| Literature DB >> 24632997 |
Caihong Wang1, Xiaojiao Liu2, Suotang Peng2, Qun Xu1, Xiaoping Yuan1, Yue Feng1, Hanyong Yu1, Yiping Wang1, Xinghua Wei1.
Abstract
Wild species of Oryza are extremely valuable sources of genetic material that can be used to broaden the genetic background of cultivated rice, and to increase its resistance to abiotic and biotic stresses. Until recently, there was no sequence information for the BBCC Oryza genome; therefore, no special markers had been developed for this genome type. The lack of suitable markers made it difficult to search for valuable genes in the BBCC genome. The aim of this study was to develop microsatellite markers for the BBCC genome. We obtained 13,991 SSR-containing sequences and designed 14,508 primer pairs. The most abundant was hexanuclelotide (31.39%), followed by trinucleotide (27.67%) and dinucleotide (19.04%). 600 markers were selected for validation in 23 accessions of Oryza species with the BBCC genome. A set of 495 markers produced clear amplified fragments of the expected sizes. The average number of alleles per locus (Na) was 2.5, ranging from 1 to 9. The genetic diversity per locus (He) ranged from 0 to 0.844 with a mean of 0.333. The mean polymorphism information content (PIC) was 0.290, and ranged from 0 to 0.825. Of the 495 markers, 12 were only found in the BB genome, 173 were unique to the CC genome, and 198 were also present in the AA genome. These microsatellite markers could be used to evaluate the phylogenetic relationships among different Oryza genomes, and to construct a genetic linkage map for locating and identifying valuable genes in the BBCC genome, and would also for marker-assisted breeding programs that included accessions with the AA genome, especially Oryza sativa.Entities:
Mesh:
Substances:
Year: 2014 PMID: 24632997 PMCID: PMC3954799 DOI: 10.1371/journal.pone.0091826
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
The statistics about the sequence assembly.
| Category | Length (bp) | Number |
| sum | 480,470,380 | 225,833 |
| ave | 2,128 | |
| largest | 41,615 | |
| N50 | 2,329 | 65,627 |
| N90 | 1,203 | 182,019 |
Occurrence of the sequence analysis and microsatellites in the genome survey.
| Category | Numbers |
| Total number of sequences examined | 225,833 |
| Total size of examined sequences (bp) | 480,470,380 |
| Total number of identified SSRs | 16,197 |
| Number of SSR containing sequences | 13,991 |
| Number of sequences containing more than 1 SSR | 1,814 |
| Number of SSRs present in compound formation | 503 |
Figure 1Frequencies of different classes of nucleotide repeats.
(A) 14508 primer pairs; (B) 600 selected primer pairs.
Details of 46 and 5 microsatellites specific to Oryza minuta and Oryza punctata, respectively.
| Locus | Repeat motif | Forward primer (5'-3') | Reverse primer (5'-3') | Tm(°C) | Expected product size (bp) |
|
| ||||||
| Especially |
|
|
| Especially |
|
|
| ||||||
| CN001 | (CAGCT)4 |
|
| 60 | 100 | √ | 2 | 0.298 | 0.253 | ||||
| CN019 | (CTTTTC)4 |
|
| 60 | 115 | √ | 1 | 0.000 | 0.000 | ||||
| CN026 | (AATT)5 |
|
| 60 | 120 | √ | 2 | 0.444 | 0.346 | ||||
| CN028 | (CTTTAT)3 |
|
| 60 | 120 | √ | 1 | 0.000 | 0.000 | ||||
| CN032 | (CTCCGT)3 |
|
| 60 | 122 | √ | 2 | 0.180 | 0.164 | ||||
| CN036 | (ATCTAT)3 |
|
| 60 | 125 | √ | 1 | 0.000 | 0.000 | ||||
| CN040 | (AAAC)5 |
|
| 60 | 128 | √ | 1 | 0.000 | 0.000 | ||||
| CN049 | (TC)14 |
|
| 60 | 133 | √ | 1 | 0.000 | 0.000 | ||||
| CN066 | (AAGATA)3 |
|
| 60 | 146 | √ | 3 | 0.292 | 0.272 | ||||
| CN070 | (GAATCG)3 |
|
| 58 | 148 | √ | 1 | 0.000 | 0.000 | ||||
| CN079 | (AGAGGG)3 |
|
| 59 | 153 | √ | 3 | 0.512 | 0.444 | ||||
| CN081 | (CTG)6 |
|
| 60 | 154 | √ | 1 | 0.000 | 0.000 | ||||
| CN082 | (AAAATG)3 |
|
| 59 | 154 | √ | 1 | 0.000 | 0.000 | ||||
| CN093 | (CAAC)5 |
|
| 60 | 159 | √ | 1 | 0.000 | 0.000 | ||||
| CN099 | (AAAGG)4 |
|
| 60 | 161 | √ | 1 | 0.000 | 0.000 | ||||
| CN102 | (ATATAC)3 |
|
| 60 | 161 | √ | 2 | 0.444 | 0.346 | ||||
| CN108 | (TTTAT)5 |
|
| 60 | 165 | √ | 1 | 0.000 | 0.000 | ||||
| CN124 | (TTGTG)4 |
|
| 60 | 169 | √ | 1 | 0.000 | 0.000 | ||||
| CN150 | (CGC)8 |
|
| 60 | 178 | √ | 4 | 0.597 | 0.552 | ||||
| CN156 | (AGG)6 |
|
| 60 | 179 | √ | 2 | 0.298 | 0.253 | ||||
| CN171 | (ATGAAG)3 |
|
| 60 | 184 | √ | 1 | 0.000 | 0.000 | ||||
| CN174 | (T)18 |
|
| 60 | 185 | √ | 1 | 0.000 | 0.000 | ||||
| CN181 | (CAACGG)3 |
|
| 60 | 185 | √ | 1 | 0.000 | 0.000 | ||||
| CN189 | (CCTCGT)3 |
|
| 60 | 188 | √ | 2 | 0.153 | 0.141 | ||||
| CN206 | (CCAAAT)3 |
|
| 60 | 194 | √ | 1 | 0.000 | 0.000 | ||||
| CN207 | (CGGTCA)3 |
|
| 60 | 194 | √ | 1 | 0.000 | 0.000 | ||||
| CN208 | (TC)9 |
|
| 60 | 195 | √ | 3 | 0.542 | 0.460 | ||||
| CN210 | (ACAT)5acacacat(ATAC) 7atatatatgtgtgtg(TATGTA)3 |
|
| 60 | 198 | √ | 1 | 0.000 | 0.000 | ||||
| CN212 | (GCGAG)4 |
|
| 60 | 198 | √ | 1 | 0.000 | 0.000 | ||||
| CN217 | (CCAGCG)3 |
|
| 60 | 199 | √ | 1 | 0.000 | 0.000 | ||||
| CN253 | (TCTTC)4 |
|
| 61 | 208 | √ | 2 | 0.165 | 0.152 | ||||
| CN275 | (CAACGG)3 |
|
| 60 | 211 | √ | 2 | 0.153 | 0.141 | ||||
| CN281 | (GCGA)5 |
|
| 60 | 213 | √ | 1 | 0.000 | 0.000 | ||||
| CN283 | (CT)9 |
|
| 60 | 214 | √ | 1 | 0.000 | 0.000 | ||||
| CN287 | (CTTTAT)3 |
|
| 59 | 214 | √ | 1 | 0.000 | 0.000 | ||||
| CN300 | (CAATGG)3 |
|
| 60 | 218 | √ | 1 | 0.000 | 0.000 | ||||
| CN310 | (CCG)6 |
|
| 60 | 221 | √ | 1 | 0.000 | 0.000 | ||||
| CN330 | (AGTGCT)3 |
|
| 60 | 225 | √ | 1 | 0.000 | 0.000 | ||||
| CN348 | (CGCCCG)3 |
|
| 60 | 229 | √ | 1 | 0.000 | 0.000 | ||||
| CN356 | (CTTCAG)3 |
|
| 60 | 230 | √ | 1 | 0.000 | 0.000 | ||||
| CN379 | (ATCC)5 |
|
| 60 | 235 | √ | 1 | 0.000 | 0.000 | ||||
| CN387 | (CTC)7 |
|
| 60 | 237 | √ | 1 | 0.000 | 0.000 | ||||
| CN391 | (AGA)9 |
|
| 61 | 238 | √ | 2 | 0.153 | 0.141 | ||||
| CN418 | (CGGAAA)4 |
|
| 60 | 241 | √ | 2 | 0.153 | 0.141 | ||||
| CN434 | (CTAGCT)3 |
|
| 60 | 245 | √ | 1 | 0.000 | 0.000 | ||||
| CN453 | (GTC)6gctcccttgctcctcgccat gcttcgggtgaagctggcgagg(GTG)6 |
|
| 61 | 251 | √ | 3 | 0.500 | 0.449 | ||||
| CN467 | (ATCTAA)3(TCTAAA)4 |
|
| 60 | 267 | √ | 1 | 0.000 | 0.000 | ||||
| CN476 | (GA)11 |
|
| 60 | 271 | √ | 1 | 0.000 | 0.000 | ||||
| CN478 | (AATAGG)3 |
|
| 60 | 271 | √ | 1 | 0.000 | 0.000 | ||||
| CN486 | (AAAAGT)3 |
|
| 60 | 276 | √ | 1 | 0.000 | 0.000 | ||||
| CN490 | (TG)9 |
|
| 60 | 279 | √ | 1 | 0.000 | 0.000 | ||||
| Mean | 1.4 | 0.093 | 0.081 | 1.4 | 0.125 | 0.102 | |||||||
Figure 2Neighbor-Joining tree of 48 accessions based on Nei's unbiased genetic distance from 495 SSR markers.
Bootstrap values (out of 100) are indicated at the branch points.