Pellia endiviifolia miRNAs using degradome data corresponding to the targets that are presented in Table6. The first T-plot shows the target coding sequences for three new microRNAs (miRNAs) representing a new miRNA family, pen-miR8156. The next two plots show the predicted slicing site for miR8158 and miR8166, representing the putative transcription factor mRNAs. TP1M abundance is normalized based on the formula TP1M = (raw abundance/library size) × 106. Additionally, the normalized TP1M value was divided by the number of targets to which it perfectly matched. Each T-plot is accompanied by a duplex of miRNA and its target mRNA. The nucleotides that are shown in red represent nucleotide mismatches within the miR8156 family. bp, base pairs.
Discussion
Because liverworts are thought to represent a basal group of land plants and because Pellia species are recognized as the most basal lineage of the simple thalloid liverworts, we studied the P. endiviifolia microtranscriptome and compared it with miRNAs from green algae and land plants. Additionally, despite the dramatic increase in the number of identified miRNAs in vascular plants, there is little evidence of their occurrence in bryophytes and algae (Zhang et al., 2010; Kozomara & Griffiths-Jones, 2014). To our knowledge, no miRNAs have been identified for the liverwort phylum, and our study provides the first detailed analysis of the liverwort microtranscriptome. Altogether, we identified 486 miRNAs representing 345 families (311 conservative miRNA families and 34 novel miRNA families).The number of identified conserved miRNA families in P. endiviifolia is high and encompasses families from all other land plants: miRNAs that are present exclusively in the moss P. patens (e.g. miR538, miR894, miR904, and miR1030), the spike-moss S. moellendorffii (e.g. miR1097), monocots (e.g. miR435, miR528, and miR812), and other individual species representing vascular plants (see Table S2). This number is higher than the number of miRNA families that are recognized in the best studied model plant, A. thaliana (193) (Kozomara & Griffiths-Jones, 2014). The Venn diagram showing the distribution of miRNA families among the taxonomic groups (see Fig.1) highlights 11 miRNA families that are present in plant species representing all other Viridiplantae taxa excluding Chlorophyta. Cuperus et al. (2011) reported eight miRNA families that were present in the common ancestor of all embryophytes (miR159/miR319 were classified as one family). Our studies confirm the presence of these eight (nine considering miR159 and miR319 separately) old miRNA families in the liverwort P. endiviifolia. Additionally, we were able to add two ancient miRNA families that were present in P. endiviifolia and other land plants. We added miR396, which is present in plant species representing all vascular plants but has not been identified in P. patens, and miR535, which was identified in P. patens and other embryophytes (Table1).Surprisingly, we discovered the presence of three miRNA families that are common exclusively to liverworts and Chlorophyta (Table3). This result is unexpected because, until now, algal and land plant microtranscriptomes were considered to represent distinct domains. However, different experimental data suggest that the ancestor of all land plants was closely related to charophycean green algae similar to extant Charophytes. Assuming that liverworts are the most basal lineage of land plants, it is reasonable and evolutionarily attractive to find common miRNAs in the Chlorophyta species and liverwort representative P. endiviifolia. Because the liverworts from the genus Pellia that were collected in the field contain endophytic Glomeromycota fungi and algae (Ligrone et al., 2007), we set up an in vitro culture of P. endiviifolia male and female thalli (Fiedorow et al., 2001) that was alga- and fungus-free. Therefore, we further considered only those liverwort miRNAs exhibiting a high similarity to algal miRNAs or to algal sRNAs that were present in the sRNA deep-sequencing results when they were obtained from the RNA that was isolated from P. endiviifolia thalli that were grown in vitro and that produced a hybridization signal when analyzed by the northern technique. In addition, examining the P. patens and S. moellendorffii miRBase data for the presence of homologous chlorophycean sRNAs gave no positive outcome. Our results strongly indicate that P. endiviifolia, a liverwort representative, shares common molecular traits that might be exclusive for liverworts and algae. However, more extensive molecular studies on the microtranscriptome of other liverwort species need to be performed to support our hypothesis.Our analyses also permitted the identification of 42 novel miRNAs belonging to 34 miRNA families that are at least P. endiviifolia- or liverwort-specific and are not present in P. patens or other land plants. Additionally, for 15 of the 42 novel miRNAs, we detected 17 primary transcripts. All of the new pri-miRNAs are able to fold into stem-loop structures containing miRNA and miRNA* in the stem region (see Fig. S6). Moreover, for all of the novel pri-miRNAs, we detected their cognate miRNA* in our sRNA sequencing results. For eight of the novel miRNAs, we identified their corresponding genes (see Table4). Pen-miR8185, for which we were able to identify both its gene and pri-miRNA, exhibits high similarity to one of the C. reinhardtii sRNAs. The fact that we identified pen-miR8185, which is homologous to one of the C. reinhardtii sRNA, as well as its precursor in the P. endiviifolia transcriptome data and its gene in the P. endiviifolia genome provides strong evidence of the presence of miRNAs that are homologous to algal miRNAs in liverworts.We were only able to identify two P. endiviifolia MIR genes (MIR408-5p and MIR536) and nine primary transcripts encoding nine conservative land plant miRNAs for which miRNA* sequences were also found in our sRNA NGS data (see Table4; Fig. S6). Our results show that the length of the pri-miRNA fold-back fits into the standard range of plant pre-miRNA length and varies between 55 and 834 nt (Bologna et al., 2013). The minimum free energy (MFE) of the miR/miR* predicted structures varies between −9.4 and −365 kcal mol−1. The plant pre-miRNA fold-backs that were found in the miRBase display an average minimum free energy of −67.88 kcal (Ritchie et al., 2007; Kozomara & Griffiths-Jones, 2014). Thus, P. endiviifolia miRNA stem-loop structures show MFE values typical for other plant pre-miRNAs. The extended stem of the pre-miR stem-loop structure serves as a structural signal that is recognized by the plant pri-miRNA-processing machinery during base-to-loop processing (Mateos et al., 2010; Song et al., 2010; Cuperus et al., 2011; Bologna et al., 2013). Based on the predicted secondary structure of the P. endiviifolia pre-miR390/390a, we postulate a base-to-loop processing direction (see Fig. S6a). In angiosperms, this mechanism has also been demonstrated for pre-miR390a and pre-miR390b (Bologna et al., 2013). The same structural determinants of the pre-miRNA structure were found in the case of the novel pen-miR8166 precursor. We postulate that the precursor is also processed in the base-to-loop direction during miR8166 biogenesis. These results underline the similarity of liverwort miRNA precursors to those that have been identified in P. patens and vascular plants.To date, all of the MIR genes that have been identified in P. endiviifolia represent independent transcriptional units. Four of 10 MIR genes contain one or two introns. This result agrees with available data for angiosperms, in which the majority of miRNAs are encoded by independent transcriptional units rather than being hosted in the introns of protein-coding or noncoding genes (Szarzynska et al., 2009; Kruszka et al., 2013, 2014). In all of the identified liverwort intron-containing MIR genes, miRNA-bearing fold-back structures were found in the second or third exon, which is an unusual feature compared with other embryophyte MIR gene structures. In A. thaliana, only two of the 23 known intron-containing MIR genes contain miRNA stem-loop structures that are located in the second or third exon, while in barley, of 13 known intron-containing MIR genes, only two have been found with an miRNA fold-back structure in exon 7 or exon 10 (Kurichara & Watanabe, 2004; Szarzynska et al., 2009; Jia & Rock, 2012; Sobkowiak et al., 2012; Kruszka et al., 2013, 2014). However, to draw further conclusions, additional MIR gene structures are required, and we cannot eliminate the possibility that other P. endiviifolia MIR intron-containing genes contain an miRNA fold-back structure in the first exon. In P. patens, approximately one-fourth of its known miRNAs are localized in close proximity to other MIR loci, suggesting that they are cotranscribed as polycistronic pri-miRNAs (Axtell et al., 2007). We did not find miRNA stem-loop structures in close proximity in the P. endiviifolia genomic sequences, which suggests a different organization of at least the liverwort MIR genes that were studied in this work.Degradome analyses that searched for P. endiviifolia miRNA-guided cleaved targets identified only three mRNAs that are conserved across embryophytes (Table5). For many other conserved miRNAs, only new targets have been found (Tables5, S5). In our analysis, only experimentally verified targets were considered. Lenz et al. (2011) showed that plant cross-species-conserved miRNA-target pairs are mainly associated with developmental processes and transcriptional regulation. According to their results P. endiviifolia has miR160 and miR166 but not miR408 targets. For many other conservative miRNAs that target common transcription factor mRNAs in vascular plants, we found orthologous sequences in the P. endiviifolia transcriptome but were unable to identify miRNA-guided cleavage products within the degradome data. This result can be explained in two ways: there is no target conservation for conservative liverwort miRNAs, or conservative targets were expressed at very low levels in the studied liverwort tissue, thereby preventing the detection of cleaved products in the degradome data.For 13 of the 42 novel miRNAs, the degradome data clearly confirmed the target predictions. Two of these miRNAs may represent transcription factors, while the others may represent different proteins of unknown function. Lenz et al. (2011) found that species-specific pairs (in A. thaliana) are involved in signal transduction and response to stress stimuli. Because the novel P. endiviifolia miRNAs were not detected in the moss P. patens, these miRNAs probably represent species-specific miRNAs; thus, their targets may be involved in the plant response to stresses.Our data show that the liverwort microtranscriptome landscape is very similar to that of other land plants. Newly discovered miRNAs probably represent species-specific examples, but at least some of these miRNAs may represent liverwort-specific molecules. Along with the unexpected identification of miRNAs with high similarity to algal miRNA and sRNA sequences, these results confirm the location of P. endiviifolia at the root of the land plant evolutionary tree of life.
Authors: Blake C Meyers; Michael J Axtell; Bonnie Bartel; David P Bartel; David Baulcombe; John L Bowman; Xiaofeng Cao; James C Carrington; Xuemei Chen; Pamela J Green; Sam Griffiths-Jones; Steven E Jacobsen; Allison C Mallory; Robert A Martienssen; R Scott Poethig; Yijun Qi; Herve Vaucheret; Olivier Voinnet; Yuichiro Watanabe; Detlef Weigel; Jian-Kang Zhu Journal: Plant Cell Date: 2008-12-12 Impact factor: 11.277
Authors: Jo Ann Banks; Tomoaki Nishiyama; Mitsuyasu Hasebe; John L Bowman; Michael Gribskov; Claude dePamphilis; Victor A Albert; Naoki Aono; Tsuyoshi Aoyama; Barbara A Ambrose; Neil W Ashton; Michael J Axtell; Elizabeth Barker; Michael S Barker; Jeffrey L Bennetzen; Nicholas D Bonawitz; Clint Chapple; Chaoyang Cheng; Luiz Gustavo Guedes Correa; Michael Dacre; Jeremy DeBarry; Ingo Dreyer; Marek Elias; Eric M Engstrom; Mark Estelle; Liang Feng; Cédric Finet; Sandra K Floyd; Wolf B Frommer; Tomomichi Fujita; Lydia Gramzow; Michael Gutensohn; Jesper Harholt; Mitsuru Hattori; Alexander Heyl; Tadayoshi Hirai; Yuji Hiwatashi; Masaki Ishikawa; Mineko Iwata; Kenneth G Karol; Barbara Koehler; Uener Kolukisaoglu; Minoru Kubo; Tetsuya Kurata; Sylvie Lalonde; Kejie Li; Ying Li; Amy Litt; Eric Lyons; Gerard Manning; Takeshi Maruyama; Todd P Michael; Koji Mikami; Saori Miyazaki; Shin-ichi Morinaga; Takashi Murata; Bernd Mueller-Roeber; David R Nelson; Mari Obara; Yasuko Oguri; Richard G Olmstead; Naoko Onodera; Bent Larsen Petersen; Birgit Pils; Michael Prigge; Stefan A Rensing; Diego Mauricio Riaño-Pachón; Alison W Roberts; Yoshikatsu Sato; Henrik Vibe Scheller; Burkhard Schulz; Christian Schulz; Eugene V Shakirov; Nakako Shibagaki; Naoki Shinohara; Dorothy E Shippen; Iben Sørensen; Ryo Sotooka; Nagisa Sugimoto; Mamoru Sugita; Naomi Sumikawa; Milos Tanurdzic; Günter Theissen; Peter Ulvskov; Sachiko Wakazuki; Jing-Ke Weng; William W G T Willats; Daniel Wipf; Paul G Wolf; Lixing Yang; Andreas D Zimmer; Qihui Zhu; Therese Mitros; Uffe Hellsten; Dominique Loqué; Robert Otillar; Asaf Salamov; Jeremy Schmutz; Harris Shapiro; Erika Lindquist; Susan Lucas; Daniel Rokhsar; Igor V Grigoriev Journal: Science Date: 2011-05-05 Impact factor: 47.728
Authors: Dawid Bielewicz; Jakub Dolata; Andrzej Zielezinski; Sylwia Alaba; Bogna Szarzynska; Michal W Szczesniak; Artur Jarmolowski; Zofia Szweykowska-Kulinska; Wojciech M Karlowski Journal: Nucleic Acids Res Date: 2011-10-19 Impact factor: 16.971
Authors: Noah Fahlgren; Miya D Howell; Kristin D Kasschau; Elisabeth J Chapman; Christopher M Sullivan; Jason S Cumbie; Scott A Givan; Theresa F Law; Sarah R Grant; Jeffery L Dangl; James C Carrington Journal: PLoS One Date: 2007-02-14 Impact factor: 3.240
Authors: Santosh Kumar; Chase Kempinski; Xun Zhuang; Ayla Norris; Sibongile Mafu; Jiachen Zi; Stephen A Bell; Stephen Eric Nybo; Scott E Kinison; Zuodong Jiang; Sheba Goklany; Kristin B Linscott; Xinlu Chen; Qidong Jia; Shoshana D Brown; John L Bowman; Patricia C Babbitt; Reuben J Peters; Feng Chen; Joe Chappell Journal: Plant Cell Date: 2016-09-20 Impact factor: 11.277
Authors: Anna V Shchennikova; Alexey V Beletsky; Olga A Shulga; Alexander M Mazur; Egor B Prokhortchouk; Elena Z Kochieva; Nikolay V Ravin; Konstantin G Skryabin Journal: Plant Mol Biol Date: 2016-04-20 Impact factor: 4.076
Authors: Sarah B Carey; Jerry Jenkins; John T Lovell; Florian Maumus; Avinash Sreedasyam; Adam C Payton; Shengqiang Shu; George P Tiley; Noe Fernandez-Pozo; Adam Healey; Kerrie Barry; Cindy Chen; Mei Wang; Anna Lipzen; Chris Daum; Christopher A Saski; Jordan C McBreen; Roth E Conrad; Leslie M Kollar; Sanna Olsson; Sanna Huttunen; Jacob B Landis; J Gordon Burleigh; Norman J Wickett; Matthew G Johnson; Stefan A Rensing; Jane Grimwood; Jeremy Schmutz; Stuart F McDaniel Journal: Sci Adv Date: 2021-06-30 Impact factor: 14.136