Vitellogenin family gene expression does not increase Drosophila lifespan or fecundity.

One of the most striking patterns in comparative biology is the negative correlation between lifespan and fecundity observed in comparisons among species. This pattern is consistent with the idea that organisms need to allocate a fixed energy budget among competing demands of growth, development, reproduction and somatic maintenance. However, exceptions to this pattern have been observed in many social insects, including ants, bees, and termites.  In honey bees ( Apis mellifera), Vitellogenin ( Vg), a yolk protein precursor, has been implicated in mediating the long lifespan and high fecundity of queen bees. To determine if Vg-like proteins can regulate lifespan in insects generally, we examined the effects of expression of Apis Vg and Drosophila CG31150 (a Vg-like gene recently identified as cv-d) on Drosophila melanogaster lifespan and fecundity using the RU486-inducible GeneSwitch system. For all genotypes tested, overexpression of Vg and CG31150 decreased Drosophila lifespan and did not affect total or age-specific fecundity. We also detected an apparent effect of the GeneSwitch system itself, wherein RU486 exposure (or the GAL4 expression it induces) led to a significant increase in longevity and decrease in fecundity in our fly strains. This result is consistent with the pattern reported in a recent meta-analysis of Drosophila aging studies, where transgenic constructs of the UAS/GAL4 expression system that should have no effect (e.g. an uninduced GeneSwitch) significantly extended lifespan in some genetic backgrounds. Our results suggest that Vg-family genes are not major regulators of Drosophila life history traits, and highlight the importance of using appropriate controls in aging studies.

Introduction

Aging (senescence) is an almost universal process in multicellular organisms, in which organismal function and performance decline with age [1, 2]. Decreasing fertility and increasing mortality are general hallmarks of aging that are typically accompanied by a declining activity level, altered metabolic rate, and a higher susceptibility to predation, parasites and disease [3– 5]. Despite its ubiquity, patterns and rates of aging vary enormously among, and within species. A large body of theory and experiment explores the evolutionary causes of this diversity; however, the underlying molecular mechanisms are still poorly understood [6, 7].

Evolutionary life history (LH) theory generally assumes that allocation of energy among the competing demands of growth, development, reproduction and somatic maintenance lead to functional trade-offs among these processes [8, 9]. Consistent with this idea of resource allocation trade-offs, lifespan and fecundity are generally negatively correlated in comparisons among species [8, 10], A prominent exception to this pattern occurs in many social insects. In many ants, termites, and bees [11], reproductive females are both long-lived and highly fecund relative to other species. For example, queen black garden ants ( Lasius niger) can live for at least 28 years, while laying hundreds of eggs per day [12], and queen honey bees ( Apis mellifera) have a maximum lifespan of 3–5 years while laying thousands of eggs per day [13]. In contrast, most non-social insects have adult longevity of less than one year, and have lower fecundity than social insect queens [14].

Investigations in honey bees suggest that the Vitellogenin gene ( Vg) produces a yolk protein precursor that is synthesized in the abdominal fat body and acts as an antioxidant and promotes longevity in queen bees [15]. Differential expression of Vg has also been associated with the differences in lifespan between different kinds of worker bees: higher expression is seen in "winter bees" which have a lifespan of 10 months to 1 year, and lower expression in "summer bees" with a lifespan of 30–50 days [16– 18]. RNAi knockdown of Vg expression in workers resulted in lower oxidative stress resistance [19] and shorter lifespan [20]. In contrast, RNAi knockdown of Vitellogenin-encoding genes in the nematode Caenorhabditis elegans increased survival [21] and the expression of genes with similar function in the fruit fly Drosophila melanogaster (yolk protein genes) is negatively correlated with lifespan [22]. The strong support for a role for Vg expression in regulating lifespan and fecundity in honey bees, combined with conflicting results from other species, led us to ask if honey bee Vg has different functional properties than its homologs in other invertebrates. Specifically, we asked (1) if transgenic expression of honey bee Vg in fruit flies can regulate lifespan or fecundity, and (2) if over-expression of a related gene that is endogenous in flies has effects similar that of expression of honey bee Vg.

An extensive genetic toolbox allows time and tissue-specific manipulation of gene expression in D. melanogaster in ways that are not available in other organisms, and these techniques have been used to characterize the effects of many genes on fly lifespan and fecundity [23]. For example, manipulations of genes involved in the insulin signaling and the target-of-rapamycin pathways have been causally linked to lifespan regulation in flies (reviewed in [23, 24]). To our knowledge, however, the effects of Vg-family genes on aging-related traits have not been investigated in flies. Unfortunately, D. melanogaster lacks a direct homolog of honeybee Vg. Instead, gene CG31150, recently annotated as crossveinless d ( cv-d), encodes a Vg-like protein that is expressed mainly in the fat body [25]. The coding sequence for this gene is the most similar among all Drosophila genes to Vg-encoding genes in honey bee (37% similarity), C. elegans (40% similarity), chicken (38% similarity) and zebra fish (38% similar) [26]. CG31150 resembles other Vg family genes in having an N-terminal Vitellogenin N domain, DUF1943 Pfam motifs, and a partial von Willebrand Factor D (VWD) domain near the C terminus [25]. The biological functions of CG31150 are largely unknown, but it was recently implicated in lipid transport and bone morphogenic protein (BMP) signaling.

We used the bipartite GAL4/UAS system to manipulate the expression of both honey bee Vg and the endogenous CG31150 gene in flies, and to assess the effects of these manipulations on fly lifespan and fecundity. In this system, expression of a transgene is under the control of a promoter region derived from yeast, the Upstream Activation Sequence (UAS). This promoter region activates transgene expression only when it is bound to the GAL4 protein. Tissue-specific promoters enable spatial control of GAL4 protein production [27]. Temporal control of transgene expression can be achieved in several ways [28], but one of the most convenient methods is using constructs in which the GAL4 DNA binding domain is fused to a progesterone receptor transcriptional activation domain, and is therefore only activated by systemic application of a progesterone-receptor ligand [29– 31]. We used RU486 (mifepristone)-induced GAL4 drivers (also called the GeneSwitch system) to manipulate our target genes in adult fat body [32]. A major advantage of this system is that control flies (not exposed to RU486) have exactly the same genotype as transgene-expressing flies, so genetic background differences cannot contribute to differences in phenotype [33]. We manipulated the expression of both the honey bee Vg and D. melanogaster CG31150 in order to determine whether either or both can regulate lifespan or fecundity in flies. We included two constructs of each gene to account for potential position effects. We also included a series of controls to take into account possible phenotypic effects of RU486 or of the expression of the GAL4 protein [34, 35].

Materials and methods

Drosophila stocks and maintenance

The GeneSwitch driver strain S106 ( w ; P{Switch1}106) and UAS-GFP strain (P{UAS-GFP.VALIUM10}attP2) were obtained from Bloomington Drosophila Stock Center. To control for position effects, we used two different transgenic strains for both Vg and CG31150, with the transgene inserted onto different chromosomes: CG31150-2 ( w , UAS- CG31150-2/FM6), CG31150-4 ( w , UAS- CG31150-4/TM3), Vg-1 ( w , UAS- Apis VGD13-1/FM6), Vg-2 ( w , UAS- Apis VGD13-2/TM3). These constructs were created by Eric Spana at the Duke University Model Systems Genomics Core Facility as follows. For the Vg constructs, four cDNAs were identified as Apis Vg from database searches, and obtained from RIKEN. All four were sequenced on both strands, and one, BH10008D13 was chosen for subsequent cloning as it matched the published sequence best. Site directed mutagenesis was used to remove an ATG from the parental cloning vector (CATTATACGAAGTTA GGGATCAGGCCAAATCGGCCG where the underlined G marks the nucleotide that was changed from a T) so that a NotI/KpnI double digest would excise the Vg cDNA from the vector and not contain an incorrect start codon. The NotI/KpnI fragment was then ligated into a NotI/KpnI linearized pUAST. The subsequent clone was verified by sequencing on both strands, and pUAST- Apis_ Vg was then transformed into Drosophila as described below. For the CG31150 constructs, cDNA GH05619 was available in the “Gold Clone” collection and was obtained from Robin Wharton (Duke University Medical Center). The cDNA was excised from GH05619 using EcoRV & XhoI and ligated into pUAST that had been digested by EcoRI, filled in with Klenow to make a blunt end, and then digested with XhoI to make compatible ends with the insert. The pUAST- CG31150 plasmid insert was sequenced on both strands. pUAST- Apis Vg and pUAST- CG31150 plasmid inserts were transformed into w by Model System Genomics of Duke University by standard techniques. All transgenic flies were mapped and balanced. Transgene sequences are shown in Supplementary Table S1.

Supplementary Table S1.

cDNA sequences of Apis Vg and Drosophila CG31150 in the transgenic constructs.

Gene	Sequence
Vg	GGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGCTCTATTAGGTG ACACTATAGAACCAGACTTTCTCGAAAGTTGTCTTCAACATGTTGCTACT TCTAACGCTTTTACTGTTCGCGGGGACAGTTTCAGCCGACTTCCAGCACA ATTGGCAAGTCGGGAATGAGTACACGTATCTCGTTCGAAGTCGCACGTTG ACGAGTCTGGGCGATCTGTCGGACGTGCATACCGGTATTCTGATAAAGGC GTTGCTCACCGTACAGGCGAAGGATTCAAACGTGCTTGCCGCCAAAGTGT GGAACGGCCAATATGCTCGTGTCCAACAGTCCATGCCTGACGGATGGGAA ACGGAGATCTCCGACCAAATGTTGGAGCTCCGTGACCTGCCTATTTCCGG CAAACCGTTCCAGATCAGGATGAAACACGGTTTGATCAGGGATCTGATCG TTGATCGCGACGTCCCCACTTGGGAGGTGAACATACTCAAGAGCATCGTT GGCCAACTGCAAGTGGACACTCAAGGTGAAAACGCCGTGAAGGTGAACAG CGTGCAAGTTCCGACCGACGACGAGCCGTACGCCTCGTTCAAAGCCATGG AGGACTCCGTGGGAGGGAAATGCGAGGTTCTCTACGATATAGCGCCTTTG TCGGACTTTGTGATCCACAGATCGCCGGAATTGGTGCCGATGCCGACGTT GAAGGGCGATGGCCGCCACATGGAGGTGATCAAGATCAAGAACTTCGATA ACTGCGATCAAAGGATAAATTATCATTTCGGTATGACGGATAACTCGAGG TTGGAACCTGGAACGAACAAGAATGGAAAGTTCTTCTCGAGATCTTCAAC GAGCAGAATCGTTATCTCAGGAAGCCTGAAACATTTCACCATCCAATCGT CGGTGACCACGAGCAAGATGATGGTCAGCCCTAGACTCTACGATCGTCAA AACGGATTGGTGCTTAGCAGAATGAACCTGACTTTAGCAAAGATGGAGAA AACGTCGAAACCTTTGCCCACGGTCAACAATCCAGAATCCACTGGCAATT TGGTTTACATCTATAACAATCCTTTCTCGGATGTCGAGGAGCGCAGAGTC AGTAAAACAGCCATGAATTCCAACCAGATCGTTTCGGACAACTCTCTCAG CTCGAGCGAAGAAAAGTTGAAGCAAGATATTCTGAACCTCCGAACTGATA TCAGTTCCAGCTCGTCCAGCATTTCCAGCAGCGAGGAGAACGATTTCTGG CAGCCTAAACCCACTTTGGAGGACGCTCCTCAGAATTCTCTGCTGCCCAA CTTCGTCGGGTACAAAGGGAAACACATTGGAAAATCCGGCAAAGTGGACG TAATAAACGCCGCCAAGGAGCTTATCTTCCAAATTGCCAACGAGCTTGAA GATGCGAGCAACATCCCCGTTCACGCAACCCTCGAGAAATTCATGATCCT TTGCAATTTGATGCGCACCATGAACAGGAAGCAAATAAGCGAGTTGGAGA GCAATATGCAGATCTCTCCCAACGAGTTGAAACCGAACGACAAGTCTCAG GTTGTCAAGCAGAATACATGGACAGTGTTTAGAGACGCCATTACCCAAAC TGGAACGGGACCTGCCTTCTTGACCATCAAGGAATGGGTCGAAAGGGGAA CTACCAAAAGCATGGAGGCAGCGAACATCATGAGCAAGCTTCCAAAGACT GTTCGCACGCCGACTGACAGCTACATCAGATCCTTTTTCGAACTGTTACA AAATCCTAAAGTGAGCAACGAGCAATTCCTCAACACCGCCGCCACCTTAT CGTTCTGCGAGATGATCCACAACGCCCAAGTGAACAAGAGGAGCATTCAC AATAATTATCCAGTCCACACGTTCGGTCGTCTTACGTCGAAACACGACAA CAGCCTCTACGACGAGTACATACCATTCCTGGAACGCGAGCTGAGGAAAG CCCATCAAGAAAAGGACAGTCCAAGGATCCAGACCTACATCATGGCTCTG GGAATGATCGGGGAACCCAAGATTCTGTCCGTGTTCGAGCCATATCTGGA AGGGAAACAGCAGATGACCGTGTTCCAGAGGACGTTGATGGTCGGCTCTT TGGGCAAATTAACCGAAACTAATCCGAAATTGGCACGCTCGGTTCTGTAC AAGATTTATCTGAACACGATGGAGAGCCACGAAGTCCGTTGCACCGCGGT CTTCCTTCTGATGAAGACCAATCCACCGTTGAGCATGTTGCAACGAATGG CGGAATTCACCAAGTTGGACACGAACAGGCAGGTGAACTCGGCCGTGAAA TCGACCATCCAAAGCTTGATGAAGCTGAAGAGCCCCGAATGGAAAGATCT CGCGAAGAAAGCTAGGAGCGTGAACCACCTTCTCACGCATCACGAATACG ACTACGAACTCTCTCGGGGATACATCGACGAGAAGATTTTGGAGAATCAG AACATCATCACCCACATGATCCTCAATTACGTGGGAAGCGAAGACAGCGT GATCCCGCGCATCCTCTACCTTACCTGGTACTCCTCCAACGGCGACATAA AAGTACCTTCCACCAAAGTGCTAGCCATGATCTCGAGCGTGAAATCATTC ATGGAGTTGAGCCTGAGGAGCGTGAAGGACCGAGAAACGATTATTTCGGC GGCCGAGAAGATCGCCGAGGAGTTGAAGATCGTCCCCGAAGAGCTCGTTC CTCTGGAAGGAAACTTGATGATAAACAATAAATATGCCTTGAAATTCTTC CCCTTCGATAAGCACATTCTCGACAAATTACCCACGTTGATCTCCAACTA CATAGAGGCTGTAAAGGAAGGAAAGTTCATGAACGTCAACATGTTGGACA CCTATGAGTCAGTGCACAGTTTCCCCACCGAAACCGGCTTACCATTCGTG TATACGTTCAACGTTATAAAGTTGACCAAGACAAGCGGAACTGTCCAGGC GCAGATCAATCCCGACTTCGCTTTCATCGCTAATTCGAACCTTCGCCTGA CCTTTTCGAAGAACGTGCAAGGAAGAGTAGGTTTCGTCACGCCGTTCGAG CATCGACACTTCATCTCCGGCATCGACTCGAACTTGCATGTGTACGCCCC CCTGAAAATCTCCCTGGACGTGAACACGCCCAAGGGCAACATGCAATGGA AGATCTGGCCGATGAAGGGCGAGGAGAAGTCGAGACTGTTCCATTACAGC GTCGTTCCATTCGTGTCCAACCACGATATTCTGAATCTTCGTCCCCTGTC GATGGAGAAGGGAACTCGACCGATGATCCCCGACGACAACACATCCCTCG CCCTTCCAAAGAACGAGGGACCGTTCAGATTAAACGTCGAAACTGCTAAA ACTAACGAGGAAATGTGGGAACTGATCGATACCGAGAAATTGACCGATCG TCTCCCCTACCCCTGGACCATGGACAACGAGAGATACGTGAAGGTAGACA TGTACATGAATTTGGAGGGGGAGCAGAAAGATCCTGTGATATTCTCCACG TCGTTCGACAGCAAGGTGATGACACGGCCCGACACGGATTCAGAGAACTG GACACCGAAAATGATGGCGGTCGAGCCGACGGACAAGCAGGCGAACAGCA AGACTCGTAGGCAAGAAATGATGAGGGAAGCGGGAAGGGGTATCGAATCG GCGAAATCGTACGTGGTGGACGTACGAGTGCACGTTCCTGGCGAGTCGGA GAGCGAGACTGTTCTCACCTTGGCCTGGTCGGAGAGCAACGTGGAGAGTA AGGGGCGATTGCTCGGTTTCTGGCGCGTCGAAATGCCGAGGAGCAACGCC GATTACGAGGTTTGCATCGGCTCTCAGATCATGGTCTCGCCGGAAACTCT TCTGTCCTACGACGAGAAGATGGACCAGAAGCCGAAGATGGATTTCAACG TGGATATCCGTTACGGGAAGAACTGCGGCAAAGGCGAGAAAATCGATATG AACGGTAAACTTAGGCAGAGCCCAAGGCTTAAGGAGCTGGTCGGGGCTAC GTCCATAATCAAGGATTGCGTGGAGGACATGAAACGGGGGAACAAGATAT TGAGAACGTGTCAGAAAGCTGTCGTACTGTCCATGTTGCTCGACGAGGTG GACATCTCGATGGAGGTCCCCTCCGACGCCCTTATAGCCCTTTATTCCCA GGGTCTCTTCAGCTTGAGCGAGATCGACAATTTGGACGTGAGCTTGGATG TCTCGAATCCCAAAAACGCCGGCAAGAAGAAGATCGACGTGAGGGCTAAG CTGAACGAGTACCTGGACAAGGCCGACGTGGTTGTCAATACGCCCATCAT GGATGCACATTTCAAGGACGTGAAATTGTCCGACTTTGGATTCAGCACTG AGGACATTTTGGACACTGCCGACGAGGACCTGTTGATTAACAACGTATTC TACGAGGATGAAACTTCCTGTATGCTGGACAAAACCCTTGCCCAGACGTT CGACGGCAAGGACTATCCTCTCAGATTGGGTCCCTGCTGGCACGCTGTCA TGACCACGTATCCTAGGATCAACCCGGACAATCACAACGAGAAACTTCAC ATTCCCAAGGACAAAAGCGTGAGCGTTCTCAGCCGGGAGAATGAGGCCGG GCAGAAGGAGGTGAAGGTATTGCTAGGAAGCGACAAGATCAAGTTCGTGC CTGGGACGACGAGCCAGCCGGAAGTGTTCGTGAACGGAGAGAAAGTCGTG GTGTCCAGGAACAAAGCTTATCAGAAGGTGGAAGAAAACGAGATCATTTT CGAGATCTACAAGATGGGTGATAGATTTATCGGTCTGACGTCTGACAAAT TTGACGTATCCCTGGCTCTGGACGGGGAACGCGTCATGCTCAAGGCGTCT GAAGATTATCGTTACTCCGTTCGCGGTCTCTGCGGCAATTTCGACCACGA CTCGACCAACGACTTCGTGGGACCCAAGAACTGCCTGTTCAGAAAGCCCG AACACTTCGTAGCCAGCTACGCTTTGATCAGTAACCAATGCGAGGGCGAC TCGTTGAACGTGGCGAAATCTCTTCAGGATCACGATTGCATCCGACAGGA GAGGACCCAGCAGAGAAACGTGATCAGCGACAGCGAATCGGGACGATTGG ACACCGAGATGTCGAGTTGGGGTTACCACCATAACGTTAACAAACATTGC ATGATCCACAGGACCCAGGTAAAGGAGACCGACGACAAGATCTGCTTCAC CATGCGTCCAGTGGTCTCTTGCGCGTCTGGTTGCACCGCCGTCGAGACGA AATCGAAGCCGTACAAGTTCCATTGCATGGAGAAGAACGAGGCCGCGATG AAGCTGAAGAAGAGAATCGAGAAGGGCGCCAATCCTGACCTCAGCCAGAA ACCTGTTTCCACCACCGAGGAATTGACCGTTCCTCTCGTCTGCAAGGCTT AACTCGAAAAATGTACTTTGTCGCTTTCTTTCGTTTAGAATAAATGTAGT TTTATAGCAGGTTATTTACTTTAATAAAATTCACTGTTTTCAATAAAAAA AAAAAAAAAACTCTCCAGCGCTGGATCCGGCCATAAGGGCCTGATCCTTC GAGGGGGGGCCCGGTACCT
CG31150	CACGAGGAACAGAGCGGACGTGTCGAGCTGTGATCCGGGAATTAGACGCG TTGGCGATAAAGGAGGAAAAGCGTCGGCTTCTTTGAAAAATCTGATAATA TACAGTCGCGTTGATATATATATTATATATAATATATATACATATATTCA CTGATACTACATTGAGAAATCTGTGCGCGAAGTGAAAAGCGTCGGAAGAT CTGTGGAAAAGCGAGTGCCACGACCTCGGAAGGAAGTAGCTAGTAGCAAG TAGCAGGCCATGAGGCTACTCAAGTGTTCCGTGTTTGTGTATCTGTTCCT GATCTTCGATGCCGGCCATGCCTTCAGCATCATTGGCCTCAACAAACAGA TGCTCTACGAGTACGAGGGCAATGTCCTGGTGGGTGCAAAGCCCCAGGAC GAGGGCCACCAGGCGCCACCCACCACCGGATGGATTGTGCGGGGCAAGCT GACGCTCCAGCGGCAAAGCGAGCTGGTCTTGGCTGCGGCGCTGGTCATAG ACGATGTAACGCTGAACAACTCCGGCGAGAAGTTCCTGCAGAACAAGGAG ATGTACCCGCCCTACAAGCCCTTCAAGATCGCTCTCACCAAGGATGGCGC CATCTCACATGTGGTCTTCAAGGAAGGCGATCCCATATGGAGCATGAACT TCAAGCGGGCCATCGCATCGGTGCTGCAGTTCCAGATGAAGTCCAGCGGG GCCTTCGTCGTGGATGAGCTGGGTATTCACGGCACTTGCCGCACGGAGTA CTTTGTGTCCAACAGGACAAACTACATCTCCATCCGCAAAACGCCGGAGG TCAAGACCTGCAAGCCGTACTCGGAGGCGGTTCACACTACACGCAGCAAC GTGCCGCCCAATACGTGCGAATTCGATCACCAGAAGAGTGTGATCATTGG CAATGAGGCCATCTACGGGATGTCACCGCACAACGAAACGGGTTACTATC TGAGCATGGCCCATGCCAAGGGCACAACCCTGATCCACACGTTCGAATCC ACGGGAGAAGCACAATTCATTAACTCGGAGTTGCTGCTCAATTTCCTTAA CGAGACGCCCATCGACAATCCCATCGATATTGAAACCTCAATGGCAGCAG AGCCATCCAACCTGGAGCTGCAGCGGCTGGATCCCAACGATCCCACTGGA GGTCGTAGCCCTCAGCAGCAGGAGACGCTGATTGCCCAGGCGGGGACGCT CTTAGACAGTCTGGCCGAAGCACTAGAGACAACGGAATTCAAGTTCTCGG AGCCCTACGACTCCACTCTCTCCGACGTGATCAAGCTTCTCAGCGAGATG GACTTTGATTCGCTCACTAAACTCTATCGGGAGGTGGACATTGGCACCTC CTATCGCCAGGAGACCATTCGCAACATCTTTCATGAAATCATTCCCCGCA TTGGAACTAAAGCATCCGTTTTTCTGACCCACCACCTGGTGCTCAACAAA TTGACTAAGCCGCAAATCGCTGTGCAACTGCTCATACCCATGCCATTCCA CATCTTCGAGCTCTCGGCGGAGTTGGTGCAAAAGTGCGAGGACTTCCTCA ATATCGGACCCGATCGCCCGGATGTGCGGCAGGCCGCTATCCTTAGCTTT GCCACGCTCATCCATAATGTCTATGTGGCCAAGGGCATCGATAAGGAAAA GTTTGAGGAGTATGTCCAGAAGTACTTTAATGCCTATCTAAGCGATCGCG ACTTCGACCAGAAGATGTTGTATCTGCAGGGTCTAAACAACTTGCAATTG GGGAACGTGGCCAACTATCTGGAGCCCATTGTTCAGGACCCCAACGAGCA CGAGGATCTGAAGTTCCAGGCCGCCTGGACGACCCTGGCACTGGCCGATC GTCGAGCGGAGCGCATATACGAGGTCTACTGGCCAATCTTTGAGTCCCGA AATGCCAGCCTAGAACTTCGTGTGGCAGCGGTTACGCTGCTATTGATTTC CAACCCCACGGCCGCCCGTCTCATCAGCATCCATCGCATCATTCAGAGCG AGACGGACCCTCACATGATTAACTACTACCGGACGACGGTGACGAGCATC TCGGAGACAACATATCCCTGCTATCAGCACCTACGCCGTCTGTTGTCCTA CATGCATCGTCATCTGCCCCAGAAGCCCGAGTCACGCTACTGGGTCACCG GTAACTACATCTTTGACTATCGCGACTCCAAGTTCGGCATCGGTGCAATG CTTCAGGTATTCCTCGTGGGCGATCCAAAGTCGGACATGCCAGTGGTGGC CTTCTTCAAATTCGACACCGAAGCTCTAGGCAAATTCACAGGACAACTGG CGCTATACATCAAGGCACGTGGGCTGCCAGATACCATCCTGAACAAGATG CAATCGCGAAATGGCAGCGATCCTTTTACCTTTAAGAGCATCAAGGCTCT ATTGGCCATGCTGCAGGCTCCGATCATCAACTCGAAGGACCTGCATCTGG AGTTCATCCTGCAAATGGAGGGCAAGACGGTGCTGTCGTACTACCTCAAC CAGCGGATGTTCCGGCAGCTGACCTACGACAACATTCTGGAAAGAATGCA GCAAATCATTCGGACAGACAGTCACATAAACATGCAGACTGTTCGTTGGC CTTTCATGAATCGCTACACGGTGCCCACGGTGCTGGGAACCTCCTCCGAC GTCCTGCTGCAGACCACCGTACTAACCTCGTTGCGTGGTAATATAACAGA GCAGCGGAACTCGCCCATAACCAAGCACACGCTGGAAATCGATGCCCGAT ACTCTTCATACGCCTCGGTGCGGAGTCGTAGCTACAATCCGTTCCTCAAC CTCGATCACGAGATCAACCGGGAGCAGGGCTTCCTCATCTACATCCCCTT TAGCAGCGAACTGCATCTGAACGAGAGTGGCAGTAAGTGCAGGCGCTACT CCTTCTCCCGACCCCAAAACCTGACCAGTGGCCTGTCCTTCAAGTCGCGG GCGGTGACCAAGACCAGGGGTTTGATCACGAAGACAGCGGCGGCGCCCTT CGAAGAGATCATGGTGCCCGAGGGTCGGAACGATGTGGTTCAACTATTTA GCTACCCAATGACGGATTTGGGCGTCCGACTGAGCATGACCACCAATCTC AACGAGCTCATCAAGTACAGGGGGATGCTGCTAAAGTCCGAGTTCACGGA GAATGGGTTCTCCGGCAATATGGTGGTCAATGCTTTGATGTACATATTTG GCTTCACCCAGCTAAGTTCCATACACCTGGGCCACGATCGCAACTTTACC ATGCTTATGTACAACGAGAAGAACACCAGGATCGAAGGTAACTTTTGTGC CGAAGACGTTTTGAAAACGTCGGACATGAAAGGCAAGCAGATCGGCCTTA CATTGGAGCACACGGACCACATGAACGAAAATCATGCTGCGGATGCACTT CATAGATGGAACATTACCCTGGACGTGCTGGCATCGACCAAGTCCAATTG GTTCAAGCTGACCGGCCAGGTTCAGCGAAATTCAAAGGATGACGAGGACG ACTGGAAGGCCTGCACCAAGTTGACCTATGAACCGCTGGTGTTTACCAAG CGACCTCACACTCTGAATGGCGATGTGGTGTTTGGCCTGGCCACCGAGGA GAGCGAGTGCCCGGAGAAGGGTTCCACGGTGCAGTTTGCAGCTAGAGCTG GTCCCTCGGAGCATGCCCGTGCCTTCCTCCGCTCCGACAAGATCTCGCTG ACGGACACCGACTTCTGTCCCAAGGAGGTACTGAAGTTCTCGCCCATACC CACTTCCAGGTATTGCAAGCGTAGCAACTTTGAGAACTTCACCTCGATCA CACAATACGACATGGACCTGAAGTTTGACAATATGCCCGCCTGGTTCGAG CTGTGGTCGAATCGACTGGACCACTTAGTGTCCGCCTTATCCGCCGACAA GGTGGACAGTCTGCATATGAGCCAGGAGATAAATATATCAATGCAAACTC CTCAGGACCAGTTCAGGCTGGCTGTGGAGGTCAACGGAGTGAAGTGGCGT TTCCATCAGATCCCCTTCTTCTACAAGCTGGACTCGAAGTTCGACGCTTC CCACGAGCTTACCTTCGACTCAGGACTTAAGCGCTCCTGCTCAGTAATCA ATGGCATAGTCAATACCTTCGATGATTACCTAATCAATCTCAGAGAGATT GCGGTGCGTCCCGACTGTCTCACGCTGCTGGTGGCTGACTGTTCGCCATT GCCACAGATTGCAGTGTTTGTTACGCCTTCGCCTGTTCAAGGACTGTCCA CCAACTATGGATTACGAGTCCATATCGGGCAAAACTACTTCAACTTCCGC GCCCGCACAGACAACAGCAGCCTGCCCACGGATGAACCAGTGCTCATATA TCTTAACCAGGATCAAACACCGCACAACGTGCGCAAAAAGCCATATCAAT GGCCAATTGAGACTAGTGACTACGACTTCCGCGTGGAACTTAACGAGCAA AATATTTTAATTGTGGAGTGTACGCAGCTGTCCTCCACCATCCAGTTCGA TCTGTACAACATCCTGAATTTCGAGATATACGGCGTGTATAAGCACCAGA TGTGTGGGCTGTGCAGCAAGCCCCTAAACCGCATGCAGAATTATACGATC TGCGAGCTGGAGGCAAACACTCCAACTCCTGTGCCGCTGCAGAATTCCTC CGATGTAGTTGTAGTTGCATAAATATAATGTGTGAGTTTAATCTAAAATA AAAAAAAGAGCCCAAAAAGGGAGAACATGCAAAAAAAAAAAAAAAAAACT CGAGGGTACCT

Overexpression of the target gene in each of the four genotypes was achieved by crossing each transgenic stock with the GeneSwitch strain S106. Strain S106 drives expression specifically in the fat body and also in the digestive system [32]. This driver has been widely used in aging studies; for example, over-expression of dfoxo and dilp6 using this driver have been shown to increase lifespan [36, 37]. To produce female flies that expressed the target transgene, virgin females from the S106 stock were crossed to males from each of the UAS-transgenic strains. Half of the female offspring from this cross were reared with RU486-supplemented media throughout adult life (see below), thus inducing transgene expression, but only during the adult stage. The remaining females from each cross were reared on media supplemented only with RU486 vehicle (ethanol), and should not have expressed the transgene. Therefore each group of flies that expressed one of the target transgenes had a genotype-matched control that differed only with respect to whether or not it was fed RU486 or vehicle.

To determine if RU486 exposure (or the GAL4 expression it induced) caused any change in lifespan or fecundity in these flies, we used an additional set of controls. We crossed the S106 driver strain to UAS-GFP flies, and exposed half of the female offspring to RU486 and half only to the ethanol vehicle. GFP is widely used as a reporter in D. melanogaster, and is believed to be non-toxic and not to influence endogenous gene expression at any stage during fly development [38]. Flies were kept on a 12:12 light: dark cycle at 25°C for their entire lifespan.

Media preparation

An RU486 (Mifepristone, Sigma, St. Louis, MO, USA) stock solution of 25mg/ml was made in 100% ethanol. Appropriate volumes of the stock were diluted with water to reach a final concentration of 65µg/ml, and 300µl of the diluted solution was added onto the surface of standard fly food (1.6% yeast, 0.92% soy flour, 6.76% cornmeal, 4.28% malt, 0.61% agar, 0.25% tegosept, 7.12% corn syrup, 0.61% propionic acid and 77.85% water).

Similar drug concentration and delivery methods have been widely used in aging studies [32, 35, 36], and our pilot data indicated that this concentration produced robust expression levels in the range that we desired (5–15 fold increase over non-induced controls). For the control food, an equal amount of 100% ethanol was diluted with water and added to the surface of standard fly food. Each type of food was made fresh twice per week. The vials were allowed to air dry for 48 hours prior to each transfer.

Lifespan assay

For each genotype tested, female offspring were collected within 24 hours of emergence and split equally into experimental and control groups. For each genotype, 96 females were reared on media supplemented with RU486, and 96 were reared on control media. Flies were housed in standard rearing vials (VWR) at a density of 6 females per vial. All rearing vials were placed randomly in 10 × 10 vial racks to control for possible position effects. The flies were transferred to new media twice per week, and were counted nearly every day. In addition, 3 replicates of 10 females each from each treatment group per genotype were collected separately to be assayed for target gene expression. For these replicates, flies were sampled at 7 days post eclosion; GFP/S106 flies were examined for GFP expression using Zeiss LSM 5 PASCA fluorescent microscopy (Zeiss, Germany), and Vg/S106 and CG31150/S106 flies were flash frozen on dry ice for quantitative PCR assays.

Fecundity assay

Females described above were placed in vials with males from a wild-type laboratory strain (described Remolina et al. [39]) when the females were 1 day old. 6 virgin females and 4 males were placed into each vial. The males were removed after 3 days, and females were transferred to new vials. Flies were transferred twice per week. After each transfer, the old vials were kept at 25°C, and all offspring eclosing within 14 days after the adults were removed and counted.

Quantitative PCR

For each genotype, we pooled 10 flies from each replicate and homogenized whole flies using cordless motors (VWR) and RNase-free pellet pestles (Kimbel Chase). Total RNA was extracted from whole bodies using a PicoPure RNA isolation kit (Arcturus), according to the manufacturer's recommended protocol. RNA purity and quantity were measured using a Nanodrop spectrophotometer (Thermo Scientific). RNA was DNase-treated with a DNA-free RNA kit (Zymo Research) and reverse transcribed using the Superscript III (Invitrogen). We conducted qRT-PCR using SYBR green master mix (Applied Biosystems), and ribosomal gene Rp49 as an endogenous control. The primer sequences were:

Rp49: F ‘TCGAACCAGGCGGGCATATTGT’, R ‘TCGAACCAGGCGGGCATATTGT’;

Vg: F ‘AGCTGGTCGGGGCTACGTCC’, R ‘TAAGGGCGTCGGAGGGGACC’;

CG31150: F ‘ACGGACACCGACTTCTGTCCCA’, R ‘TCGAACCAGGCGGGCATATTGT’

For transgenic GFP flies (UAS-GFP/S106), expression of GFP was assessed by fluorescent microscopy.

Statistical analysis

For each transgenic line, we compared Kaplan–Meier (product-limit) survival estimates between RU486- and vehicle-fed flies by using log-rank and generalized Wilcoxon chi-square tests of the homogeneity of survival functions between groups. These tests were conducted using JMP Pro 10 statistical software (SAS Institute Inc., Cary, North Carolina, United States). Log-rank tests are more sensitive to survival differences that occur late in life while Wilcoxon tests are more sensitive to differences earlier in life [40]. Results of both tests were consistent in all the analyses reported here, so we report only the log-rank test results. To determine if activation of transgene expression by RU486 had different effects in different genotypes, we use used Cox proportional hazard models with predictor variables that included genotype, RU486 treatment, and genotype-by-treatment interaction. A significant interaction in this model would indicate that genotypes responded differently to RU486 treatment. These tests were conducted using the phreg procedure of SAS v. 9.3. Flies that died accidentally or escaped during transfers were recorded as censored on the day they died or escaped. For fecundity assays, the mean age-specific fecundity for each vial was calculated by dividing the number of offspring by the number of female parents alive in the vial. We then compared fecundity among genotypes and treatment groups using repeated-measures ANOVA of mean fecundity, with age of the females as the repeated measure. These analyses were conducted in JMP Pro 10.

Results

Quantitative PCR confirmed that Vg and CG31150 were overexpressed by the GeneSwitch system

Flies carrying S106 GAL4 driver and each of the target genes, Vg-1, Vg-2, CG31150-2, CG31150-4, that were fed on RU486 had a >5 fold increase in target mRNA expression compared with their genetically matched controls ( Table 1). In addition, all 30 GFP/S106 flies that were fed on RU486 showed fluorescent green under the fluorescent microscope while none of their genetically matched controls did (data not shown).

Table 1.

Vg and CG31150 mRNA expression in each genotype after normalizing to Rp49.

Genotype	RU-		RU+		Fold change [2]
	RQ [1]	Standard Deviation	RQ [1]	Standard Deviation
Vg-1/S106	0.71	0.340	11.77	4.333	11.06
Vg-2/S106	0.63	0.198	26.68	23.134	26.05
CG31150-2/ S106	1.02	0.517	6.48	2.340	5.46
CG31150-4/ S106	1.18	0.240	9.97	8.038	8.79

1Target gene mRNA expression level is derived by relative quantification (RQ) after normalizing to Rp49.

2Fold change in target gene expression between RU486-exposed flies and the genetically matched non-fed control.

Increasing Vg and CG31150 expression does not extend lifespan in Drosophila

To test whether Vg or CG31150 overexpression affected lifespan in Drosophila, we examined survival of flies with overexpression of Apis Vg and Drosophila CG31150. Contradictory to the hypothesis that an increase in the target gene expression would increase lifespan, we observed no significant differences between control and overexpression flies for any of the four experimental genotypes tested ( Table 2, Figure 1a–1d). A proportional-hazards model indicated that there were no significant differences among the four Vg and CG31150 genotypes in their response to transgene activation (χ 2 = 0.97, df=3, p=0.81 for genotype-by-RU486 treatment interaction). As an additional control, we assessed whether the RU486 treatment itself was associated with changes in lifespan by comparing RU486-fed and vehicle-fed UAS-GFP/S106 flies. Surprisingly, the RU486-fed flies had a significantly longer lifespan than the controls in this comparison, indicating that RU486 itself (or the GAL4 expression induced by it) had a positive effect on lifespan in this assay ( Table 2, Figure 1e). Thus, the lack of lifespan-extending effects of Vg and CG31150 transgene expression were not due to confounding effects of the method of induction because this method appeared to increase, rather than decrease lifespan in this experiment.

Table 2.

Median lifespan of target gene over-expressing flies and their genetically matched controls, along with results of log-rank tests of homogeneity of survival curves.

Genotype	n	Median Lifespan (days)	χ 2	P
Vg-1/S106	89	70	1.903	0.168
Control	87	70
Vg-2/S106	85	71	0.004	0.952
Control	83	72
CG31150-2/S106	78	68	0.777	0.378
Control	77	72
CG31150-4/S106	85	71	1.269	0.260
Control	88	76
GFP/S106	81	81	11.751	<0.001*
Control	80	76

Figure 1.

Survival curves for flies either fed RU486 (red) or vehicle only (black, control).

No significant lifespan difference was observed between Vg or CG31150 overexpressed flies and their genetically matched control ( a– d). The negative control GFP/S106 had significantly longer lifespan when fed with RU486 ( e).

To determine if transgene expression had any effect on lifespan in the Vg and CG31150 lines, after accounting for the lifespan-extending effects of RU486 exposure, we compared the effects of RU486 across all genotypes. Proportional hazards models indicated that there was significant heterogeneity among genotypes in their response to RU486 treatment overall (χ 2 = 11.2, df=4, p=0.02), with RU486 exposure associated with significantly higher mortality in the Vg and CG3115 transgenic flies than in the GFP transgenic flies in each pairwise comparison (χ 2 = 6.5, df=1, p=0.01, hazard ratio = 1.77 for CG31150-2 vs GFP; χ 2 = 7.8, df=1, p=0.005, hazard ratio = 1.85 for CG31150-4 vs GFP; χ 2 = 8.23, df=1, p<0.005, hazard ratio = 1.87 for Vg-1 vs GFP; χ 2 = 4.0, df=1, p<0.05, hazard ratio = 1.56 for Vg-2 vs GFP). These results suggest that Vg and CG31550 transgene over-expression decrease fly lifespan because (1) GFP over-expression is unlikely to increase lifespan, and in one study was shown to decrease lifespan [41], and (2) if transgene expression had no effect in Vg and CG31550 lines, we should have observed a similar increase in lifespan in the RU486-fed flies driven solely by lifespan-extending effects of RU486 and/or GAL4 expression.

Increasing Vg and CG31150 expression does not increase fecundity in Drosophila

To investigate whether overexpression of Vg or CG31150 increased fecundity in Drosophila, we compared age-specific and lifetime fecundity between flies overexpressing these genes and genetically matched controls. We observed a significant overall reduction in fecundity of the RU486-fed flies in all UAS/S106 genotypes, including the control genotype GFP/S106 ( Table 3, Figure 2). The difference between treatments was greatest during mid-life at ages of peak egg-laying, and less at early and late ages (significant age-by-treatment effects were observed in every genotype, Table 3, Figure 2).

Table 3.

Mean lifetime fecundity targetgene over-expressing flies and their genetically matched controls, along with results of ANOVA tests of treatment and age-by-treatment interaction effects.

Genotype	Lifetime fecundity	Treatment effect		Age × treatment effect
		F (df)	P value	F (df)	P value
Vg-1/S106	70.854	0.353 (1,29)	0.003	5.436 (12,18)	<0.001
Control	84.830
Vg-2/S106	83.101	0.218 (1,30)	0.016	2.646 (12,19)	0.003
Control	97.515
CG31150-2/S106	62.166	0.318 (1,30)	0.004	2.512 (12,19)	0.004
Control	79.311
CG31150-4/S106	81.688	0.195 (1,30)	0.022	2.974 (12,19)	0.001
Control	94.750
GFP/S106	81.320	0.477 (1,30)	<0.001	2.593 (12,19)	0.003
Control	97.651

Figure 2.

Fecundity experiments on flies either fed on +RU486 (blue) or –RU486 (red).

For all of the 5 genotypes tested, the overexpression flies had lower lifetime fecundity than the control. Age × treatment effects were also significant for all phenotypes.

In two-way ANOVA models that included all genotypes, there was no significant genotype-by-treatment interaction (F=0.111, df=4,149, p=0.978) indicating that all transgenic lines, including GFP/S106, responded similarly to RU486 exposure. It therefore appears likely that the decline in fecundity in transgene-expressing flies is caused by RU486 itself or by the expression of GAL4, rather than target-gene overexpression.

Lifespan raw data: For each genotype, the death date for each individual was recorded. When a fly died of unnatural causes, the date was recorded under the columns titled “censored”. “Emerged” refers to the date that the individual enclosed. “Cell #” indicates the position of the vial in the 10 × 10 vial racks. Fecundity raw data: For each genotype, the number of offspring that enclosed before the day of transfer was recorded, along with the number of mothers that were alive at the time. “Cell #” indicates the position of the vial in the 10 × 10 vial racks. qPCR raw data: Target gene mRNA expression level is derived by relative quantification (RQ) after normalizing to Rp49. CT, CT mean and CT standard deviation were calculated.

Click here for additional data file.

Discussion

In this experiment, Vg and CG31150 overexpressing flies and their genetically matched controls did not differ significantly in lifespan. However, our negative control GFP/S106 showed significant increase in lifespan when fed RU486. The extended lifespan in the GFP/S106 flies is likely due to the supplement of RU486 in the diet or expression of the GAL4 protein, rather than GFP overexpression. If this lifespan-extending effect of RU486 and/or GAL4 activation also occurred in Vg- and CG31150-overexpresing lines we investigated, then over-expression of these genes likely had a corresponding negative effect on lifespan.

Vg and CG31150 overexpressing flies showed reduced fecundity comparing with their genetically matched controls. GFP/S106 flies fed with RU486 showed a quantitatively similar reduction in fecundity. These results suggest that over-expression of Vg and CG31150 do not affect fecundity in Drosophila. Instead the effect is attributable to RU486, the expression of GAL4, or both.

Tarone et al. (2012) [42] reported that expression levels of Drosophila yp family genes were negatively correlated with longevity among genotypes derived from a natural D. melanogaster population. These genes, while unrelated to Vitellogenins, are thought to carry out some functions normally associated with Vitellogenins (e.g., they are believed to comprise the major storage protein in fly embryos) [26, 43]. Similarly, our results suggest that Vg-family gene expression affects fly lifespan. This result contrasts with effects of Vg expression in hymenoptera [15, 16, 19, 44, 45]. The specific pathway through which these genes affect fly lifespan is not known, but our results suggest that it was unlikely due to trade-offs with fecundity, since no increase in fecundity was detected in transgene-overexpressing flies.

In addition to CG31150, three other Vg-family genes have been described in D. melanogaster [26], but their effects on aging have not been characterized. These genes include the major hemolymph lipid carrier ( apolpp) and regulators of interorgan lipid transport ( mtp and apoLTP). Products of these genes might therefore play major roles in regulating energy allocation and life history patterns, and future studies of their effects on aging-related traits are warranted.

In addition to testing effects of Vg and CG31150, our results highlighted the importance of using multiple controls in aging studies. If we had not used the GFP/S106 controls, we would not have identified the effects of RU486 exposure in increasing female fly lifespan and decreasing fecundity, and we would have concluded that expression of our target genes had no effect on lifespan and that they decreased fecundity. Aging-related phenotypes are sensitive to many environmental variables, genetic background, and interaction between genotype and environment. A recent meta-analysis of Drosophila aging experiments reported that transgenic constructs of the GAL4/UAS expression system that should have had no phenotypic effects (GAL4 alone, UAS alone, or noninduced GeneSwitch constructs) significantly extended lifespan in the w genetic background [46], consistent with our results. Other studies have reported significant reductions in lifespan caused by RU486 exposure in some genotypes [35], suggesting that strain-specific effects of RU486 exposure are common. Experiments using inducible transgenic constructs therefore require multiple sets of controls to reliably assay genetic regulation of aging phenotypes.

Data availability

F1000Research: Dataset 1. Drosophila lifespan and fecundity data set, 10.5256/f1000research.3975.d28311 [47]

Previous reports of a positive correlation between Vg gene expression and longevity in the hymenoptera prompted this interesting and timely test of Vg gene over-expression in Drosophila. The data show that there is no simple strong benefit to life span when over-expressing Vg genes in the Drosophila adult fat body, using the S1-106 Gene-Switch driver strain. In addition, because a life span increase was observed in a control cross involving over-expression of GFP, the results suggest possible effects of the drug, the activated Gene-Switch transcription factor, the GFP, or the variability of the assay. These results underscore the importance of careful controls for possible life span effects on the conditional gene expression system itself, independent of the specific identity of the gene being over-expressed.

The data are clearly presented and support the conclusions above, however, the generality of the conclusions must be tempered somewhat given the limited scope of the study.

In previous Drosophila studies life span extension was observed when transgenes were expressed with certain drivers, but not others, including some cases where the drivers tested had similar tissue specificities.  Those results indicate that the precise tissue-specificity and/or level of transgene expression can be important. In the present study the Vg transgenes were expressed using a Gene-Switch driver strain that yields expression in only a subset of the fat-body tissues, so it remains possible that over-expression of the Vg genes using a driver with more extensive expression pattern in the fat body and/or other tissues might create a life span increase.

The conclusions regarding the possible cause of the life span increase in the control cross are based on the assumption that over-expressed GFP has little or no phenotypic effect.  However the one Drosophila study cited reports a significant (negative) effect of GFP expression on aging phenotypes (using different drivers).  If GFP can have negative effects in some tissues it seems possible it might have positive effects when expressed in other tissues (for example, the “negative” effect of killing the IPCs or the germ cells can increase fly life span). For these reasons it is not clear whether the life span increase observed in the present study results from the drug, the activated Gene-Switch, or the GFP. Finally, it should be noted that this result was not replicated. These considerations limit the support for a possible negative life span effect of the Vg transgenes as suggested in the Abstract and Discussion.

I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

This is a well written, interesting and well executed study showing similarities between honey bee and  Drosophila vitellogenin, but with neither extending lifespan nor effecting fecundity when over expressed in flies. The study also offers an important lesson in using controls in UAS-GAL4 systems. The purpose was to ask whether the most closely related gene in  Drosophila to the  vitellogenin gene in honey bee is also involved in aging. This was a long shot from the level of homology but a question worth asking. The results were basically negative but the authors also found very clear and striking effects in the controls that anyone using the UAS-GAL4 system should be aware of.

There are several points that the authors should consider addressing in their revision: Summary:

Are all five of the transgenic sets on the same genetic background? It is not clear from the methods where the  w flies were sourced and there is no mention of backcrossing. If they came from different sources it is possible that the backgrounds might be different making comparisons across the five less meaningful. Even if the backgrounds are not exactly the same the on/off nature of the UAS-GAL4 system in the same lines still means the effects are real within each pair.

Another interpretation of the longevity results is that the honey bee  Vg and fly homolog both blocked the effect of GAL4 instead of the authors’ interpretation that over expression of both of these genes decrease lifespan. This is an important because it might be overreaching to interpret the results as a shortening of lifespan in general unless one assumes the effects of GAL4 and the  Vg genes are independent and additive.

The authors should start off the discussion with an important positive result they neglected to point out, that both the honey bee and the fly  Vg genes showed exactly the same effects on both longevity and fecundity. The consistent results from the two  Vg’s might be saying they share some functions. Hence the previously seen effect on aging is only in honey bees and not flies. I realise that this is a weak supposition given that fecundity was not changed and that only a control effect may have been reversed in the aging experiment, but the fact that both gave exactly the same results is consistent with the central hypothesis that the two have homologous functions.

I think there is a mis-wording at the end of the second sentence of the 5 th paragraph in the Discussion. Remove “ that they decreased”. The point is that fecundity was not reduced when you consider the effect seen in the control.

​Early on in the honeybee  vitellogenin story there was a suggestion that it increased lifespan by acting as an anti-oxidant. If this was the case then one might have expected to see an increase in lifespan in the  Drosophila as well. The fact that this did not happen suggests that honeybee vitellogenin is working in bees in another manner. On the other hand, antioxidants can decrease lifespan in some  Drosophila genetic backgrounds in which case they see  Vg’s functioning in exactly the same way in both flies and bees (assuming the GAL4 is additive). Although this is all speculative, it still might be worth going into a bit more detail about what is known and thought about the molecular mechanisms underpinning how  Vg effects aging in honey bees and more clearly define the  a priori predictions.

The title is appropriate

​

Abstract is adequate

Everything is well explained and presented

The conclusions are sound and sufficiently conservative, I do make some suggestions above.

I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.