Literature DB >> 25202497

Nuclear SSR markers for Miscanthus, Saccharum, and related grasses (Saccharinae, Poaceae).

Trevor R Hodkinson1, Mariateresa de Cesare2, Susanne Barth3.   

Abstract

PREMISE OF THE STUDY: We developed nuclear simple sequence repeat (SSR) markers for the characterization of the biomass crop Miscanthus, especially M. sacchariflorus, M. sinensis, and M. ×giganteus, and tested for cross-species amplification. • METHODS AND
RESULTS: Twenty-nine SSR markers (di- and tetranucleotide repeats) were developed from DNA sequences obtained from 192 clones from an enriched genomic library of M. sinensis. All markers were successfully amplified in M. sacchariflorus, M. sinensis, and M. ×giganteus, and 19 amplified across a broad range of Miscanthus species. Polymorphism information content and expected heterozygosity values (19 locus sample) were 0.88 and 0.89, respectively, for M. sinensis, 0.48 and 0.54 for M. sacchariflorus, and were the lowest in M. ×giganteus (0.33, 0.41). Thirteen out of 19 primer pairs showed cross-species amplification in non-Miscanthus sensu stricto taxa. •
CONCLUSIONS: The new set of 29 SSR markers will be of high value for characterizing Miscanthus germplasm collections, for prebreeding, and for assessing variation in natural populations.

Entities:  

Keywords:  Miscanthus; Poaceae; SSRs; Saccharum; cross-species amplification; microsatellites

Year:  2013        PMID: 25202497      PMCID: PMC4103459          DOI: 10.3732/apps.1300042

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Miscanthus Andersson is under development as a biomass crop and has been characterized by a wide range of markers including amplified fragment length polymorphism (AFLP; Hodkinson et al., 2002), restriction fragment length polymorphism (RFLP; Hernández et al., 2001), inter-simple sequence repeat (ISSR) PCR, and DNA sequences of nuclear and chloroplast regions generated using conventional (Hodkinson et al., 2002) and next-generation approaches including RNAseq and genotyping by sequencing (GBS; Ma et al., 2012). Simple sequence repeat (SSR) markers from maize and Brachypodium distachyon (L.) P. Beauv. (Hernández et al., 2001; Zhao et al., 2011) have been successfully applied to Miscanthus, and chloroplast SSRs have been developed by De Cesare et al. (2010). Some nuclear SSR markers have also been developed, such as those for M. sinensis Andersson, M. floridulus (Labill.) Warb. (Ho et al., 2011), and several other Miscanthus species (Zhou et al., 2011). However, there is a need to develop additional SSR markers for Miscanthus as the total number of available markers is limited. There is also a need to test these markers on a range of species, especially M. sacchariflorus (Maxim.) Hack., M. sinensis, and M. ×giganteus Greef & Deuter ex Hodk. & Renvoize as these comprise the main species of germplasm collections. SSRs developed from Saccharum officinarum L. expressed sequence tags (ESTs) have been recently used by Kim et al. (2012) to generate genetic maps of M. sacchariflorus and M. sinensis with genome coverage of 72.7% and 84.9%, respectively. The numbers of linkage groups found for the two maps (40 for M. sacchariflorus and 23 for M. sinensis) were higher than the basic chromosome number for Miscanthus (x = 19). Additional markers, such as those generated in this study, will be required to make more saturated maps, especially from noncoding regions that are underrepresented in current maps. Recently, single-nucleotide polymorphism (SNP) markers generated using GBS markers have been used for high-resolution mapping and identified all 19 linkage groups in M. sinensis (Ma et al., 2012).

METHODS AND RESULTS

DNA samples were either freshly extracted or obtained from the DNA bank at Trinity College, Dublin. Fresh leaves were frozen in liquid nitrogen and ground manually to a fine powder. Total genomic DNA was extracted following a modified cetyltrimethylammonium bromide (CTAB) method (Hodkinson et al., 2007). Total genomic DNA from the M. sinensis clone SW217 was used by ATG Genetics (Vancouver, British Columbia, Canada) to build a nuclear microsatellite–enriched library. After digestion with multiple 4-cutter restriction enzymes, enrichment for SSRs containing fragments was obtained through biotinylated TCn, TGn, and GATAn simple sequence motifs. The selected fragments were cloned into the EcoRI site of the plasmid pUC19 and screened for positive clones using 32P-labeled TCn, CAn, and GATAn simple sequence motifs. Two 96-well microtiter plates containing single positive bacterial colonies, one selected for the presence of dinucleotide repeats and the second for the presence of tetranucleotide repeats, were produced. The 192 clones were sequenced by AGOWA GmbH (Berlin, Germany), and SSRs were identified in the clones using ‘find microsat Win32’ (Salamin, unpublished). All 192 clones contained SSRs (96 dinucleotides and 96 tetranucleotides). Eighty primer pairs were designed equally among these sets using Primer3 software (Rozen and Skaletsky, 2000; http://frodo.wi.mit.edu/primer3/) and tested with PCR. Selection of the final sample of 29 primers was based on clarity of product on an agarose gel. Primer details and GenBank numbers are provided in Table 1.
Table 1.

Characteristics of 29 primer pairs developed for microsatellite genotyping.

LocusClone, GenBank accession no.Repeat motifFluorescent dyeForward primer sequence (5′–3′)Reverse primer sequence (5′–3′)Ta (°C)Sequence length (bp)SSR size (bp)
Mis-1SSR1A10, KF130838(TCTA)20FAMCAGTCCTTGGAGCAGGCTATAAGATCTCAAACCTATAGTC5420280
Mis-13SSR1F10, KF130839(TAGA)19ROXCGGACTAACTTGTGAATCTTGTCCTTGGAGCAGGCTATGA5423076
Mis-14SSR1F12, KF130840(GATA)15FAMGTAGCTGCAACTGCTAGTGTACTCGCATTGGTTGGTATGA5914160
Mis-15SSR1F2, KF130841(ATCT)16FAMACTACTGCATGCATCATGATGTGCTTCGCGGCGAAGTTTCA5919564
Mis-16SSR1F5, KF130842(TATC)13/(TCTA)16VICATCTTGCCTAGGATGCATTAGTGGTCTATTACAACAAGGCT6026452+64*
Mis-20SSR1G12, KF130843(TCTA)17TAMRATAGCTGAGCTGTCTATGGTATAGCCATTGAGGCTAAGGAT5424968
Mis-22SSR1G8, KF130844(TAGA)17VICCGAGCGAGCCTGCATGTGTGTTGACGTCAGCAAGATATTG5417368
Mis-23SSR1G9, KF130845(ATCT)15TAMRACACGAACTGAATCAGCATGCGTAGCTGCAACTGCTAGTGT6024060
Mis-24SSR1H10, KF130846(AGAT)15VICATACACGATCCAAACATGTCATGTGCTCACCCAAGAGATG6032460
Mis-33SSR2B7, KF130847(CT)20TAMRATGACATAGGGCTACACATATCGAGTGAGGCAGCTAGTTCA4824240
Mis-37SSR2D9, KF130848(TC)34FAMGAATGCAGTCATCAGCAGCTTGGACATCTCTAGGTTGATC5421868
Mis-41SSR2F5, KF130849(GA)24ROXATAATGCAGGTCAGTTCAACCGCAGCTAGCTGCTTGTCAG5422648
Mis-42SSR2F6, KF130850(AG)31FAMGCCGCCAGGCTCCCAAGCCTATCCGAGCCATGTATGCACG5420662
Mis-50SSR2H9, KF130851(GA)21ROXTACGGACGATTAACCAAGCCCGCAAGGTGCAGGACCATCA5423042
Mis-51SSR2G4, KF130852(TC)20FAMGATCCATCACGGATTCATCAATCATAGGCAAAACGGATCG6016440
Mis-52SSR2C11, KF130853(GA)19NEDTTATTGGTGCCCAAAGGTGTAACAAGCCCTCAAGCTTCCT6037038
Mis-53SSR2G10, KF130854(GA)19FAMAGGCAGCACCTCACAAAACTGGTGGAGATGCTCTTCTTGC6017338
Mis-54SSR2A11, KF130855(CT)18NEDTAAGAAACGCAGCAGCAGAAAGTCTCCGGCTTTCTCACAA6022636
Mis-55SSR2B9, KF130856(GA)18VICCGGCTTCGAGTGATACCTTTTACCGGATTTAAGGGGCTTT6025036
Mis-59SSR2B3, KF130857(GA)16FAMGAGCTGATCGCGTAGCAAGTTCGATAAACAGGGGATTGG6015232
Mis-60SSR2C3, KF130858(GA)16FAMAGATGGCAGCTTGCTCTTGTCCATTTGTTGAGCACGATGT6019032
Mis-63SSR1G3, KF130859(TCTA)14VICAGGCTAGCACTTCCTCCAAACTGCCTGGTGACCCCTATAA6023456
Mis-64SSR1G6, KF130860(AGAT)14NEDTCCCCTTAGTGTCCGTGAAGGAGGCAGGTGTAGTCGGAGA6023656
Mis-66SSR1D5, KF130861(CTAT)13VICCATGGCTACAGGCACCTAAAAATAACGAGAAATGGCCGATG6016552
Mis-69SSR1F4, KF130862(TCTA)13NEDCCTCTGCGGATATGAGGTGTGAAGTGACAACATGCGATGG6017552
Mis-70SSR1B10, KF130863(TATC)12NEDTCGCACCTTTAATTTTTGCATTTATGAACCCGACAGGGAGA6024948
Mis-71SSR1D3, KF130864(TAGA)12VICCAACCATGAGCACTTCTCCAAACATAGGAGGCCAAGCAAA6017948
Mis-78SSR2G11, KF130865(CT)15NEDTCTGCAGGTGACAAGGAAGAGTCAACCGGCATAGTTCGAT6016730
Mis-79SSR2G9, KF130866(CT)15VICGCCAACTCGTGGATTTGAGTCGTAGCAAGAGGGGAACAAA6024830

Note: Ta = annealing temperature.

*Compound SSR separated by a nonpolymorphic region.

Characteristics of 29 primer pairs developed for microsatellite genotyping. Note: Ta = annealing temperature. *Compound SSR separated by a nonpolymorphic region. Twenty-nine primer sets provided reliable amplification, and 19 of these were selected to have a mixture of di- and tetranucleotide SSRs. A template DNA volume of 1 μL (40 ng·μL−1) was amplified with an initial denaturation of 5 min at 95°C followed by 35 cycles each with a denaturation of 1 min at 95°C, 1 min at a primer-specific annealing temperature (Table 1), and an extension of 1 min at 72°C, followed by a final extension at 72°C for 10 min. The reaction mixture (final volume) contained 1× reaction buffer containing 2 mM MgSO4, 0.125 μM dNTPs, 0.25 μM of each primer, and 0.5 U of Taq DNA polymerase (New England BioLabs, Herts, United Kingdom). Five different fluorescent dyes were used for primer labeling to allow multiplexing, in pools (Table 1). A polyA treatment at 65°C was applied for 30 min to the PCR products. Undiluted PCR products were then sized using an ABI 3130xl automated DNA sequencer (Applied Biosystems, Carlsbad, California, USA) and the resulting peaks were scored with GeneMapper version 4.0 software (Applied Biosystems). All 29 primer pairs produced good amplification on eight test genotypes of M. sacchariflorus, M. sinensis, and M. ×giganteus, but 11 loci were not consistently amplified across our entire collection and were discarded from further analyses. Our final analysis therefore included 19 SSR markers. Allele number, size range, expected heterozygosity (He), and polymorphism information content (PIC) were calculated using PIC Calculator Extra (http://www.genomics.liv.ac.uk/animal/pic.html). He and PIC values were only calculated for M. sacchariflorus, M. sinensis, and M. ×giganteus because of sample size (Table 2).
Table 2.

Genetic properties of the newly developed markers for three Miscanthus species.

M. sacchariflorus (n = 9)M. sinensis (n = 73)M. ×giganteus (n = 15)
LocusASize range (bp)HePICASize range (bp)HePICASize range (bp)HePIC
Mis-12127–1610.3750.30519125–2560.9040.8963125–1610.3700.340
Mis-14287–1190.6630.6042587–2080.9280.924299–1190.5000.375
Mis-153144–1480.6200.54820144–2050.8620.8522146–1480.5000.375
Mis-202200–2340.3200.26928197–3000.9070.9012200–2340.4990.375
Mis-2211240.0000.00014103–1740.8370.81811240.0000.000
Mis-233191–2230.6250.55527191–3140.9350.9322203–2230.4990.375
Mis-2413310.0000.00021283–3610.9050.89913310.0000.000
Mis-375160–2000.7890.75627160–2220.9380.9353160–2260.5310.420
Mis-412214–2150.4440.34635197–5120.9240.91912140.0000.000
Mis-423206–2470.5600.49921163–2470.9090.9034183–2360.5740.500
Mis-502207–2560.4080.32525199–2600.8690.8592207–2560.4970.373
Mis-512136–1400.4630.35624132–1760.8870.87911400.0000.000
Mis-526177–2070.8060.77718170–2070.8630.8503177–2070.5570.457
Mis-545213–2360.7960.76318207–2440.8600.8484213–2240.6470.586
Mis-597135–1550.8400.82010123–1600.7920.7664148–1550.6780.618
Mis-644214–2580.7400.69230194–2860.9230.9182232–2580.4760.363
Mis-693130–1430.6120.54117105–1970.8610.8482130–1380.5000.375
Mis-703219–2370.5950.52626211–3280.9030.8972219–2250.5000.375
Mis-793242–2660.5400.46622235–2740.9040.8974224–2520.4790.427
Mean0.5370.4810.8900.8810.4110.333

Note: A = number of alleles; He = expected heterozygosity; PIC = polymorphism information content.

Statistics provided for species where sample size (n) was 9 or greater.

Genetic properties of the newly developed markers for three Miscanthus species. Note: A = number of alleles; He = expected heterozygosity; PIC = polymorphism information content. Statistics provided for species where sample size (n) was 9 or greater. Polymorphism at 19 microsatellite loci was studied in a collection of 166 individual grasses (Appendix 1), mostly belonging to the species M. sinensis, M. sacchariflorus, and M. ×giganteus. Fourteen individuals belonging to closely related genera were also included. All markers revealed considerable length polymorphism, with the number of alleles ranging from 13 to 44 per locus, with an average of 27.5 (Table 3). The loci amplified included a tetranucleotide repetition in nine cases and a dinucleotide repetition in the remaining 10. No major difference was observed between di- and tetranucleotide microsatellite loci in their ability to detect variation. Thirteen out of 19 primer pairs showed cross-amplification in non-Miscanthus species (Table 3). Average allele number was higher than the value of 12 found by Hernández et al. (2001) in a previous study using SSRs from maize. The higher number of clones used in our study (166 against 16 clones) and the introduction of species other than M. sinensis, M. sacchariflorus, and M. ×giganteus could account for the difference in allele number.
Appendix 1.

List of all accessions used in the study, source, and herbarium voucher number. All taxa are Andropogoneae subtribe Saccharinae unless indicated otherwise.

TaxonaSourcebVoucherc
M. sacchariflorus 1TCD Bot. GardensTCD P15
M. sinensis ‘Zebrinus’ 2TCD Bot. GardensTCD P20
M. sinensis ‘Zebrinus’ 3TCD Bot. GardensTCD P21
M. ×giganteus 4TCD Bot. GardensTCD P34
M. ×giganteus 5TCD Bot. GardensTCD P36
Miscanthus sp. 6TCD Bot. GardensTea-6
M. sinensis 7TCD Bot. GardensTCD P48
Miscanthus sp. 8TCD Bot. GardensTCD P50
M. sinensis 9TCD Bot. GardensTCD P51
M. sacchariflorus 10TCD Bot. GardensTCD P58
Miscanthus sp. 11TCD Bot. GardensTea-11
M. sinensis 13TCD Bot. GardensTCD P73
M. sinensis 14TCD Bot. GardensTCD P75
Miscanthus sp. 15TCD Bot. GardensTCD P104
M. transmorrisonensis 16TCD Bot. GardensTCD P105
M. ×giganteus 17TCD Bot. GardensTCD P108
Miscanthus sp. 18TCD Bot. GardensTea-18
M. sinensis ‘Goliath’ 19TCD Bot. GardensTCD P110, SIN-H6
M. ×giganteus 20TCD Bot. GardensTCD P114
Miscanthus sp. 21TCD Bot. GardensTea-21
Miscanthus sp. 22TCD Bot. GardensTea-22
Miscanthus sp. 23TCD Bot. GardensTea-23
M. sinensis 24TCD Bot. GardensTCD P11
M. sinensis 25TCD Bot. GardensTCD P11
M. sinensis 26TCD Bot. GardensTCD P11
Miscanthus sp. 27TCD Bot. GardensTea-27
Miscanthus sp. 28TCD Bot. GardensTea-28
Miscanthus sp. 29TCD Bot. GardensTea-29
M. sinensis 30TCD Bot. GardensTea-30
M. ×giganteus 31TCD Bot. GardensTea-31
M. ×giganteus 32TCD Bot. GardensTea-32
M. sinensis ‘Zebrinus’ 33TCD Bot. GardensTCD P20
Miscanthus sp. 34TCD Bot. GardensTea-34
M. sinensis ‘Gross Fontane’ 35TCD Bot. GardensTCD P30
M. sinensis ‘Gross Fontane’ 36TCD Bot. GardensTea-36
Miscanthus sp. 37TCD Bot. GardensTea-37
Miscanthus sp. 38TCD Bot. GardensTea-38
Miscanthus sp. 39TCD Bot. GardensTea-39
M. sinensis 40TCD Bot. GardensTCD P62
Miscanthus sp. 42TCD Bot. GardensTea-42
Miscanthus sp. 43TCD Bot. GardensTea-43
M. sinensis subsp. condensatus 44TCD Bot. GardensTCD P94
Miscanthus sp. 45TCD Bot. GardensTea-45
Miscanthus sp. 46TCD Bot. GardensTea-46
Miscanthus sp. 47TCD Bot. GardensTea-47
Miscanthus sp. 48TCD Bot. GardensTea-48
Miscanthus sp. 49TCD Bot. GardensTea-49
Miscanthus sp. 50TCD Bot. GardensTea-50
Miscanthus sp. 51TCD Bot. GardensTea-51
Miscanthus sp. 52TCD Bot. GardensTea-52
Miscanthus sp. 53TCD Bot. GardensTea-53
Miscanthus sp. 54TCD Bot. GardensTea-54
Miscanthus sp. 55TCD Bot. GardensTea-55
M. sinensis ‘Goliath’ 56Teagasc Oak ParkTea-56
M. sinensis ‘Goliath’ 57TCD Bot. GardensTea-57
M. sinensis ‘Sirene’ 58Teagasc Oak ParkTea-58
M. sinensis ‘Strictus’ 59TRH gardenTea-59
M. sinensis ‘Strictus’ 60TCD Bot. GardensTea-60
M. sinensis ‘Malapartus’ 61TRH GardenTea-61
M. sinensis 62TRH GardenTea-62
M. sinensis ‘Sirene’ 63TCD Bot. GardensTea-63
M. ×giganteus 64TCD Bot. GardensTea-64
M. ×giganteus 65TCD Bot. GardensTea-65
M. ×giganteus 66TRH GardenTea-66
Miscanthus sp. 68TCD Bot. GardensTea-68
Miscanthus sp. 69TCD Bot. GardensTea-69
Miscanthus sp. 70TCD Bot. GardensTea-70
Miscanthus sp. 71TCD Bot. GardensTea-71
Miscanthus sp. 72TCD Bot. GardensTea-72
Miscanthus sp. 73TCD Bot. GardensTea-73
M. ×giganteus 74Germany—from DenmarkTea-M1 Lasei 1
M. sacchariflorus × M. sinensis 75GermanyTea-M81 RH 81
M. sinensis 76Germany—from JapanTea-88-110
M. sinensis 77Germany—from JapanTea-88-111
M. sinensis 78Germany—from JapanTea-90-5
M. sinensis 79Germany—from JapanTea-90-6
M. sinensis 80Germany—from SwedenTea-SW 217
M. ×giganteus 81Germany—from DenmarkTea-M53 IPL 53
M. ×giganteus 82GermanyTea-M56 HAGA 56
M. ×giganteus 83GermanyTea-M63 GREIF 63
M. sacchariflorus 84Germany—from JapanTea-M11 MATEREC 11
M. sinensis ‘Goliath’ 85GermanyTea-M7 GOFAL 7
M. sinensis hybrid 86GermanyTea-M42 BERBO 42
M. sacchariflorus × M. sinensis 87GermanyTea-M43RH43
M. sinensis hybrid 88GermanyTea-M78 JESEL 78
Miscanthus sp. 89Oak ParkTea-89
Miscanthus sp. 90Oak ParkTea-90
Miscanthus sp. 91Oak ParkTea-91
Miscanthus sp. 92Oak ParkTea-92
M. ×giganteus 93IGER/TinPlant/Oak ParkTea-93
M. ×giganteus 94Old Trial Teagasc Oak ParkTea-94
M. sinensis 95SwedenTea-95
M. sinensis 96SwedenTea-96
M. sinensis 97SwedenTea-97
M. sinensis 98SwedenTea-98
M. sinensis 99SwedenTea-99
M. sinensis 100SwedenTea-100
M. sinensis 101SwedenTea-101
M. sinensis 102SwedenTea-102
M. sinensis 103SwedenTea-103
M. sinensis 104SwedenTea-104
M. sinensis 105SwedenTea-105
M. sinensis 106SwedenTea-106
M. sinensis 107SwedenTea-107
M. sinensis 108SwedenTea-108
M. sinensis 109SwedenTea-109
M. sinensis 110SwedenTea-110
M. sinensis 111SwedenTea-111
M. sinensis 112SwedenTea-112
M. sinensis 113SwedenTea-113
M. sinensis 114SwedenTea-114
M. sinensis 115SwedenTea-115
M. sacchariflorus × M. sinensis 116SwedenTea-116
M. sacchariflorus × M. sinensis 117SwedenTea-117
M. sacchariflorus × M. sinensis 118SwedenTea-118
M. sacchariflorus × M. sinensis 119SwedenTea-119
M. sacchariflorus × M. sinensis 120SwedenTea-120
M. sacchariflorus × M. sinensis 121SwedenTea-121
M. sacchariflorus × M. sinensis 122SwedenTea-122
M. sacchariflorus × M. sinensis 123SwedenTea-123
M. sacchariflorus × M. sinensis 124SwedenTea-124
M. sacchariflorus × M. sinensis 125SwedenTea-125
M. sacchariflorus × M. sinensis 126SwedenTea-126
M. sacchariflorus × M. sinensis 127SwedenTea-127
M. sacchariflorus 128TCD Bot. GardensTea-128
M. sacchariflorus 129TCD Bot. GardensTea-129
Miscanthus sp. 130TCD Bot. GardensTea-130
Miscanthus sp. 131TCD Bot. GardensTea-131
Saccharum officinarumTCD Bot. GardensTCD TRH s.n.
Cymbopogon citratusdTCD Bot. GardensTCD TRH s.n.
Zea diploperenniseTCD Bot. GardensTCD TRH s.n.
Sorghum halepense 6fRBG Kew 151 01Kew 1966-54209
Pennisetum sp.gTCD Bot. GardensTCD TRH s.n.
M. sinensis var. variegatus 1RBG Kew 154 04Kew 1969-19093
M. sinensis subsp. condensatus 7RBG Kew 151Kew 1969-19091
M. oligostachyus 16RBG Kew 151 (pot)Kew 1995-1864
M. nepalensis 25RBG Kew TH 4Kew 1985-8388
M. sinensis ‘Goliath’ 27ADAS Steinmann nurseriesKew MB93/02
M. sinensis ‘Gracillimus’ 28ADAS Piccoplant, GermanyKew MB94/05
M. sinensis ‘Roland’ 29ADAS Piccoplant, GermanyKew MB94/06
M. sinensis Anderss. 30ADAS Wye CollegeKew MB94/07
M. sinensis ‘Gross Fontane’ 31ADAS Genft Dogels, GermanyKew PN95/01
M. sacchariflorus 61RBG KewKew 1987-2727
M. sinensis ‘Yakushimanum’ 63RBG KewKew 1987-1148
M. transmorrisonensis 65RBG KewKew1990-2748
M. fuscus 82RBG KewKew 590
M. violaceus 84RBG KewKew 7437
M. ecklonii 86RBG KewKew 2347
M. junceus 88RBG KewKew 1060
M. junceus 89RBG KewKew 2309
M. ecklonii 105RBG KewKew 2929
M. ecklonii 106RBG KewKew 247
M. yunnanensis 107RBG KewKew 30689
M. nudipes 109RBG KewKew 2007
M. tinctorius 112RBG KewKew 1466
Saccharum spontaneum 117RBG KewKew Butt, 1977
Narenga porphyrocoma 120RBG KewKew 2092
Saccharum contortum 121RBG KewKew 3797
Spodiopogon rhizophorus 125RBG KewKew 283
Spodiopogon sibiricus 128RBG KewKew 210
Eulalia quadrinervis 134RBG KewKew 3294
M. sinensis ‘Morning Light’ 155RBG KewKew 1996 821
M. sacchariflorus 159RBG KewKew 3598 1935
M. sacchariflorus 160RBG KewKew 1984
M. tinctorius ‘Nana Variegata’ 161RBG KewKew 1996 1065
M. sinensis ‘Goliath’ 194ADASKew PN96/30

Numbers accompanying species names represent the DNA extraction identifier for this study.

Source abbreviations: ADAS = Agricultural Development Advisory Service (now Agriculture and Environmental Consultancy); IGER = Institute of Grassland and Environmental Research (now Institute of Biological, Environmental and Rural Sciences [IBERS]); RBG Kew = Royal Botanic Gardens, Kew, Richmond, Surrey, United Kingdom; TCD Bot. Gardens = Trinity College Dublin Botanical Garden, Dublin, Ireland; Teagasc Oak Park = Teagasc Oak Park Research Centre, Carlow, Ireland; TRH Garden = personal garden of first author.

Voucher abbreviations: Kew = Herbarium of the Royal Botanic Gardens, Kew, Richmond, Surrey, United Kingdom; TCD = Trinity College Dublin Herbarium, Ireland; Tea = Teagasc Oak Park Research Centre, Carlow, Ireland.

Andropogoninae, Andropogoneae (subtribe/tribe).

Tripsacinae, Andropogoneae.

Sorghinae, Andropogoneae.

Cenchrinae, Paniceae.

Table 3.

Cross-amplification of the newly developed microsatellites of Miscanthus.

Saccharinae
Miscanthus s.s.bMiscanthus s.l.cOther Saccharinae generaOther Andropogoneae/Paniceaed
LocusA (n = 166)eSize range (bp)eM. sacchariflorusM. sinensisM. sinensis subsp. condensatusM. ×giganteusM. transmorrisonensisM. tinctoriusM. eckloniiM. junceusM. violaceusM. nepalensisM. nudipesM. fuscusEulalia quadrinervisNarenga porphyrocomaSaccharum contortumSaccharum officinarumSaccharum spontaneumSpodiopogonfSorghum halepenseZea diploperennisCymbopogon citratusPennisetum sp.
Mis-120125–256++++++
Mis-143371–208++++++++++
Mis-1521144–205++++++
Mis-2033197–300+++++
Mis-2216103–174++++++
Mis-2330176–314++++++
Mis-2423248–361+++++++++
Mis-3733169–226++++++++
Mis-4144131–512++++++++
Mis-4229121–247++++++
Mis-5030199–260+++++++
Mis-5127132–176++++++++++++
Mis-5222132–207+++++
Mis-5420207–244++++++++
Mis-5913123–162+++++
Mis-6440177–286++++++++
Mis-6924105–220+++++++++++
Mis-7031211–328++++++
Mis-7934224–276++++++++++++
Average27.5

Cross-amplification in Miscanthus species, other Saccharinae, other Andropogoneae, and Paniceae (+ = yes; – = no).

Miscanthus s.s. (Asian Miscanthus with basic chromosome number of 19).

Miscanthus s.l. (GrassBase—The Online World Grass Flora [http://www.kew.org/data/grasses-db.html]).

Sorghum is classified in Sorghinae (Andropogoneae), Zea in Tripsacinae (Andropogoneae), Cymbopogon in Andropogoninae (Andropogoneae), and Pennisetum in Cenchrinae (Paniceae).

Total allele number and size range in base pairs (bp) for 19 nuclear SSR markers across all samples.

Spodiopogon rhizophorus and S. sibiricus.

Cross-amplification of the newly developed microsatellites of Miscanthus. Cross-amplification in Miscanthus species, other Saccharinae, other Andropogoneae, and Paniceae (+ = yes; – = no). Miscanthus s.s. (Asian Miscanthus with basic chromosome number of 19). Miscanthus s.l. (GrassBase—The Online World Grass Flora [http://www.kew.org/data/grasses-db.html]). Sorghum is classified in Sorghinae (Andropogoneae), Zea in Tripsacinae (Andropogoneae), Cymbopogon in Andropogoninae (Andropogoneae), and Pennisetum in Cenchrinae (Paniceae). Total allele number and size range in base pairs (bp) for 19 nuclear SSR markers across all samples. Spodiopogon rhizophorus and S. sibiricus. PIC and He values varied considerably among species (Table 2) and were the highest (0.88 and 0.89, respectively) for M. sinensis, 0.48 and 0.54 for M. sacchariflorus, and the lowest (0.33 and 0.41) in M. ×giganteus. The PIC value of M. sinensis (0.88) was consistent with the value of 0.83 in Hernández et al. (2001), both are higher than the average PIC value recently found by Zhao et al. (2011) in a study examining transferability of 49 microsatellite markers from Brachypodium distachyon to M. sinensis. In the past few years, the first nuclear microsatellite markers for Miscanthus have been developed (Hung et al., 2009; Ho et al., 2011; Zhou et al., 2011). Both studies from Zhao et al. (2011) on transferability from Brachypodium P. Beauv. and from Hung et al. (2009) on nine new microsatellite loci specific for Miscanthus, were limited to M. sinensis, thus explaining the low level of polymorphism found compared to the markers in this study. Zhou et al. (2011) extended the test for their 14 newly developed markers to M. floridulus, M. lutarioriparius L. Liu ex S. L. Chen & Renvoize, and M. sacchariflorus, increasing the average number of alleles found to 16.1 and the PIC value to 0.76. A different approach was used by Ho et al. (2011) to develop 12 new SSR primer pairs for Miscanthus. They designed primers based on genic microsatellite loci (EST-SSRs) obtained through transcriptome sequencing and detected an average of 7.9 alleles per locus when tested on M. floridulus and M. sinensis.

CONCLUSIONS

The newly developed primers presented here were found to cross-amplify not only within Miscanthus species but also in other members of the Saccharinae, Andropogoneae, and Paniceae. They amplified DNA in Zea L. (Tripsacinae), Sorghum Moench (Sorghinae), Cymbopogon Spreng. (Andropogoninae), and Pennisetum Rich. (Paniceae). The primers are of high value for characterization of Miscanthus species and can be applied to other closely related genera including Saccharum L.
  8 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  SSR-based genetic maps of Miscanthus sinensis and M. sacchariflorus, and their comparison to sorghum.

Authors:  Changsoo Kim; Dong Zhang; Susan A Auckland; Lisa K Rainville; Katrin Jakob; Brent Kronmiller; Erik J Sacks; Martin Deuter; Andrew H Paterson
Journal:  Theor Appl Genet       Date:  2012-01-25       Impact factor: 5.699

3.  The use of dna sequencing (ITS and trnL-F), AFLP, and fluorescent in situ hybridization to study allopolyploid Miscanthus (Poaceae).

Authors:  Trevor R Hodkinson; Mark W Chase; Chigusa Takahashi; Ilia J Leitch; Michael D Bennett; Stephen A Renvoize
Journal:  Am J Bot       Date:  2002-02       Impact factor: 3.844

4.  Transferability of microsatellite markers from Brachypodium distachyon to Miscanthus sinensis, a potential biomass crop.

Authors:  Hua Zhao; Jiangyan Yu; Frank M You; Mingcheng Luo; Junhua Peng
Journal:  J Integr Plant Biol       Date:  2011-03       Impact factor: 7.061

5.  Development of microsatellite markers for Miscanthus sinensis (Poaceae) and cross-amplification in other related species.

Authors:  Hai-Fei Zhou; Shan-Shan Li; Song Ge
Journal:  Am J Bot       Date:  2011-06-23       Impact factor: 3.844

6.  Development of 12 genic microsatellite loci for a biofuel grass, Miscanthus sinensis (Poaceae).

Authors:  Chuan-Wen Ho; Tai-Han Wu; Tsai-Wen Hsu; Jao-Ching Huang; Chi-Chun Huang; Tzen-Yuh Chiang
Journal:  Am J Bot       Date:  2011-07-27       Impact factor: 3.844

7.  High resolution genetic mapping by genome sequencing reveals genome duplication and tetraploid genetic structure of the diploid Miscanthus sinensis.

Authors:  Xue-Feng Ma; Elaine Jensen; Nickolai Alexandrov; Maxim Troukhan; Liping Zhang; Sian Thomas-Jones; Kerrie Farrar; John Clifton-Brown; Iain Donnison; Timothy Swaller; Richard Flavell
Journal:  PLoS One       Date:  2012-03-16       Impact factor: 3.240

Review 8.  DNA banking for plant breeding, biotechnology and biodiversity evaluation.

Authors:  Trevor R Hodkinson; Stephen Waldren; John A N Parnell; Colin T Kelleher; Karine Salamin; Nicolas Salamin
Journal:  J Plant Res       Date:  2007-02-02       Impact factor: 3.000

  8 in total
  3 in total

1.  Development of molecular markers for invasive alien plants in Korea: a case study of a toxic weed, Cenchrus longispinus L., based on next generation sequencing data.

Authors:  JongYoung Hyun; Hoang Dang Khoa Do; Joonhyung Jung; Joo-Hwan Kim
Journal:  PeerJ       Date:  2019-11-11       Impact factor: 2.984

2.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

3.  Genetic diversity and population structure of Miscanthus lutarioriparius, an endemic plant of China.

Authors:  Sai Yang; Shuai Xue; Weiwei Kang; Zhuxi Qian; Zili Yi
Journal:  PLoS One       Date:  2019-02-01       Impact factor: 3.240

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.