| Literature DB >> 24675788 |
Niklaus Zemp1, Aria Minder2, Alex Widmer1.
Abstract
Quantitative real time (qRT)-PCR is a precise and efficient method for studying gene expression changes between two states of interest, and is frequently used for validating interesting gene expression patterns in candidate genes initially identified in genome-wide expression analyses, such as RNA-seq experiments. For an adequate normalisation of qRT-PCR data, it is essential to have reference genes available whose expression intensities are constant among the different states of interest. In this study we present and validate a catalogue of traditional and newly identified reference genes that were selected from RNA-seq data from multiple individuals from the dioecious plant Silene latifolia with the aim of studying gene expression differences between the two sexes in both reproductive and vegetative tissues. The catalogue contains more than 15 reference genes with both stable expression intensities and a range of expression intensities in flower buds and leaf tissues. These reference genes were used to normalize expression differences between reproductive and vegetative tissues in eight candidate genes with sex-biased expression. Our results suggest a trend towards a reduced sex-bias in sex-linked gene expression in vegetative tissues. In this study, we report on the systematic identification and validation of internal reference genes for adequate normalization of qRT-PCR-based analyses of gene expression differences between the two sexes in S. latifolia. We also show how RNA-seq data can be used efficiently to identify suitable reference genes in a wide diversity of species.Entities:
Mesh:
Year: 2014 PMID: 24675788 PMCID: PMC3968030 DOI: 10.1371/journal.pone.0092893
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Gene names, primer sequences, amplicon characteristics of the S. latifolia candidate reference genes, accession numbers of the protein with the best blast hits in A. thaliana and accession numbers of sequences that were used to design the assays are shown.
| Gene symbol | Primer sequences (5′-3′) | Amplicon length (bp) | Tm (°C) | Amplification efficiency | Best blast hit | GenBank accession number |
| SL_REF1 | F: TCCTCGGAAGGTTCAAGGGTGTCTT R: | 102 | 59.4 | 1.89 | no hit | GARX01000000 (contig_1076.1) |
| SL_REF2 | F: GCAGTGGTTGTAGTCCGGCATTAGT R: | 124 | 59.3 | 1.89 | no hit | GARX01000000 (contig_12371.1) |
| SL_BXL4 | F: TTTGCTCCTTGCATCGCGGTTTGT R: | 143 | 60.4 | 1.88 | Q9FLG1 | GARX01000000 (contig_1352.1) |
| SL_EDL16 | F: GGGGCCAATTTCACTTGATGCTGGA R: | 118 | 59.5 | 1.85 | Q8LBI9 | GARX01000000 (contig_13862.1) |
| SL_METL1 | F: TCCGGTGGTTGGGTTCCTCCTAAAA R:GCCGCATGCCAGTGTCAACAAAA | 116 | 59.5 | 1.77 | Q94AI4 | GARX01000000 (contig_15898.1) |
| SL_REF3 | F: CGCCAGGCAGAGGTGTTAAACCAGA R: | 145 | 60.5 | 1.77 | no hit | GARX01000000 (contig_17318.1) |
| SL_REF4 | F: AAAGCGACGATCTTAGGGCGGTTTG R: | 153 | 59.7 | 1.87 | no hit | GARX01000000 (contig_18234.1) |
| SL_REF5 | F: TTCCAGGCCCTTAGTGTTAGGGGTT R: | 176 | 59 | 1.89 | no hit | GARX01000000 (contig_18486.1) |
| SL_PREP1 | F: CGCCTCCGCCTTATCTTCGTCATTT R: | 178 | 59.4 | 1.89 | Q9LJL3 | GARX01000000 (contig_2002.1) |
| SL_PIP5K8 | F: ACTCCAACGGCGACCCAAAAGAAA R: | 187 | 59.5 | 1.89 | Q8RY89 | GARX01000000 (contig_2735.1) |
| SL_COQ3 | F: ACGGTCTACGCTTTGCCATCACTTC R: | 142 | 59.6 | 1.86 | O49354 | GARX01000000 (contig_3547.1) |
| SL_BL52 | F: TGGTTTTGTCCCCACCGAAACGAA R: | 124 | 59.2 | 1.84 | O22232 | GARX01000000 (contig_38083.1) |
| SL_RPM1 | F: AGAGTGTATGTCTGCCAACTGCCCT R: | 183 | 59.6 | 1.88 | Q39214 | GARX01000000 (contig_38634.1) |
| SL_PDXK | F: TCATCAATGGCGCAACCTCCGATT R: | 152 | 59.4 | 1.82 | Q8W1X2 | GARX01000000 (contig_39927.1) |
| SL_ASPL1 | F: ACGCCGGCTTTGTTGTTCATCAGT R: | 108 | 59.7 | 1.90 | Q9LX20 | GARX01000000 (contig_49970.1) |
| SL_REF6 | F: AACTCCCTGTTCTCACCCCATTCCT R: | 100 | 59.1 | 1.91 | no hit | GARX01000000 (contig_56060.1) |
| SL_BLUS1 | F: CCACCACTATGGGATCGCGTGAAA R: | 131 | 59.3 | 1.81 | O23304 | GARX01000000 (contig_57265.1) |
| SL_STR1 | F: ACCCAGTGCAAGAACACAAGCAGT R: | 193 | 59.4 | 1.84 | O64530 | GARX01000000 (contig_57652.1) |
| SL_AKT6 | F: TGACTCGGGATCAGCCAGTTCACA R: | 122 | 59.3 | 1.84 | Q8GXE6 | GARX01000000 (contig_62745.1) |
| SL_REF7 | F: AGTTGGTACTTGGCGTTTGAGGGAC R: | 185 | 59.1 | 1.83 | no hit | GARX01000000 (contig_64521.1) |
| SL_REF8 | F: GCTTGTGGAAGCAGGGGATCTTTGT R: | 174 | 59.4 | 1.91 | no hit | GARX01000000 (contig_25240.1) |
|
| F: CTGGGAAATACGCAGGTGAT R: | 200 | 59.9 | 1.90 | NP_564101 | GH293053 |
|
| F: CTGGTTTCGCTGGAGATGAT R: | 280 | 60.1 | 1.89 | NP_187818 | GH293703 |
|
| F: TTCATTGCTTGCCACTTCTG R: | 201 | 60 | 1.86 | NP_568476 | GH294915 |
|
| F: GGCCACTTTCTGCTCTGGTA R: | 182 | 59.8 | 1.84 | AAL91176 | GH294786 |
|
| F: GCGAGACTGGAGCTGATTTC R: | 194 | 60.1 | 1.87 | NP_172801 | GH291995 |
|
| F: AATTTTCGCCTTCCTCATCC R: | 396 | 60 | 1.80 | NP_567286 | GH293574 |
Gene names of traditional reference genes are written in bold.
Figure 1Expression (Ct) values of candidate reference genes ordered by decreasing stability in reproductive and vegetative tissues.
Boxplots represent Ct values over all tested samples in (A) flower buds (25 genes) and (B) leaves (26 genes) for candidate reference genes that are arranged by decreasing (left to right) stability rank as inferred from RefFinder. Traditional reference genes are indicated in bold.
Figure 2Gene expression stabilities of candidate reference genes.
Average expression stabilities (M) of the candidate reference genes in (A) flower buds (25 genes) and (B) leaves (26 genes) as estimated by geNorm. Small M values indicate high stability. M values for most genes were below 0.5, indicating high expression stability [36]. Traditional reference genes are indicated in bold.
Figure 3Sex-biased expression of eight target genes in vegetative and reproductive tissues.
Transcript levels are shown as log2 fold changes for eight sex-linked genes in (A) flower buds and (B) rosette leaves. Red and blue colours indicate female- and male-biased expression (fold change ≥1.5), respectively. Asterisks indicate significant expression differences between males and females based on Wilcoxon tests after correction for multiple testing. Error bars indicate mean standard errors calculated from five to seven biological replicates normalized over the three selected reference genes. No expression was observed for contig_3475 in leaf tissues.