| Literature DB >> 25003022 |
Tala Shi1, Ni Putu Desy Aryantini1, Kenji Uchida2, Tadasu Urashima1, Kenji Fukuda1.
Abstract
To optimize culture conditions that enhance production of a highly viscous exopolysaccharide of Lactobacillus fermentum TDS030603, a chemically defined medium was examined. The best yield was found to be 199 ± 23 mg/l when 48-hr cultivation was microaerobically performed at 30°C in the chemically defined medium supplemented with 5% glucose and 1% ammonium citrate without pH control. In response to the optimized exopolysaccharide production, the mRNA expression levels of epsB, epsE, and epsG elevated significantly. Our results indicated that the optimal C/N ratio and/or microaerobic condition can alter the expression levels of several exopolysaccharide biosynthesis-related genes promoting the exopolysaccharide production yield.Entities:
Keywords: chemically defined medium; gene expression; highly viscous exopolysaccharide; probiotics
Year: 2014 PMID: 25003022 PMCID: PMC4081186 DOI: 10.12938/bmfh.33.85
Source DB: PubMed Journal: Biosci Microbiota Food Health ISSN: 2186-3342
Fig. 1.Factors affecting on the EPS production of L. fermentum TDS030603.
(a) Glucose concentration versus semi-purified EPS yield; (b) ammonium citrate concentration versus semi-purified EPS yield; (c) aeration condition versus semi-purified EPS yield; (d) cell growth and purified EPS yield in MRS (solid bars), CDM (the non-optimized CDM, hollow bars) and CDMopt (the optimized CDM cultivated under microaerobic conditions, diagonal bars). All experiments were performed in triplicate, except for EPS purification from MRS in panel (d). * p<0.05.
Primers used for real-time quantitative PCR of the EPS-related genes and 16S rRNA in L. fermentum TDS030603
| Gene | Primer | Sequence (5’→3’) | Product size (bp) | |
| BF2 sense | GAAGGTAAGCACCCAAACCA | 60.0 | 234 | |
| BR2 antisense | ATCAAGAACCCAAGCACCAA | 60.5 | ||
| CF2 sense | ATCCGGACCAACATTCACTT | 59.3 | 214 | |
| CR2 antisense | TGGTTAACCCCTTTTGGTTG | 59.7 | ||
| DF2 sense | TATTCTGGAGGCGTTTTTGG | 60.1 | 205 | |
| DR2 antisense | AAACTCACGGGCCATTTTT | 59.4 | ||
| EF2 sense | CGAGTAGGCCGTAATGGAAA | 60.1 | 209 | |
| ER2 antisense | GGTCGTGGACCAATAAAGGA | 59.8 | ||
| FF2 sense | TCAAGCGGGTATTTGACTTCTT | 60.1 | 238 | |
| FR2 antisense | AACATTGGGCCATCAACATC | 60.6 | ||
| GF2 sense | GTTGGCCTTATGGAAGCAGA | 60.2 | 158 | |
| GR2 antisense | CAATTGAATCCCGAGTGAAAG | 59.6 | ||
| 16S rRNA | 16SF1 sense | GCGTTATCCGGATTTATTGG | 59.3 | 240 |
| 16SR1 antisense | CTGTTCGCTACCCATGCTTT | 60.3 | ||
Fig. 2.Relative expression of six EPS-related genes in CDM (solid bars) and CDMopt (hollow bars).
The amounts of mRNA expression of six EPS-related genes (epsB, epsC, epsD, epsE, epsF and epsG) in the cells obtained by cultivation in MRS, CDM and CDMopt were estimated by real-time quantitative PCR and normalized against the 16S rRNA gene. The normalized values of the six genes in CDM and CDMopt are shown relative to those in MRS. Analysis was performed for three independent experiments with duplicate wells, and the average values were indicated (means ± SD). * p<0.05 (CDM versus CDMopt). # p<0.05 (CDM versus MRS).