Literature DB >> 18489742

Exercise induced stress in horses: selection of the most stable reference genes for quantitative RT-PCR normalization.

Katia Cappelli1, Michela Felicetti, Stefano Capomaccio, Giacomo Spinsanti, Maurizio Silvestrelli, Andrea Verini Supplizi.   

Abstract

BACKGROUND: Adequate stress response is a critical factor during athlete horses' training and is central to our capacity to obtain better performances while safeguarding animal welfare. In order to investigate the molecular mechanisms underlying this process, several studies have been conducted that take advantage of microarray and quantitative real-time PCR (qRT-PCR) technologies to analyse the expression of candidate genes involved in the cellular stress response. Appropriate application of qRT-PCR, however, requires the use of reference genes whose level of expression is not affected by the test, by general physiological conditions or by inter-individual variability.
RESULTS: The expression of nine potential reference genes was evaluated in lymphocytes of ten endurance horses during strenuous exercise. These genes were tested by qRT-PCR and ranked according to the stability of their expression using three different methods (implemented in geNorm, NormFinder and BestKeeper). Succinate dehydrogenase complex subunit A (SDHA) and hypoxanthine phosphoribosyltransferase (HPRT) always ranked as the two most stably expressed genes. On the other hand, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transferrin receptor (TFRC) and ribosomal protein L32 (RPL32) were constantly classified as the less reliable controls.
CONCLUSION: This study underlines the importance of a careful selection of reference genes for qRT-PCR studies of exercise induced stress in horses. Our results, based on different algorithms and analytical procedures, clearly indicate SDHA and HPRT as the most stable reference genes of our pool.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18489742      PMCID: PMC2412902          DOI: 10.1186/1471-2199-9-49

Source DB:  PubMed          Journal:  BMC Mol Biol        ISSN: 1471-2199            Impact factor:   2.946


Background

Knowledge of the molecular mechanisms underlying the stress response in athlete horse is a fundamental prerequisite for planning an appropriate training schedule to obtain better performances, preserve animal welfare and avoid overtraining-syndrome [1,2]. It is universally accepted that moderate physical activity may have beneficial effects in terms of general health conditions and could favour the functioning of the immune system. Conversely, strenuous exercise, like exhaustive endurance races, may have detrimental effects on the immune system, determine changes in the cellular composition of peripheral blood and induce the expression of genes that appear to be related to the overtraining-syndrome [3-5]. The list of candidate genes is nevertheless far from being complete, as the athlete's reaction to exercise is a coordinated response of multiple organ systems, and likely involves multiple and complex regulatory changes: induction of heat shock proteins, inflammatory response modulation (pro and anti-inflammatory cytokines) and generation of reactive oxygen and nitrogen species (ROS and RSN) that, besides their damaging potential, play a crucial role in cellular signalling [6,7]. Since exercise has been shown to be an important factor in regulating immune cells and their functions, and considering that stress evokes inflammatory reactions, lymphocytes are considered the best candidate cell type to study physiological changes associated with exhaustive exercise [5]. Quantitative real-time PCR (qRT-PCR) is the technique of choice when trying to detect modifications in transcription levels in a reliable and reproducible manner. Nevertheless, there are some technical issues that must be taken into account, such as quality and quantification of the starting material, enzyme efficiency, and primer design. Different approaches have been proposed to normalize measurements of expression levels [8], but this is generally done using an internal control gene, known as a reference gene or as housekeeping gene (HKG), under the assumption that this has a constant level of expression in the chosen tissue, is not affected by the treatment and has no inter-individual variability. In addition, the reference gene and the target gene should have similar ranges of expression to avoid analytical problems. Widely expressed genes like ACTB, GAPDH or R18S are generally preferred, without preliminary analysis of their expression profiles under the specific study conditions [5,6,9]. Nevertheless, a number of studies report how commonly accepted HKGs do not always constitute reliable controls [10-14], because of unexpected variation in their expression profiles. More appropriately, multiple HKGs should be evaluated before their employment, and their stability should be measured in the context of the relevant experimental conditions. A number of statistical methods have been proposed to evaluate stability of gene expression and select the best HKGs in a given experimental setting [9,15-18]. The aim of this paper is to identify the best reference genes for qRT-PCR experiments investigating horse lymphocyte gene expression in exercise induced stress. Statistical algorithms implemented in geNorm [9], BestKeeper [19], and NormFinder [20] were used.

Results

To assess which are the most stable genes during strenuous exercise, nine potential HKGs were tested in ten endurance horses with a time course sampling strategy. A qRT-PCR assay, based on SYBR® Green detection, was designed for the transcription profiling of the nine genes (ACTB, B2M, GAPDH, HPRT, R18S, RPL32 SDHA, TFRC and UBB, Table 1). The specificity of the amplifications was confirmed by melting curve analyses (Additional files 1, 2, 3, 4, 5, 6, 7, 8, 9). For each assay, a standard curve was generated by using 4-fold serial dilutions of pooled cDNAs. As shown in Table 2, linear correlation coefficients (R2) varied from 0.998 to 1.000 and PCR efficiencies (E) ranged between 93.9 and 102.6%.
Table 1

Details of the nine genes evaluated.

Gene SymbolGene NameFunctionAccession Number
ACTBβ-actinCytoskeletal structural proteinAF035774
B2Mβ-2-microglobulinCytoskeletal protein involved in cell locomotionX69083
GAPDHglyceraldehyde-3-phosphate dehydrogenaseGlycolytic enzymeAF157126
HPRThypoxanthine phosphoribosyltransferaseMetabolic salvage of purines in mammalsAY372182
R18Sribosomal RNA 18SMember of ribosome RNAAJ311673
RPL32ribosomal protein L32Member of ribosomal proteinsCX594263
SDHAsuccinate dehydrogenase complex subunit AElectron transporter in the TCA cycle and respiratory chainDQ402987
TFRCtransferrin receptorIron uptakeDQ284764
UBBubiquitin BProtein degradationAF506969
Table 2

Assay conditions for each of the nine genes evaluated.

Gene symbolPrimers 5'-3' (forward, reverse)Amplicon length, bpPCR efficiency, %Correlation with dilution series (R2)
ACTBGGACCTGACGGACTACCTCCACGCACGATTTCCCTCTC8395.20.999
B2MCCTGCTCGGGCTACTCTCCATTCTCTGCTGGGTGACG89100.21.000
GAPDHATCTGACCTGCCGCCTGGAGCGATGCCTGCTTCACCACCTTC68102.61.000
HPRTAATTATGGACAGGACTGAACGGATAATCCAGCAGGTCAGCAAAG12193.91.000
R18SGTCTGCCCTATCAACTTTCGTTCCTTGGATGTGGTAGCC11994.10.998
RPL32GGGAGCAATAAGAAAACGAAGCCTTGGAGGAGACATTGTGAGC13897.01.000
SDHAGAGGAATGGTCTGGAATACTGGCCTCTGCTCCATAAATCG9196.00.999
TFRCTGGCTACTTGGGCTATTGTAAACGGGTGGTTCTGTTCCCTCTATCTCC9097.60.998
UBBTTCGTGAAGACCCTGACCCCTTATCCTGGATCTTGGC9199.40.999
Details of the nine genes evaluated. Assay conditions for each of the nine genes evaluated.

Expression levels of candidate reference genes

Cycle threshold values (Cts) for the nine HKGs tested ranged between 17.9 (ACTB) and 26.6 (TFRC). The gene encoding 18S rRNA is largely over expressed (Ct 9.1) compared to the protein coding genes. Each single control gene appeared to be equally expressed in the tested cDNA samples, and the variations of the Ct values (calculated for each single gene in the ten horse individuals subtracting the Min Ct from the Max Ct values) was always smaller than one (Figure 1).
Figure 1

Average Ct of candidate HKGs. Expression levels of candidate control genes in the ten endurance horses. Values are given as qRT-PCR cycle threshold numbers (Ct values). Circles represent mean Ct values, bars indicate the standard deviation.

Average Ct of candidate HKGs. Expression levels of candidate control genes in the ten endurance horses. Values are given as qRT-PCR cycle threshold numbers (Ct values). Circles represent mean Ct values, bars indicate the standard deviation.

Data analysis

Profiles obtained for each horse and HKG were analysed using three different methods, implemented in the software geNorm, NormFinder and BestKeeper. GeNorm provides a ranking of the tested genes, based on their expression stability, determining the two most stable HKGs for normalization purposes. Selected HKGs were ranked according to the stability measure M (average pair-wise variation of each gene against all others), from the most stable (lowest M value) to the least stable (highest M value): SDHA/HPRT, R18S, B2M, UBB, ACTB, RPL32, TFRC, GAPDH (Table 3). All genes displayed a relatively high stability over the three time course samplings, with M values (M < 0.8) far below the accepted limit of 1.5 [9]. The two most stably expressed genes of our pool (SDHA and HPRT) allow an optimal normalization of qRT-PCR data, and the addition of a third HKG (R18S) would not significantly increase the statistical reliability of this calculation (V2/3 = 0.090, abundantly below the default cut-off value of 0.15 [9]).
Table 3

Candidate reference genes ranking according to geNorm.

RankGene SymbolM valueV value
1/2SDHA/HPRT0.232---
3R18S0.2740.090
4B2M0.3110.078
5UBB0.3350.064
6ACTB0.3760.068
7RPL320.4050.059
8TFRC0.4480.065
9GAPDH0.5210.080

M value is calculated as average expression stability of control genes during stepwise exclusion of the least stable controls. V value is calculated as the pair-wise variation between two sequential normalization.

Candidate reference genes ranking according to geNorm. M value is calculated as average expression stability of control genes during stepwise exclusion of the least stable controls. V value is calculated as the pair-wise variation between two sequential normalization. The NormFinder algorithm uses a model-based approach for the estimation of modifications among the HKG expressions, also taking into account variation across sub-groups and avoiding artificial selection of co-regulated genes [20]. The results of the NormFinder analysis are shown in Table 4. This ranking appeared to be slightly different from what obtained using geNorm. GAPDH, TFRC and RPL32 still occupy the lowest positions, while SDHA remains the most stable gene. ACTB gained the second position stepping over HPRT and R18S defined as the least reliable controls.
Table 4

Candidate reference genes ranking according to NormFinder.

RankGene SymbolStability value
1SDHA0.056
2ACTB0.086
3R18S0.087
4HPRT0.093
5B2M0.103
6UBB0.111
7RPL320.124
8TFRC0.151
9GAPDH0.174
Candidate reference genes ranking according to NormFinder. BestKeeper measures HKG stability by using a pair-wise correlation analysis of all pairs of candidate genes and calculating the geometric mean of the best candidates [15,19]. A preliminary analysis, based on the inspection of raw Ct values, estimated the variation of all HKGs to be compatible with an overall stability in gene expression (Table 5), with SD values lower than 1. All genes were retained for the calculation of the BestKeeper index, which similarly exhibited a moderate SD variation (0.58). BestKeeper allows a comparative analysis across HKGs, by estimating correlations in the expression levels between all the possible candidates. Highly correlated control genes are combined into an index. Afterwards, the pair-wise correlation between genes and the correlation between each gene and the index are calculated, describing the consistency between the index and each HKG [15].
Table 5

Statistical output from BestKeeper analysis.

ACTBB2MGAPDHHPRTR18SRPL32SDHATFRCUBB
N303030303030303030
G Mean [Ct]17.8519.8423.2025.349.0721.1524.5126.5419.25
A Mean [Ct]17.8619.8523.2225.359.1021.1524.5226.5619.26
Min [Ct]16.9218.5520.9924.117.9720.1023.2225.1117.94
Max [Ct]19.2321.8625.0527.7612.0222.4226.9128.8821.46
SD [± Ct]0.490.510.710.620.570.460.660.730.64
CV [% Ct]2.772.573.082.436.282.182.702.753.35
coeff. of corr. [r]0.8900.9210.7080.963*0.949*0.8320.983*0.8440.935*
p-value0.0010.0010.0010.0010.0010.0010.0010.0010.001

Genes are listed in alphabetical order. N: number of samples; G Mean [Ct]: geometric mean of the Ct; A Mean [Ct]: arithmetic mean of the Ct; Min and Max [Ct]: extreme values of the Ct; SD [Ct]: standard deviation of the Ct; CV [% Ct]: coefficient of variance expressed as percentage on the Ct level. * Indicates the best correlation between control genes and the BestKeeper index.

Statistical output from BestKeeper analysis. Genes are listed in alphabetical order. N: number of samples; G Mean [Ct]: geometric mean of the Ct; A Mean [Ct]: arithmetic mean of the Ct; Min and Max [Ct]: extreme values of the Ct; SD [Ct]: standard deviation of the Ct; CV [% Ct]: coefficient of variance expressed as percentage on the Ct level. * Indicates the best correlation between control genes and the BestKeeper index. The nine control genes tested in our analysis correlated well one with one another and with the BestKeeper index (Table 5). The best correlation between one HKG and the BestKeeper index was obtained for SDHA (r = 0.983), followed by HPRT, R18S and UBB. The statistically significant correlation shown by SDHA with the BestKeeper index appeared to be consistent with the good performance of this gene as assessed by geNorm and NormFinder. It is also remarkable how GAPDH, RPL32 and TFRC, are again classified as the least reliable HKGs, showing the worst correlations with the determined BestKeeper index (Table 5).

Discussion

A number of authors have studied gene expression profiles in exercise induced stress using forefront technologies, like gene chips and qRT-PCR. This study is the first solid contribution in assessing which reference genes have to be used to validate and normalize qRT-PCR outcomes. Several methods have been proposed to allow accurate normalization of gene expression using qRT-PCR [9,19-22] but at present there is no consensus on which algorithm should be used to measure reference gene stability. A comparison of different methods of reference gene selection allows a better identification of the most reliable controls and reduces the risk of artificial selection of co-regulated transcripts [16]. We compared three different statistical approaches (geNorm, NormFinder and BestKeeper) to evaluate nine potential HKGs, in order to select the best reference gene to be used in studying exercise-induced stress in horses. The uniformity in gene ranking between the three software packages was generally high: SDHA is the most stable HKG according to all the three methods. HPRT similarly displays a constant significant stability. R18S always ranks third, B2M fourth and UBB fifth, and can be therefore considered plausible HKGs, even if the addition of supplementary reference genes would not significantly enhance the reliability of the normalization according to the geNorm analysis (V value, Table 3). Regarding ACTB, it is difficult to formulate a final judgement because, as already reported in a previous study [15], its classification is not consistent between the three software packages (6th in geNorm and BestKeeper, 2nd in NormFinder). Nevertheless, this gene shows an overall reduced variability, as attested by the M value calculated by geNorm and by its good correlation with the BestKeeper index (r = 0.890). GAPDH, TFRC and RPL32 were classified as the least stable genes and they are not likely to be useful in this given experimental system. Notably, the expression of GAPDH, that has been used as HKG in a previous exercise induced stress study [5], appears to be the least stable. In contrast with what reported elsewhere [23-26], R18S appears to be a good potential reference gene. Despite its good performance, the usefulness of this gene as a control is often doubted: some authors [27] tend to consider it unsuitable for normalization because its transcription is carried out by RNA polymerase I and because of its well known over-expression in comparison with mRNAs (as confirmed even in our experiments, Figure 1). Considering that HKGs that have expression levels comparable to the gene of interest are generally preferred [15], its usage should be carefully considered if used for the normalization of genes that exhibit low level of expression.

Conclusion

Our results indicate SDHA and HPRT as the most stable reference genes with a very good statistical reliability according to all the three software employed. Moreover, the use of only two genes (SDHA and HPRT) appears to be sufficient for a reliable normalization of the genes of interest; this result is of special interest for future high throughput applications of the technique.

Methods

Blood collection, RNA extraction and cDNA synthesis

Ten horses were chosen among participants to national endurance races (90–120 km). Blood samples were taken from the jugular vein and collected at three different time points: before, at the end of the race, and 24 hours after the race. Immediately after collection, peripheral blood mononuclear cells (PBMCs) were isolated by the Ficoll-Hypaque method (GE Healthcare, Pollards Wood, United Kingdom) from 8 ml of blood. Total RNA was extracted from approximately 1 × 107 PBMCs, using the Aurum Total RNA Fatty and Fibrous Tissue kit (Bio-Rad, Herculers CA, USA) according to the manufacturer's instructions. Genomic DNA was eliminated by a DNase treatment supplied with the kit. Extracted RNA was quantified using the Quant-It RNA assay (Invitrogen, Dorset, United Kingdom) in a VersaFluor fluorometer (Bio-Rad) and checked for integrity in a denaturing agarose gel electrophoresis with ethidium bromide staining. Successful removal of DNA contaminants was tested by absence of PCR amplification in the MC1R gene (GenBank accession number X98012, primers from [28]). 1.5 μg of total RNA were retro-transcribed using random hexamers and Superscript III Reverse Transcriptase (Invitrogen) according to the manufacturer's specifications. A PCR with ACTB primers (Table 2) was performed on each cDNA to check for successful retro-transcription.

Reference genes selection and primer design

Nine widely used reference genes were evaluated: β-actin (ACTB), glyceraldehyde-3P-dehydrogenase (GAPDH), hypoxanthine ribosyltransferase (HPRT1), β-2-microglobin (B2M), succinate dehydrogenase complex subunit A (SDHA), transferrin receptor (TFRC), ubiquitin B (UBB), ribosomal protein L32 (RPL32) and 18S ribosomal rRNA (R18S). In order to minimize the possibility of co-regulation, genes were selected from different functional classes. Primers were designed based on available sequences using the Primer3 software. Mfold [29] was used to check the chosen sequences to avoid designing primers in the region of template secondary structure; amplicon lengths were optimized to 68/138 bp to ensure optimal polymerization efficiency. Specificity of amplification was confirmed by sequencing. For each primer pair, a preliminary real-time assay was performed to evaluate the amplification of non-specific products or primer dimer artefacts (Additional files 1, 2, 3, 4, 5, 6, 7, 8, 9). Efficiency of RT-PCR (E), slope values, and correlation coefficients (R2) were determined (Table 2) using serial 1:4 dilutions of a template cDNA (pooled from the ten individuals studied, previously diluted 1:5). PCR products were subsequently resolved on 2% agarose gel to check for size specificity of the amplicon.

Real-time quantitative PCR

Five microliters of cDNA template (previously diluted 1:10) were added to the master mix FastStart SYBR Green Master (Roche Applied Science, Penzberg, Germany) with the ROX fluorochrome internal check. PCR reactions, in a volume of 25 μl were performed on a MX3000P machine (Stratagene, La Jolla CA, USA). PCR conditions were the same for all primer pairs: initial denaturation at 95°C for 10' followed by 40 cycles of denaturation at 95°C for 30", annealing at 58°C for 30" and extension at 72°C for 30". Fluorescence data were collected at the end of the extension step. Following cycling, the melting curve was determined in the range 58°–95°C, with a temperature slope of 0.01°C/sec. Each reaction was run in triplicate with appropriate negative controls. Baseline and threshold values were automatically determined for all plates and genes using the MxPro software ver. 3.20 (Stratagene). In order to ensure comparability between data obtained from different experimental plates, threshold values for each gene were manually set to the arithmetic mean between the thresholds as automatically determined following each run. Corrected Ct values were transformed to quantities based on the comparative Ct method. Following appropriate formatting, values were imported into geNorm (version 3.4), NormFinder (version 0.953) and BestKeeper (version 1) VBA applets.

Authors' contributions

KC, MF, SC performed all experiments and data analysis, and drafted the manuscript. GS supervised the study design and the data analysis. MS conceived the project, AVS supervised and coordinated the project and participated in writing the manuscript. All authors read and approved the final manuscript.

Additional file 1

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the ACTB gene. Click here for file

Additional file 2

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the B2M gene. Click here for file

Additional file 3

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the GAPDH gene. Click here for file

Additional file 4

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the HPRT gene. Click here for file

Additional file 5

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the R18S gene. Click here for file

Additional file 6

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the RPL32 gene. Click here for file

Additional file 7

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the SDHA gene. Click here for file

Additional file 8

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the TFRC gene. Click here for file

Additional file 9

Melting curve . Melting curve analyses image (jpg format) collected using using the MxPro software ver. 3.20 (Stratagene) during calibration experiments of the selected primer pair for the UBB gene. Click here for file
  29 in total

1.  Housekeeping gene variability in normal and carcinomatous colorectal and liver tissues: applications in pharmacogenomic gene expression studies.

Authors:  Carmelo Blanquicett; Martin R Johnson; Marty Heslin; Robert B Diasio
Journal:  Anal Biochem       Date:  2002-04-15       Impact factor: 3.365

2.  Mutations in the agouti (ASIP), the extension (MC1R), and the brown (TYRP1) loci and their association to coat color phenotypes in horses (Equus caballus).

Authors:  S Rieder; S Taourit; D Mariat; B Langlois; G Guérin
Journal:  Mamm Genome       Date:  2001-06       Impact factor: 2.957

3.  Mfold web server for nucleic acid folding and hybridization prediction.

Authors:  Michael Zuker
Journal:  Nucleic Acids Res       Date:  2003-07-01       Impact factor: 16.971

4.  Customized molecular phenotyping by quantitative gene expression and pattern recognition analysis.

Authors:  Shreeram Akilesh; Daniel J Shaffer; Derry Roopenian
Journal:  Genome Res       Date:  2003-07       Impact factor: 9.043

5.  Housekeeping genes as internal standards: use and limits.

Authors:  O Thellin; W Zorzi; B Lakaye; B De Borman; B Coumans; G Hennen; T Grisar; A Igout; E Heinen
Journal:  J Biotechnol       Date:  1999-10-08       Impact factor: 3.307

6.  Beta-actin--an unsuitable internal control for RT-PCR.

Authors:  S Selvey; E W Thompson; K Matthaei; R A Lea; M G Irving; L R Griffiths
Journal:  Mol Cell Probes       Date:  2001-10       Impact factor: 2.365

7.  Changes in physiological parameters in overtrained Standardbred racehorses.

Authors:  M J Hamlin; J P Shearman; W G Hopkins
Journal:  Equine Vet J       Date:  2002-07       Impact factor: 2.888

8.  Evaluation and validation of housekeeping genes in response to ionizing radiation and chemical exposure for normalizing RNA expression in real-time PCR.

Authors:  Malathi Banda; Aryamani Bommineni; Robert A Thomas; Leo S Luckinbill; James D Tucker
Journal:  Mutat Res       Date:  2007-08-19       Impact factor: 2.433

9.  The quantification of gene expression in an animal model of brain ischaemia using TaqMan real-time RT-PCR.

Authors:  Brian C Bond; David J Virley; Nigel J Cairns; A Jackie Hunter; Gary B T Moore; Stephen J Moss; Anne W Mudge; Frank S Walsh; Elena Jazin; Paul Preece
Journal:  Brain Res Mol Brain Res       Date:  2002-10-15

10.  Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.

Authors:  Jo Vandesompele; Katleen De Preter; Filip Pattyn; Bruce Poppe; Nadine Van Roy; Anne De Paepe; Frank Speleman
Journal:  Genome Biol       Date:  2002-06-18       Impact factor: 13.583

View more
  54 in total

1.  Validation of reference genes for real-time quantitative PCR studies in gene expression levels of Lactobacillus casei Zhang.

Authors:  Wenjing Zhao; Yan Li; Pengfei Gao; Zhihong Sun; Tiansong Sun; Heping Zhang
Journal:  J Ind Microbiol Biotechnol       Date:  2010-11-23       Impact factor: 3.346

2.  Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR.

Authors:  Jun-hong Sun; Liang-huan Nan; Cai-rong Gao; Ying-yuan Wang
Journal:  Int J Legal Med       Date:  2011-08-04       Impact factor: 2.686

3.  Short-term environmental enrichment, and not physical exercise, alleviate cognitive decline and anxiety from middle age onwards without affecting hippocampal gene expression.

Authors:  Gaurav Singhal; Julie Morgan; Magdalene C Jawahar; Frances Corrigan; Emily J Jaehne; Catherine Toben; James Breen; Stephen M Pederson; Anthony J Hannan; Bernhard T Baune
Journal:  Cogn Affect Behav Neurosci       Date:  2019-10       Impact factor: 3.282

4.  Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis.

Authors:  Magdalena Gamm; Marie-Claire Héloir; Jani Kelloniemi; Benoît Poinssot; David Wendehenne; Marielle Adrian
Journal:  Mol Genet Genomics       Date:  2011-02-22       Impact factor: 3.291

5.  Determination of reliable reference genes for multi-generational gene expression analysis on C. elegans exposed to abused drug nicotine.

Authors:  Faten A Taki; Baohong Zhang
Journal:  Psychopharmacology (Berl)       Date:  2013-05-17       Impact factor: 4.530

6.  Differentiation and activation of equine monocyte-derived dendritic cells are not correlated with CD206 or CD83 expression.

Authors:  Nathifa A Moyo; Emanuele Marchi; Falko Steinbach
Journal:  Immunology       Date:  2013-08       Impact factor: 7.397

7.  A protein-based set of reference markers for liver tissues and hepatocellular carcinoma.

Authors:  Stella Sun; Xin Yi; Ronnie Tp Poon; Chun Yeung; Philip J R Day; John M Luk
Journal:  BMC Cancer       Date:  2009-09-02       Impact factor: 4.430

8.  Reference genes for normalising gene expression data in collagenase-induced rat intracerebral haemorrhage.

Authors:  Naomi L Cook; Timothy J Kleinig; Corinna van den Heuvel; Robert Vink
Journal:  BMC Mol Biol       Date:  2010-01-20       Impact factor: 2.946

9.  Exercise-induced up-regulation of MMP-1 and IL-8 genes in endurance horses.

Authors:  Katia Cappelli; Michela Felicetti; Stefano Capomaccio; Camillo Pieramati; Maurizio Silvestrelli; Andrea Verini-Supplizi
Journal:  BMC Physiol       Date:  2009-06-24

10.  Quantitative TaqMan real-time PCR assays for gene expression normalisation in feline tissues.

Authors:  Yvonne Kessler; A Katrin Helfer-Hungerbuehler; Valentino Cattori; Marina L Meli; Bigna Zellweger; Pete Ossent; Barbara Riond; Claudia E Reusch; Hans Lutz; Regina Hofmann-Lehmann
Journal:  BMC Mol Biol       Date:  2009-12-11       Impact factor: 2.946

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.