Literature DB >> 24885968

Aspergillus oryzae-based cell factory for direct kojic acid production from cellulose.

Ryosuke Yamada, Toshihide Yoshie, Satoshi Wakai, Nanami Asai-Nakashima, Fumiyoshi Okazaki, Chiaki Ogino, Hiromoto Hisada, Hiroko Tsutsumi, Yoji Hata, Akihiko Kondo1.   

Abstract

BACKGROUND: Kojic acid (5-Hydroxy-2-(hydroxymethyl)-4-pyrone) is one of the major secondary metabolites in Aspergillus oryzae. It is widely used in food, pharmaceuticals, and cosmetics. The production cost, however, is too high for its use in many applications. Thus, an efficient and cost-effective kojic acid production process would be valuable. However, little is known about the complete set of genes for kojic acid production. Currently, kojic acid is produced from glucose. The efficient production of kojic acid using cellulose as an inexpensive substrate would help establish cost-effective kojic acid production.
RESULTS: A kojic acid transcription factor gene over-expressing the A. oryzae strain was constructed. Three genes related to kojic acid production in this strain were transcribed in higher amounts than those found in the wild-type strain. This strain produced 26.4 g/L kojic acid from 80 g/L glucose. Furthermore, this strain was transformed with plasmid harboring 3 cellulase genes. The resultant A. oryzae strain successfully produced 0.18 g/L of kojic acid in 6 days of fermentation from the phosphoric acid swollen cellulose.
CONCLUSIONS: Kojic acid was produced directly from cellulose material using genetically engineered A. oryzae. Because A. oryzae has efficient protein secretion ability and secondary metabolite productivity, an A. oryzae-based cell factory could be a platform for the production of various kinds of bio-based chemicals.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24885968      PMCID: PMC4035902          DOI: 10.1186/1475-2859-13-71

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Kojic acid (5-Hydroxy-2-(hydroxymethyl)-4-pyrone) is widely used in the food industry, pharmaceutical industry, and in cosmetics [1,2]. Furthermore, kojic acid is also used as a building block for biodegradable plastics [3,4]. Plastics have phenolic hydroxyl groups that are derived from kojic acid. Thus, it has some unique properties. Futamura et al. [5] reported that the production cost of kojic acid is about $10/kg. It must be decreased to less than $2/kg before it could be used in many applications. Thus, an efficient and cost-effective kojic acid production process would be desirable. The utilization of biomass, particularly cellulosic materials, is desirable because it is abundant, inexpensive, renewable, and has favorable environmental properties. However, an efficient and cost-effective method for the degradation of cellulosic materials into glucose would be required before it could be used for the production of bio-based chemicals. Cellulose has a structure that is very rigid with a high degree of crystallinity. Thus, the degradation of cellulose requires large amounts of various types of cellulase. The degradation of cellulose requires a synergistic reaction of at least three types of cellulase: endoglucanase (EG), cellobiohydrolase (CBH), and β-glucosidase (BGL). Although many studies have reduced the cost of cellulosic material degradation using recombinant bacteria, fungi, and yeast [6], cellulase degradation efficiency has not been sufficiently improved. The filamentous fungus Trichoderma reesei degrades cellulose effectively and is known to produce more than several dozen g/L of cellulase in the medium [7], therefore, it is known for its high cellulose degradation ability. Aspergillus oryzae is known as a high protein-secreting microorganism and its genetic recombination procedures are well developed. There are many reports concerning the production of a large amount of protein by A. oryzae[8]. Thus, A. oryzae shows promise as a host strain that could produce a large amount of cellulase and bio-based chemicals from cellulose. There have been reports concerning a single cellulase gene expression by A. oryzae, but no studies have focused on the cultivation of the 3 types of cellulase expressing A. oryzae on cellulose as a sole carbon source. Kojic acid is one of the major secondary metabolites in A. oryzae. In the 100 years since it was discovered, there has been no elucidation of the entire pathway of kojic acid biosynthesis in A. oryzae. Recently, some genes regarding the production of kojic acid in A. oryzae were reported [9]. According to the report, 14 genes from AO090113000132 to AO090113000145 including a transcription factor gene (kojR; AO090113000137), an enzyme gene (kojA, AO090113000136), and a transporter gene (kojT AO090113000138) form a cluster. These genes are engaged in kojic acid production. The kojR gene encodes a fungal-specific Zn(II)2Cy6 transcription factor that is located between kojA (upstream 743 bp) and kojT (downstream 383 bp). The kojR regulates the transcription of kojA and kojT. A strain with a disrupted transcription factor gene could not produce kojic acid at all [10]. Thus, kojR seems to be a key factor in kojic acid production. The goal of the present study was to construct an A. oryzae-based cell factory for direct kojic acid production from cellulose. First, A. oryzae over-expressing the transcription factor gene kojR was constructed, and kojic acid production from glucose and starch by the resultant strain was carried out. Then, A. oryzae co-expressing the transcription factor and 3-types of cellulase genes was constructed. Finally, direct kojic acid production from cellulose by the resultant strain was carried out.

Methods

Strains and media

Table  1 summarizes the genetic properties of all strains used. The A. oryzae strain RIB40 [11] was used as the wild-type strain. The strain NSPlD1 [12] derived from A. oryzae RIB40 was used as a transformation host strain. Potato dextrose agar (PDA; Nissui Pharmaceutical, Tokyo, Japan) media and GPY medium (3% glucose, 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4 · 7H2O, 1% peptone, and 0.5% yeast extract, pH 6.0) were used for the cultivation of A. oryzae. Czapek-Dox (CD) medium (2% glucose, 0.3% NaNO3(CD-NO3), 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4 · 7H2O, and 0.8 M NaCl, 1.5% agar, pH 6.0) with a required supplement (0.0015% methionine, 20 mM uridine, 0.2% uracil) was used for the niaD-based plasmid transformation. CD medium was used for sC-based plasmid transformation.
Table 1

Strains and plasmid used in this study

Strains and plasmidsRelevant featuresReference
Escherichia coli strain
 
 
NovaBlue
endA1 hsdR17(r K12-m K12+) supE44 thi-I gyrA96 relA1 lac recA1/F’[proAB + lacIq ZΔM15::Tn10(Tetr)]
Novagen
Aspergillus oryzae strains
 
 
RIB40
Wild type
Machida et al. [11]
NSPlD1
niaD - sC - adeA - ΔargB::adeA - ΔligD::argB ΔpyrG::adeA
Maruyama and Kitamoto [12]
NSPlD1/pIS1-kojR
niaD - ::pIS1-kojR [P-sodM::kojR::T-glaB] sC - adeA- ΔargB::adeA- ΔligD::argB ΔpyrG::adeA
This study
NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI
niaD - ::pIS1-kojR [P-sodM::kojR::T-glaB] sC- ::pIS1sC-CBHI-EGI-BGLI [P-svaA::CBHI::T-svaA, P-hlyA::EGI::T-hlyA, P-sodM::CutL-BGLI::T-glaB] adeA- ΔargB::adeA- ΔligD::argB ΔpyrG::adeA
This study
Plasmids
 
 
pISI-CBHI
CBHI gene from T. reesei containing plasmid
This study
pIS1-svaA-CBHI
Vector for expression of CBHI from T. reesei [P-svaA::CBHI::T-glaB]; niaD marker
This study
pISI-EG
EGI (T. reesei) gene containing plasmid
This study
pIS1-hlyA-EGI
Vector for expression of EGI from T. reesei [P-hlyA::EG::T-hlyA]; niaD marker
This study
pIS1-BGLI
Vector for expression BGLI from A. aculeatus [P-sodM::CutL-BGL::T-glaB]; niaD marker
This study
pIS1-CBHI-EGI-BGLI
Vector for expression of CBHI, EGI, and BGLI [P-svaA::CBHI::T-svaA, P-hlyA::EGI::T-hlyA, P-sodM::CutL-BGLI::T-glaB]; niaD marker
This study
pIS1sC-CBHI-EGI-BGLI
Vector for expression CBHI, EGI, and BGLI [P-svaA::CBHI::T-svaA, P-hlyA::EGI::T-hlyA, P-sodM::CutL-BGLI::T-glaB]; sC marker
This study
pIS1-kojRVector for expression of transcription factor (AO090113000137) [P-sodM::kojR::T-glaB]; niaD markerThis study
Strains and plasmid used in this study GY medium (8% glucose, 0.25% yeast extract, 0.1% K2HPO4, 0.05% MgSO4 · 7H2O, pH 6.0), SY medium (8% soluble starch, 0.25% yeast extract, 0.1% K2HPO4, 0.05% MgSO4 · 7H2O, pH 6.0), and CY medium (1% phosphoric acid swollen cellulose (PASC), 0.25% yeast extract, 0.1% K2HPO4, 0.05% MgSO4 · 7H2O, pH 6.0) was used for kojic acid production. PASC was prepared from Avicel PH-101 (Fluka Chemie GmbH, Buchs, Switzerland) as amorphous cellulose [13]. The transformant and wild-type strains used for kojic acid production with GY medium and SY medium were cultivated in 500 mL Erlenmeyer flasks containing 100 mL medium at 30°C that was shaken at 150 rpm using an orbital shaker with inocula of 1 × 105 spores/mL. The transformant and wild-type strain used for kojic acid fermentation in the CY medium was precultivated in a 200 mL Erlenmeyer flask with baffles containing 100 mL GPY medium at 30°C that was shaken at 150 rpm using an orbital shaker with inocula of 1 × 105 spores/mL. The mycelium in culture medium was separated from the culture medium by filtration using Miracloth (Calbiochem, Darmstadt, Germany) and was washed by distilled water. The washed mycelium was recultivated in 500 mL Erlenmeyer flasks with baffles containing 100 mL CY medium at 30°C that were shaken at 150 rpm using an orbital shaker. E. coli NovaBlue (Novagen, Inc., Madison, WI, USA) was used as the cloning host for recombinant DNA manipulations. The bacterium was grown in Luria–Bertani medium (1% tryptone, 0.5% yeast extract, and 0.5% NaCl) containing 0.1 mg/mL of ampicillin.

Construction of plasmids

The primers used in the present study are summarized in Table  2. The PCR amplification of DNA fragments was performed using KOD plus neo DNA polymerase (Toyobo, Osaka, Japan).
Table 2

Polymerase chain reaction primers used in this study

PrimersSequence (5′-3′)Template DNA
ascI-kojR-F
AAAAAGGCGCGCCATGTCGTTGAATACCGACGATTCC
A. oryzae genome DNA
notI-FLAG-kojR-R
AAAGCGGCCGCTTACTTGTCATCATCGTCCTTATAGTCTCTATATCTCTGACCACCTGC
CBHI-F
CCAAACCACCCAAAGGGCGCGCCATGTATCGGAAGTTGGCCGTCATC
synthesized gene
CBHI-R
GAAAGTACATGTCGAGCGGCCGCTTACAGGCACTGAGAGTAGTAAG
psvaA-ascI-CBHI-F
GGCGCGCCAAAAAATGTATCGGAAGTTGGCCGTCA
pISI-CBHI
tsvaA-notI-CBHI-R
AAATGATGCGGCCGCTTACAGGCACTGAGAGTAGT
pIS1-psvaA-F
CACAACACTCTCGACCTGCAGCGGTTTACACCGAAGACCGG
A. oryzae genome DNA
CBHI-ascI-psvaA-R
ATTTTTTGGCGCGCCCTTGCGAGCAGGGGGATAAT
CBHI-notI-tsvaA-F
GCGGCCGCATCATTTTCCCGCTTTGATCTGGTCGGTTCCC
A. oryzae genome DNA
pIS1-tsvaA-R
GGTACCCGGGGATCCTCTAGATCAAGCATAACTACAACAGGGCAAGGAATACGG
EGI-F
CCAAACCACCCAAAGGGCGCGCCATGGCGCCCTCAGTTACACTGC
T. reesei cDNA
EGI-R
GAAAGTACATGTCGAGCGGCCGCCTAAAGGCATTGCGAGTAGTCTG
phlyA-ascI-EGI-F
GGCGCGCCAAAAAATGGCGCCCTCAGTTACACTGC
pISI-EG
thlyA-notI-EGI-R
AGAGAGAGCGGCCGCCTAAAGGCATTGCGAGTAGT
pIS1-phlyA-F
CACAACACTCTCGACCTGCAGTACAGCATGGTCTGGATTCCAATCCACGCAGC
A. oryzae genome DNA
EGI-ascI-phlyA-R
ATTTTTTGGCGCGCCGGTGTTGTGGTGTGAAGGGTGATTGATGTGAGACC
EGI-notI-thlyA-F
GCGGCCGCTCTCTCTCCCCTATACGTGATACCGTA
A. oryzae genome DNA
pIS1-thlyA-R
GGTACCCGGGGATCCTCTAGAGATGCAAATTGGAGTTAAAT
sCutL-F
CCAAACCACCCAAAGGGCGCGCCATGCATCTTGCTATCAAGTCTC
A. oryzae genome DNA
sCutL-R
TCACTAGTTCTCTCAACCAGAGCATTGCTGGG
N28-F
TTGAGAGAACTAGTGATGACAACTTGGTTGGTGGCATG
pISI-GFP (Adachi et al. [14])
N28-R
AGTTCATCCTCGACACGCTTGGCGCTGTTGG
BGL-F
GTGTCGAGGATGAACTGGCGTTCTCTCCTC
pdU-PGAGBGL (Yamada et al. [15])
BGL-R
GAAAGTACATGTCGAGCGGCCGCTTACTTGTCATCGTCATCCTTG
pIS1-svaA-CBHI-F
GGCTTTCCCCGTCAAGCTCT
pISI-svaA-CBHI
pIS1-svaA-CBHI-R
GGCGAACGTGGCGAGAAAGG
phlyA-into-pIS1-svaA-CBHI-F
CTCGCCACGTTCGCCTACAGCATGGTCTGGATTCCAATCCACGCA
pISI-hlyA-EGI
connect-thlyA-and-psodM-R
TATTTAAATATCGATGATGCAAATTGGAGTTAAATATTAACTAAC
connect-psodM-and-thlyA-F
ATCGATATTTAAATATTATGTACTCCGTACTCGGTTGATTATTAA
pIS1-BGL1
tglaB-into-pIS1-svaA-CBHI-R
TTGACGGGGAAAGCCGGATGTAGTATGTATACTTAGTTTGATTGC
hlyA-EGI-svaA-CBHI-sodM-BGLI-F
TTTATATCCAAGATCACCTGCAGCGGTTTACACCGAAGACCGGTA
pISI-CBHI-EGI-BGL1
hlyA-EGI-svaA-CBHI-sodM-BGLI-R
TGCCAAGAGAAGCTTGGCGTAATCATGGTCATAGCTGTTT
sC-F
AAGCTTCTCTTGGCAATAGCTGCCC
pUSC (Yamada et al. [16])
sC-R
GATCTTGGATATAAAAATCCAAATATGGCTCCTCG
kojR-RT-PCR-F
TGGTGCAATCAGCGAAGGA
wild type and engineered A. oryzae cDNA
kojR-RT-PCR-R
AGACTACTCTCCTGCATCATGCC
kojA-RT-PCR-F
ATCCGAAGGCGAATGGTTT
wild type and engineered A. oryzae cDNA
kojA-RT-PCR-R
ATGAACCCAGCGTCGCTATT
kojT-RT-PCR-F
CATGGTGCCGCATATTTACTTC
wild type and engineered A. oryzae cDNA
kojT-RT-PCR-R
AATGGACACAATGGGTTGCC
ß-Tubulin-RT-PCR-F
GCCAGTGTGGTAACCAAATAGGT
wild type and engineered A. oryzae cDNA
ß-Tubulin-RT-PCR-RTAAACACCGGAGCCGTCAA
Polymerase chain reaction primers used in this study The transcription factor gene (kojR, AO090113000137) expression plasmid was constructed as follows. The kojR was amplified by PCR using primers ascI-kojR-F and notI-FLAG-kojR-R from A. oryzae genome DNA as a template. The amplified fragment was inserted into the AscI/NotI sites of the digested pISI, which contained the sodM promoter and glaB terminator from A. oryzae[17]. The resultant plasmid was named pISI-kojR. The CBHI gene from Trichoderma sp. expressing plasmid pIS1-svaA-CBHI was constructed as follows. The DNA fragment encoding the Trichoderma sp. CBHI gene (GenBank accession no. X69976) was amplified by PCR using primers CBHI-F and CBHI-R from a synthesized gene (GENEWIZ, South Plainfield, NJ, USA). The fragment was inserted into the AscI/NotI site of the plasmid pISI using an In-Fusion HD Cloning Kit (Takara Bio Inc., Shiga, Japan). The resultant plasmid was named pISI-CBHI. Then, the CBHI gene was amplified by PCR using primers psvaA-ascI-CBHI-F and tsvaA-notI-CBHI-R with pISI-CBHI as a template. The svaA promoter [17] and svaA terminator were amplified by PCR using primers pIS1-psvaA-F and CBHI-ascI-psvaA-R, and CBHI-notI-tsvaA-F and pIS1-tsvaA-R, respectively, with A. oryzae genome DNA as a template. These PCR-amplified DNA fragments were simultaneously inserted into the XbaI and PstI sites of pIS1 using an In-Fusion PCR Cloning kit. The resultant plasmid was named pISI-svaA-CBHI. An EGI gene from the T. reesei-expressing plasmid pIS1-hlyA-EGI was constructed. The EGI-expressing plasmid was constructed as follows. The DNA fragment encoding the T. reesei EGI gene was amplified by PCR using the primers EGI-F and EGI-R with T. reesei cDNA as a template. The fragment was inserted into the AscI/NotI site of the plasmid pISI using an In-Fusion HD Cloning Kit. The resultant plasmid was named pISI-EG. The T. reesei EGI gene was then amplified by PCR using the primers phlyA-ascI-EGI-F and thlyA-notI-EGI-R with pISI-EG as a template. The hlyA promoter [18] and hlyA terminator were amplified by PCR using primers pIS1-phlyA-F and EGI-ascI-phlyA-R, and EGI-notI-thlyA-F and pIS1-thlyA-R, respectively, using the A. oryzae genome DNA as a template. These PCR-amplified DNA fragments were simultaneously inserted into the XbaI and PstI sites of pIS1 using an In-Fusion PCR Cloning kit. The resultant plasmid was named pISI-hlyA-EGI. The BGL1 gene from A. aculeatus expressing plasmid pIS1-BGL1 was constructed as follows. The DNA fragment encoding the secretion signal from A. oryzae cutinase, the 28 amino acids from the N-terminal region of Rhizopus oryzae lipase, and the A. aculeatus BGL gene were amplified by PCR using the primers sCutL-F and sCutL-R, N28-F and N28-R, and BGL-F and BGL-R, respectively, from the genome DNA of A. oryzae, pISI-GFP [14], and pδU-PGAGBGL [15], respectively. These fragments were simultaneously inserted into the AscI/NotI site of the plasmid pISI using an In-Fusion HD Cloning Kit. The resultant plasmid was named pISI-BGL. The pIS1-CBHI-EGI-BGL1 plasmid was constructed as follows. The pISI-svaA-CBHI was linearized by PCR using the primers pIS1-svaA-CBHI-F and pIS1-svaA-CBHI-R. The EGI- and BGL1-expressing cassettes were amplified by PCR using primers phlyA-into-pIS1-svaA-CBHI-F and connect-thlyA-and-psodM-R, and connect-psodM-and-thlyA-F and tglaB-into-pIS1-svaA-CBHI-R, respectively, from pISI-hlyA-EGI and pIS1-BGL1, respectively. These fragments were fused using an In-Fusion PCR Cloning kit. The resultant plasmid was named pISI-CBHI-EGI-BGL1. The pIS1sC-CBHI-EGI-BGL1 plasmid was constructed as follows. The CBHI-, EGI-, and BGL1-expressing cassettes were amplified by PCR using primer (hlyA-EGI-svaA-CBHI-sodM-BGL1-F and hlyA-EGI-svaA-CBHI-sodM-BGL1-R). The sC gene was amplified by PCR using primer (sC-F and sC-R) from a pUSC plasmid [16]. These amplified fragments were fused using an In-Fusion PCR Cloning System. The resultant plasmid was named pISIsC-CBHI-EGI-BGL1.

Transformation of A. oryzae

The transformation of A. oryzae was carried out according to the previously described method with minor modifications [19]. The niaD-based pIS1-kojR plasmids were introduced into the NSPlD1 strain. The resultant strain was named NSPlD1/pIS1-kojR. The sC-based plasmid pIS1sC-CBHI-EGI-BGL1 was introduced into the NSPlD1/pIS1-kojR strain. The resultant strain was named NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGL1.

RNA extraction and reverse transcription

The RNA was isolated from fungus bodies cultivated in GY medium for 6 days at 30°C using NucleoSpin RNA II (Takara Bio Inc.) according to the manufacturer’s protocol. The cDNA synthesis was carried out using a ReverTra Ace qPCR RT Kit (Toyobo) according to the manufacturer’s protocol.

Real-time PCR analysis

The transcription level of Kojic-acid-producing genes (kojR, kojA, kojT) was quantified by real-time PCR. Quantitative real-time PCR was performed using an Mx3005P Real-Time QPCR System (Agilent Technologies, Santa Clara, CA, USA) with a Thunderbird SYBR qPCR Mix (Toyobo). The normalized transcription level was calculated using the standard curve method with β-tubulin as the house-keeping gene [20]. All primers used for real-time PCR analysis are summarized in Table  2.

Enzyme assay

A wild-type strain and 3-types of cellulase gene-expressing strains were cultivated in GY medium for 6 days at 30°C, and the culture supernatant was used for the determination of PASC degradation activity. PASC degradation activity was measured in 25 mM sodium acetate buffer (pH 5.0) at 30°C with 5 g/L of PASC. After hydrolysis, the supernatant was separated by centrifugation for 5 min at 10,000 × g and 4°C, and the produced glucose concentration was measured. One unit of PASC degradation activity was defined as the amount of enzyme producing 1 μmol/min glucose at 30°C, pH 5.0.

Analytical methods

The kojic acid concentration was determined using a colorimetric method described previously [21]. The total sugar concentration was determined by a colorimetric phenol-sulfuric acid method described previously [22]. The glucose concentration was determined using a Wako Glucose CII-Test kit (Wako Pure Chemical Industries, Osaka, Japan).

Results

Kojic acid production from glucose using the engineered A. oryzae

To confirm the effect of the over-expression of the transcription factor for kojic acid production, the kojic acid productivity from the transcription factor over-expressing strain NSPlD1/pIS1-kojR from glucose was evaluated. As shown in Figure  1 the wild-type strain produced 16.4 g/L of kojic acid after 14 days of fermentation. By contrast, the transcription factor over-expressing strain NSPlD1/pIS1-kojR produced 26.4 g/L of kojic acid after 14 days of fermentation and it was 1.6-fold higher than that of the wild-type strain.
Figure 1

Time course of kojic acid production from glucose. Triangles, glucose; squares, kojic acid; open symbols, wild-type strain; and, closed symbols, transcription factor over-expressing strain NSPlD1/pIS1-kojR. The data represent the averages from three independent experiments (error bars represent SE).

Time course of kojic acid production from glucose. Triangles, glucose; squares, kojic acid; open symbols, wild-type strain; and, closed symbols, transcription factor over-expressing strain NSPlD1/pIS1-kojR. The data represent the averages from three independent experiments (error bars represent SE).

Quantification of the transcription level of kojic-acid-producing genes by real-time PCR

To confirm the effect of the over-expression of transcription factor at the level of the kojic-acid-producing genes, the transcription level of the transcription factor, the kojic-acid-producing enzyme, and the transporter gene were evaluated by real-time PCR. As shown in Figure  2, the transcription factor of the over-expressing strain NSPlD1/pIS1-kojR showed a 1.8, 1.8, and 5.4-fold increases in the transcription level of transcription factor, enzyme, and transporter gene, respectively, compared with the wild-type strain.
Figure 2

Transcription levels of kojic acid producing genes. (A) Transcription factor gene, (B) enzyme gene, (C) transporter gene. The data represent the averages from three independent experiments (error bars represent SE).

Transcription levels of kojic acid producing genes. (A) Transcription factor gene, (B) enzyme gene, (C) transporter gene. The data represent the averages from three independent experiments (error bars represent SE).

Kojic acid production from soluble starch by recombinant A. oryzae

Since A. oryzae can assimilate starch as a sole carbon source intrinsically, direct kojic acid production from starch using the transcription factor over-expressing strain NSPlD1/pIS1-kojR was carried out. As shown in Figure  3, the wild-type strain produced 6.2 g/L of kojic acid after 18 days of fermentation. In contrast, the transcription factor over-expressing strain produced 19.4 g/L of kojic acid after 18 days of fermentation, i.e. 3.1-fold gain.
Figure 3

Time course of kojic acid production from starch. Triangles, total sugar; squares, kojic acid; open symbols, wild-type strain; and, closed symbols, transcription factor over-expressing strain NSPlD1/pIS1-kojR. The data represent the averages from three independent experiments (error bars represent SE).

Time course of kojic acid production from starch. Triangles, total sugar; squares, kojic acid; open symbols, wild-type strain; and, closed symbols, transcription factor over-expressing strain NSPlD1/pIS1-kojR. The data represent the averages from three independent experiments (error bars represent SE).

Evaluation of cellulase activity

To confirm the cellulase expression of engineered A. oryzae, the PASC degradation activity of 3-types of cellulase were evaluated. As shown in Figure  4, the 3-types of cellulase gene-expressing strains NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI showed 29.9 U/L after 6 days of cultivation. In contrast, the wild-type strain showed significantly lower PASCase activity (1.4 U/L).
Figure 4

PASCase activity of 3-types of cellulase gene-expressing strains. The data represent the averages from three independent experiments (error bars represent SE).

PASCase activity of 3-types of cellulase gene-expressing strains. The data represent the averages from three independent experiments (error bars represent SE).

Direct kojic acid production from PASC

To confirm direct kojic acid productivity from cellulose, kojic acid production from PASC was carried out. As shown in Figure  5, there was 0.18 g/L of kojic acid produced after 6 days of fermentation when using a transcription factor gene and the 3-types of cellulase genes co-expressing strain NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI. In contrast, the wild-type strain did not produce a detectable amount of kojic acid.
Figure 5

Time course of kojic acid production from PASC. Open symbols, wild-type strain; closed symbols, transcription factor and 3-types of cellulase gene over-expressing strains NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI. The data represent the averages from three independent experiments (error bars represent SE).

Time course of kojic acid production from PASC. Open symbols, wild-type strain; closed symbols, transcription factor and 3-types of cellulase gene over-expressing strains NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI. The data represent the averages from three independent experiments (error bars represent SE).

Discussion

In the present study, a transcription factor gene over-expressing A. oryzae NSPlD1/pIS1-kojR was developed by gene recombination strategy. Furthermore, the transcription factor gene and 3-types of cellulase genes co-expressing A. oryzae NSPlD1/pIS1-kojR/pIS1sC-CBHI-EGI-BGLI was constructed and the strain successfully produced kojic acid directly from PASC. The transcription factor gene kojR, which is responsible for kojic acid production, was over-expressed in this study, and as a result, kojic acid productivity was improved. As shown in Figure  2, the transcription levels of both the kojic acid-producing enzyme kojA and the exporting transporter kojT were enhanced. This was because the kojic acid productivity was improved. Terabayashi et al. [9] reported that the kojR, kojA, and kojT genes would encode the transcription factor, the kojic acid-producing enzyme, and the transporter, respectively. In the present study, the transcription level of the enzyme and the transporter were enhanced by an over-expression of the transcription factor, which correlates well with that report. Although there are reports of improved kojic acid productivity through fermentation engineering strategies [1,5,23], to our knowledge, this study is the first to report an improvement in kojic acid productivity via genetic engineering. Kojic acid productivity could be improved even more by combining fermentation engineering and genetic engineering in future work. Direct kojic acid production from cellulose was successfully demonstrated by A. oryzae expressing 3-types of cellulase genes. However, the yield of kojic acid remained low. This was due to the low levels of cellulase production. In previous reports, some microorganisms such as Saccharomyces cerevisiae, Kluyveromyces marxianus, Bacillus subtilis, and E. coli were used for bio-based chemical production from cellulose by conferring cellulolytic activity [6]. Although most reports did not indicate the amount of cellulase production, Zhang et al. [24] reported that about 14 mg/L of endoglucanase was produced by recombinant Bacillus subtilis. In any case, because T. reesei produces several dozen g/L of cellulase [7], the amount of cellulase expression from cellulolytic activity conferred microorganisms has not yet reached the level of T. reesei. Although A. oryzae has an extremely high protein secreting ability, cellulase expression of T. reesei is still higher than that of A. oryzae. Because the maximum protein production is approximately 20 g/L in Aspergillus organisms [25], the cellulase productivity could be improved with genetic engineering. Three types of cellulase genes and specific transcription factors were successfully over-expressed simultaneously in recombinant A. oryzae. To this point, only a few reports have focused on the co-expression of more than 3-kinds of genes in A. oryzae. This is because the selection marker for gene recombination is limited in A. oryzae compared with other microorganisms such as yeast S. cerevisiae[26]. In the present study, a 3-cassette plasmid with different promoters was constructed and the simultaneous overexpression of 4 genes was successful. Thus, the simultaneous multi gene expression technique, which is an important technique for the construction of a cell factory in A. oryzae, has been well established. By using this technique, an A. oryzae-based cell factory could be a promising strategy for producing various bio-based chemicals.

Conclusions

The productivity of kojic acid from A. oryzae was made more efficient by the over-expression of specific transcription factors. To accomplish this, recombinant A. oryzae expressing 3 types of cellulase genes was constructed. Direct kojic acid production from PASC by genetically engineered A. oryzae was successfully demonstrated. Although this research was conducted as the proof of a concept, the results showed that an A. oryzae-based cell factory could be established. Because, A. oryzae has efficient protein secretion ability and secondary metabolite productivity, an A. oryzae-based cell factory could be a promising platform for producing various kinds of bio-based chemicals.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

TY designed and performed the experiments. NAN performed the experiments. TY and RY wrote the paper. SW, FO, CO, HH, HT, YH and AK commented and supervised on the manuscript. All the authors approved the final manuscript.
  21 in total

1.  Kojic acid biosynthesis in Aspergillus oryzae is regulated by a Zn(II)(2)Cys(6) transcriptional activator and induced by kojic acid at the transcriptional level.

Authors:  Junichiro Marui; Noriko Yamane; Sumiko Ohashi-Kunihiro; Tomohiro Ando; Yasunobu Terabayashi; Motoaki Sano; Shinichi Ohashi; Eiji Ohshima; Kuniharu Tachibana; Yoshitaka Higa; Marie Nishimura; Hideaki Koike; Masayuki Machida
Journal:  J Biosci Bioeng       Date:  2011-04-21       Impact factor: 2.894

Review 2.  Trichoderma reesei RUT-C30--thirty years of strain improvement.

Authors:  Robyn Peterson; Helena Nevalainen
Journal:  Microbiology       Date:  2011-10-13       Impact factor: 2.777

3.  Repeated-batch production of kojic acid in a cell-retention fermenter using Aspergillus oryzae M3B9.

Authors:  H M Wan; C C Chen; R Giridhar; T S Chang; W T Wu
Journal:  J Ind Microbiol Biotechnol       Date:  2005-05-14       Impact factor: 3.346

4.  Isolation of a novel promoter for efficient protein expression by Aspergillus oryzae in solid-state culture.

Authors:  Hiroki Bando; Hiromoto Hisada; Hiroki Ishida; Yoji Hata; Yoshio Katakura; Akihiko Kondo
Journal:  Appl Microbiol Biotechnol       Date:  2011-07-06       Impact factor: 4.813

Review 5.  Heterologous gene expression in filamentous fungi.

Authors:  Xiaoyun Su; George Schmitz; Meiling Zhang; Roderick I Mackie; Isaac K O Cann
Journal:  Adv Appl Microbiol       Date:  2012       Impact factor: 5.086

6.  Identification and characterization of genes responsible for biosynthesis of kojic acid, an industrially important compound from Aspergillus oryzae.

Authors:  Yasunobu Terabayashi; Motoaki Sano; Noriko Yamane; Junichiro Marui; Koichi Tamano; Junichi Sagara; Mitsuko Dohmoto; Ken Oda; Eiji Ohshima; Kuniharu Tachibana; Yoshitaka Higa; Shinichi Ohashi; Hideaki Koike; Masayuki Machida
Journal:  Fungal Genet Biol       Date:  2010-09-16       Impact factor: 3.495

7.  Kojic acid production in an airlift bioreactor using partially hydrolyzed raw corn starch.

Authors:  T Futamura; H Ishihara; T Tamura; T Yasutake; G Huang; M Kojima; M Okabe
Journal:  J Biosci Bioeng       Date:  2001       Impact factor: 2.894

8.  Construction of an Aspergillus oryzae cell-surface display system using a putative GPI-anchored protein.

Authors:  Takashi Adachi; Junji Ito; Kouji Kawata; Masahiro Kaya; Hiroki Ishida; Hiroshi Sahara; Yoji Hata; Chiaki Ogino; Hideki Fukuda; Akihiko Kondo
Journal:  Appl Microbiol Biotechnol       Date:  2008-09-24       Impact factor: 4.813

9.  Multiple gene disruptions by marker recycling with highly efficient gene-targeting background (DeltaligD) in Aspergillus oryzae.

Authors:  Jun-Ichi Maruyama; Katsuhiko Kitamoto
Journal:  Biotechnol Lett       Date:  2008-06-24       Impact factor: 2.461

10.  Genome sequencing and analysis of Aspergillus oryzae.

Authors:  Masayuki Machida; Kiyoshi Asai; Motoaki Sano; Toshihiro Tanaka; Toshitaka Kumagai; Goro Terai; Ken-Ichi Kusumoto; Toshihide Arima; Osamu Akita; Yutaka Kashiwagi; Keietsu Abe; Katsuya Gomi; Hiroyuki Horiuchi; Katsuhiko Kitamoto; Tetsuo Kobayashi; Michio Takeuchi; David W Denning; James E Galagan; William C Nierman; Jiujiang Yu; David B Archer; Joan W Bennett; Deepak Bhatnagar; Thomas E Cleveland; Natalie D Fedorova; Osamu Gotoh; Hiroshi Horikawa; Akira Hosoyama; Masayuki Ichinomiya; Rie Igarashi; Kazuhiro Iwashita; Praveen Rao Juvvadi; Masashi Kato; Yumiko Kato; Taishin Kin; Akira Kokubun; Hiroshi Maeda; Noriko Maeyama; Jun-ichi Maruyama; Hideki Nagasaki; Tasuku Nakajima; Ken Oda; Kinya Okada; Ian Paulsen; Kazutoshi Sakamoto; Toshihiko Sawano; Mikio Takahashi; Kumiko Takase; Yasunobu Terabayashi; Jennifer R Wortman; Osamu Yamada; Youhei Yamagata; Hideharu Anazawa; Yoji Hata; Yoshinao Koide; Takashi Komori; Yasuji Koyama; Toshitaka Minetoki; Sivasundaram Suharnan; Akimitsu Tanaka; Katsumi Isono; Satoru Kuhara; Naotake Ogasawara; Hisashi Kikuchi
Journal:  Nature       Date:  2005-12-22       Impact factor: 49.962

View more
  7 in total

1.  Construction of single, double, or triple mutants within kojic acid synthesis genes kojA, kojR, and kojT by the CRISPR/Cas9 tool in Aspergillus oryzae.

Authors:  Yuzhen Li; Huanxin Zhang; Ziming Chen; Junxia Fan; Tianming Chen; Bin Zeng; Zhe Zhang
Journal:  Folia Microbiol (Praha)       Date:  2022-01-15       Impact factor: 2.099

Review 2.  CRISPR/Cas9-Based Genome Editing and Its Application in Aspergillus Species.

Authors:  Feng-Jie Jin; Bao-Teng Wang; Zhen-Dong Wang; Long Jin; Pei Han
Journal:  J Fungi (Basel)       Date:  2022-04-30

3.  Identification and characterization of the ZRT, IRT-like protein (ZIP) family genes reveal their involvement in growth and kojic acid production in Aspergillus oryzae.

Authors:  Zhe Zhang; Junxia Fan; Chuannan Long; Bin He; Zhihong Hu; Chunmiao Jiang; Yongkai Li; Long Ma; Jingshang Wen; Xiaojin Zou; Yuan Chen; Zhenxiang Ge; Bin Zeng
Journal:  J Ind Microbiol Biotechnol       Date:  2019-09-20       Impact factor: 3.346

Review 4.  Transcriptional Activation of Biosynthetic Gene Clusters in Filamentous Fungi.

Authors:  László Mózsik; Riccardo Iacovelli; Roel A L Bovenberg; Arnold J M Driessen
Journal:  Front Bioeng Biotechnol       Date:  2022-07-15

Review 5.  Towards Understanding the Function of Aegerolysins.

Authors:  Nada Kraševec; Matej Skočaj
Journal:  Toxins (Basel)       Date:  2022-09-11       Impact factor: 5.075

6.  Development of bio-based fine chemical production through synthetic bioengineering.

Authors:  Kiyotaka Y Hara; Michihiro Araki; Naoko Okai; Satoshi Wakai; Tomohisa Hasunuma; Akihiko Kondo
Journal:  Microb Cell Fact       Date:  2014-12-14       Impact factor: 5.328

Review 7.  Fungal Pigments and Their Roles Associated with Human Health.

Authors:  Lan Lin; Jianping Xu
Journal:  J Fungi (Basel)       Date:  2020-11-12
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.