Literature DB >> 24594288

Development and evaluation of reverse transcription loop-mediated isothermal amplification assay for the detection of the fathead minnow nidovirus.

Qingli Zhang1, Isaac Standish2, Andrew D Winters3, Corey Puzach4, Rachel Ulferts5, John Ziebuhr6, Mohamed Faisal7.   

Abstract

Fathead minnow nidovirus (FHMNV) is a serious baitfish-pathogenic virus in North America. Studies to trace the spread of the virus and determine its host range are hampered by the absence of reliable diagnostic assays. In this study, a one-step, reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed that targets a region in the FHMNV spike protein gene. The assay was optimized, and the best results were obtained at 8 mM of Mg(2+) with an incubation time of 40 min at 63 °C in the presence of calcein. The analytical sensitivity of the RT-LAMP method was estimated to be as low as 5 viral copies and was 1000-fold more sensitive than the conventional reverse transcription polymerase chain reaction (RT-PCR) method. The diagnostic sensitivity and specificity of the developed RT-LAMP assay versus the RT-PCR assay was 100% and 95.7%, respectively. A quantitative RT-LAMP of FHMNV with a high correlation coefficient (r(2)=0.9926) was also developed and the result of quantitation of viral copies in tissue samples of infected fish showed that the viral loads of the infected fish tissue samples reached up to 4.7×10(10) copies per mg. It is anticipated that the developed RT-LAMP and quantitative RT-LAMP methods will be instrumental for diagnosis and surveillance of FHMNV.
Copyright © 2014 Elsevier B.V. All rights reserved.

Entities:  

Keywords:  Calcein; Fathead minnow nidovirus; Quantitative RT-LAMP; Real-time; Reverse transcription loop-mediated isothermal amplification

Mesh:

Substances:

Year:  2014        PMID: 24594288      PMCID: PMC7113640          DOI: 10.1016/j.jviromet.2014.02.018

Source DB:  PubMed          Journal:  J Virol Methods        ISSN: 0166-0934            Impact factor:   2.014


Introduction

In 1997, a bacilliform virus was isolated from fathead minnows (Pimephales promelas) exhibiting external hemorrhages and necrotic changes in visceral organs (Iwanowicz and Goodwin, 2002). The isolated virus, originally believed to belong to the family Rhabdoviridae, measured 130–180 nm in length and 31–47 nm in diameter. Additional phylogenetic analyses based on the complete genome proved that the fathead minnow virus isolate is a species within the genus Bafinivirus, subfamily Torovirinae, family Coronaviridae, order Nidovirales and was named the fathead minnow nidovirus (FHMNV, Batts et al., 2012). The detection of FHMNV and the marked pathology it causes raised concerns about potential losses in the multi-billion dollar baitfish industry and the potential for transmitting this deadly infectious agent to other water bodies, thereby threatening other native fish species. In order to augment sport and commercial fisheries in the Laurentian Great Lakes basin, natural resource agencies propagate species such as the muskellunge (Esox masquinongy) in hatcheries and then release them into inland lakes to establish sustainable populations (Dexter and O’Neal, 2004). This entails feeding live baitfish, primarily fathead minnows, to these propagated fish. The risk of transmitting FHMNV to these hatchery-propagated fish and the losses it may cause remains to be determined. Currently, the only available diagnostic protocol for FHMNV is the reverse transcription polymerase chain reaction (RT-PCR) developed by Batts et al. (2012). This assay was used successfully to confirm the presence of FHMNV in cultured cell lines that exhibited syncytia formation, a characteristic cytopathic effect of this nidovirus. Herein, we report on the development of a rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of FHMNV in infected cell lines and fish tissues. In addition, a protocol to quantify FHMNV in infected fish tissue samples has been developed.

Materials and methods

Cell, virus and template RNA

Epithelioma papulosum cyprini cell line (EPC) was used throughout this study. The cells were allowed to grow at 25 °C in 150 cm2 tissue culture flasks containing Eagle's minimum essential medium (MEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gemini Bio-Products, CA, USA) and adjusted to pH of 7.4 using 7.5% sodium bicarbonate until 80–90% confluent and then incubated at 20 °C until used. The initial FHMNV strain used was originally isolated in the Aquatic Animal Health Laboratory of Michigan State University, East Lansing, Michigan, USA, from spontaneously infected juvenile muskellunge. The virus was allowed to replicate in EPC cells until the characteristic giant cells dominated the cell monolayer. Viral RNA was extracted from infected EPC cells using a QIAamp viral RNA kit (Qiagen, Hilden, Germany) following the manufacturer's protocol. For RNA extraction from infected fathead minnow and muskellunge kidney and spleen tissue samples, the QIAamp® viral RNA Mini Kit (Qiagen) was used. cDNA were synthesized by the Reverse Transcription System (Promega, Madison, WI, USA) using random primers.

Primer design for the FHMNV RT-LAMP

It has been shown that, for the majority of nidoviruses with large genomes (26.3–31.6 kb), the gene sequence encoding for three protein domains (3CLpro, RdRp, and HEL1) is highly conserved while other genes are more variable (Nga et al., 2011, Lauber et al., 2012). To develop an RT-LAMP assay specific to FHMNV, the spike glycoprotein gene, which has been shown to be comparatively variable among other genes within nidovirus genomes (Nga et al., 2011, Lauber et al., 2012), was chosen as the target gene for this assay. Three pairs of RT-LAMP primers, including a pair of loop primers, were designed as described by Nagamine et al. (2002). The spike protein gene from the FHMNV genome (GenBank accession number GU002364) was submitted to the website (http://primerexplorer.jp/elamp4.0.0/index.html) and a set of RT-LAMP primers was generated by the Primer Explorer software, version 4.0 (Table 1 and Fig. 1 ).
Table 1

Primers used for reverse transcriptase loop-mediated isothermal amplification of the fathead minnow nidovirus.

PrimerSequence
F3ACGTAAAGAATCTCAGAGATGA
B3TGAACTTTTGAGAGGTGACT
FIP (F1c + TTTT + F2)CGTCTGCTGTTGTTTTGACAAACTTTTGTGCAGCAAACTTCAAAGC
BIP (B1c + TTTT + B2)TTGCAGCACAGAATGAAGTGATTTTATGGCCATATCCTTAAGGGA
LFGCGTTGTGCTTTTCTTCGATG
LBCAAAGGATTCAACTCAAACATCGAC
Fig. 1

RT-LAMP target spike protein gene for the fathead minnow nidovirus (GenBank accession number GU002364). Nucleotide sequences used for primer design are indicated by boxes and arrows. F, forward primer; B, backward primer; LF, loop-forward primer; LB, loop-backward primer.

Primers used for reverse transcriptase loop-mediated isothermal amplification of the fathead minnow nidovirus. RT-LAMP target spike protein gene for the fathead minnow nidovirus (GenBank accession number GU002364). Nucleotide sequences used for primer design are indicated by boxes and arrows. F, forward primer; B, backward primer; LF, loop-forward primer; LB, loop-backward primer.

Optimization of FHMNV RT-LAMP conditions

The RT-LAMP reaction was conducted as described by Tomita et al. (2008) and Zhang et al. (2013), with minor modifications. The reaction was carried out in a 20 μL reaction mixture containing 1.6 μM each of FIP and BIP primers; 0.8 μM each of LF and LB primers; 0.2 μM each of F3 and B3 primers; 1 × isothermal amplification buffer (20 mM Tris–HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween 20, pH 8.8); 6 mM MgCl2; 1 M betaine; 1.4 mM each deoxynucleoside triphosphate (dNTP); 0.2 mM MnCl2; 20 μM Calcein; 2U AMV Reverse Transcriptase (Invitrogen); 8U Bst DNA polymerase (New England Biolabs, Beverly, MA, USA); and 1 μL of template RNA. The mixture was incubated for 60 min in a Mastercycler gradient PCR machine (Eppendorf, Hauppauge, NY, USA) at 57, 60, 63, 66 or 69 °C followed by 80 °C for 20 min to terminate the reaction. Reaction tubes were collected at 10, 20, 30, 40, 50 or 60 min to determine the optimal reaction time for amplification at 63 °C as predetermined. Likewise, the optimal concentration of Mg2+ was determined by running the reaction in the presence of 4, 6, 8, 10, or 12 mM at 63 °C for 40 min. RT-LAMP amplification products (2.5 μL) were subjected to electrophoresis on a 2.0% agarose gel.

Specificity of FHMNV RT-LAMP assay

The specificity of the developed assay was tested against three other nidoviruses, the white bream virus (WBV, Schütze et al., 2006), which is the most closely related virus and only other known species within the genus Bafinivirus (Batts et al. (2012), as well as two viruses representing more distantly related nidoviruses: the human coronavirus 229E (HCoV-229E, genus Alphacoronavirus, subfamily Coronavirinae, family Coronaviridae) and Cavally virus (CavV, genus Alphamesonivirus, family Mesoniviridae) (Zirkel et al., 2011). In all cases, total RNA isolated from cells infected with WBV (EPC cells), HCoV-229E (HuH-7 cells) and CavV (C6/36 cells), respectively, was used as template. The cells were infected with the appropriate virus at a multiplicity of infection of 3 TCID50 per cell and total RNA was isolated at 48 h p.i. Additionally, the specificity of the FHMNV LAMP assay was tested against three fish pathogenic rhabdoviruses isolated from infected cells: infectious hematopoietic necrosis virus (genus Novirhabdovirus), viral hemorrhagic septicemia virus genotype IVb (genus Novirhabdovirus), and the spring viremia of carp virus (genus Vesiculorhabdovirus). Additional fish pathogenic viruses used for specificity testing included the infectious pancreatic necrosis virus (genus Aquabirnavirus) isolated from infected cells and the genomic DNA of alloherpesvirus epizootic epitheliotropic disease virus (EEDV, salmonids herpesvirus 3), recovered from lake trout infected with EEDV. DNA and RNA of these viruses were used as template of the RT-LAMP using the primers designed for the detection of FHMNV under the predetermined conditions described above.

Analytical sensitivity of the FHMNV RT-LAMP assay

The detection limit of the RT-LAMP assay was analyzed with two kinds of templates. One of the templates was the total RNA extracted from the EPC cells infected by FHMNV. The other template was a plasmid pCR®2.1-TOPO® vector containing the target fragment from the FHMNV spike protein gene (designated as pCR®2.1-FHMNV). A 10-fold serial dilution of the total RNA (1.6 fg × 106 to 10−1) and the plasmid pCR®2.1-FHMNV (5 × 107 to 10−2 copies) were used as the template for qRT-LAMP under the conditions predetermined earlier. After the reaction, the products were analyzed on a 2% agarose gel and documented using LAS3000 Gel Imaging System (Fujifilm Medical Systems, Stamford, CT, USA).

Analytical sensitivity of the FHMNV RT-PCR assay

The detection limit of the developed FHMNV RT-LAMP assay was compared to the RT-PCR developed by Batts et al. (2012). A 10-fold serial dilution of the total RNA (1.6 fg × 106 to 10−1) was amplified by both the RT-PCR and FHMNV RT-LAMP. The SYBR® Green (Invitrogen) stained RT-PCR products were analyzed on a 1.5% agarose gel, while the RT-LAMP was performed under the optimized conditions described above.

Evaluation of the FHMNV RT-LAMP assay on samples

The newly developed RT-LAMP assay was used to determine the presence of FHMNV in 85 samples, including seven FHMNV isolates obtained using EPC cell lines from spontaneously infected fathead minnows; one isolate that was retrieved using EPC cell lines from spontaneously infected muskellunge; kidney and spleen tissue samples collected from 60 spontaneously infected hatchery propagated juvenile muskellunge (Wolf Lake State Fish Hatchery, Mattawan, MI, USA); eight kidney and spleen tissue samples from experimentally infected juvenile muskellunge; and nine kidney and spleen tissue samples experimentally infected fathead minnows. Total RNA of the samples was extracted and the optimized FHMNV RT-LAMP was performed as described above. Simultaneously, RT-PCR assays (as described by Batts et al., 2012) were performed on the same total RNA samples. Amplification products were electrophoresed and analyzed on a 2% agarose gel. The diagnostic sensitivity (DSe) and specificity (DSp) of the two methods, as defined by the World Organization for Animal Health (2011), were calculated as detailed in Zhang et al. (2013).

Quantitative FHMNV RT-LAMP assay

To determine viral load in infected fish tissues, the RNA extracted from the kidney and spleen tissue samples of the 77 fish used in 2.7 was amplified by quantitative RT-LAMP (qRT-LAMP). The qRT-LAMP assay was established by using ten-fold dilutions of FHMNV plasmid DNA (pCR®2.1-FHMNV) as standards and carried out in a final reaction volume of 20 μL, as described above. For real-time monitoring, the qRT-LAMP reactions were incubated at 63 °C for 40 cycles (one minute per cycle) with an Eppendorf realplex 2 (Eppendorf). The change of fluorescence value was monitored every minute at 520 nm.

Results

Determination of the conditions for FHMNV detection by RT-LAMP

The results demonstrated that we were able to optimize the RT-LAMP assay for the detection and quantitation of FHMNV in both infected cell culture and fish tissue samples. No clear bands were obtained when no additional MgCl2 was added to the isothermal reaction buffer which contained 2 mM MgSO4. The best results in terms of obtaining clear bands and maximizing amplification products were obtained when the Mg2+ concentration was at 8 mM (Fig. 2A). Therefore, we considered the optimal Mg2+ concentration to be 8 mM and further optimization experiments were performed at that concentration. The optimum temperature for RT-LAMP was found to be 63 °C, at which clear bands and maximum amplification products were obtained (Fig. 2B). Using the optimized Mg2+ concentration and incubation temperature, amplified products could be observed as early as 20 min after starting the reaction. An additional 10–20 min of reaction time, however, produced better amplification results (Fig. 2C). Based on these findings, further RT-LAMP assays were allowed a reaction time of 40 min at 63 °C with 8 mM Mg2+ final concentration.
Fig. 2

Optimization of the RT-LAMP reaction for the detection of the fathead minnow nidovirus spike protein gene. (A) Effect of Mg2+ concentrations on the RT-LAMP reaction at 63 ̊C. (B) Effect of temperature on the RT-LAMP reaction using 8 mM Mg2+. (C) Effect of reaction time on the RT-LAMP reaction using 8 mM MgCl2, incubation at 64 °C plus DNA Ladder (Invitrogen, Carlsbad, CA, USA).

Optimization of the RT-LAMP reaction for the detection of the fathead minnow nidovirus spike protein gene. (A) Effect of Mg2+ concentrations on the RT-LAMP reaction at 63 ̊C. (B) Effect of temperature on the RT-LAMP reaction using 8 mM Mg2+. (C) Effect of reaction time on the RT-LAMP reaction using 8 mM MgCl2, incubation at 64 °C plus DNA Ladder (Invitrogen, Carlsbad, CA, USA).

Analytical specificity of the RT-LAMP assay for FHMNV

Positive results were only obtained when RNA from the FHMNV strains was used as template. RNA or DNA from other viruses including the closely related WBV was not amplified by the RT-LAMP (Fig. 3 ). Furthermore, both BLAST and EMBL searches revealed that the target sequence (189 bp) did not align with any other viral sequences available in these databases, including members of other nidovirus (sub)families, such as the equine torovirus (EToV, genus Torovirus), gill-associated virus (GAV Okavirus), infectious bronchitis virus (IBV Gammacoronavirus) and equine arteritis virus (EAV Arterivirus). Altogether, these results indicate that the RT-LAMP method is specific for amplification of FHMNV nucleic acid.
Fig. 3

Sybr green-stained agarose gel illustrating the specificity of amplification by the RT-LAMP assay using the primers designed for the detection of fathead minnow nidovirus (FHMNV). Amplification occurred only with the FHMNV but not with the white bream virus (WBV), the Cavally virus (CavV), the infectious hematopoietic necrosis virus (IHNV), infectious pancreatic necrosis virus (IPNV), viral hemorrhagic septicemia virus (VHSV), epizootic epitheliotropic disease virus (EEDV), spring viremia of carp virus (SVCV), or human coronavirus 229E (HCoV-229E). NC, negative control; M, 1Kb plus DNA Ladder.

Sybr green-stained agarose gel illustrating the specificity of amplification by the RT-LAMP assay using the primers designed for the detection of fathead minnow nidovirus (FHMNV). Amplification occurred only with the FHMNV but not with the white bream virus (WBV), the Cavally virus (CavV), the infectious hematopoietic necrosis virus (IHNV), infectious pancreatic necrosis virus (IPNV), viral hemorrhagic septicemia virus (VHSV), epizootic epitheliotropic disease virus (EEDV), spring viremia of carp virus (SVCV), or human coronavirus 229E (HCoV-229E). NC, negative control; M, 1Kb plus DNA Ladder.

Comparison of the analytical sensitivities of RT-LAMP and RT-PCR

When the reaction was tested using 1 μL of 10-fold serial dilutions of plasmid pCR®2.1-FHMNV DNA (23.3 ng/μL equivalent to 5.4 × 109  copies/μL), the analytical sensitivity of the qRT-LAMP method was estimated to be as low as five copies of the plasmid (Fig. 4A). When the reactions were tested using 1 μL of 10-fold serial dilutions of RNA from EPC cells infected by FHMNV both for RT-LAMP and RT-PCR, the analytical sensitivities of the RT-LAMP method and RT-PCR were 1.6 fg and 1.6 pg total RNA, respectively (Fig. 4B). The DNA fragment produced by the RT-PCR was 278 bp (Fig. 4C).
Fig. 4

Sensitivity of RT-LAMP and RT-PCR detection methods for the fathead minnow nidovirus (FHMNV). (A) Sensitivity of RT-LAMP detection of pCR®2.1-FHMNV plasmid containing the targeted DNA fragment from the spike protein gene of FHMNV. In lanes 1–9 the reaction was conducted using 10-fold serial dilutions of the plasmid (pCR®2.1-FHMNV) DNA of 5.4 × 107 to 0 copies, respectively, while lane 10 served as a negative control. (B) Sensitivity of RT-LAMP detection of RNA from EPC cells infected by FHMNV. In lanes 1–8 the reaction was conducted using 10-fold serial dilutions of RNA from FHMNV infected fish of 1.6 × 105 to 0 fg, respectively. (C) Sensitivity of RT-PCR detection of RNA from FHMNV infected fathead minnow tissues. In lanes 1–8, the reaction was conducted using 10-fold serial dilutions of RNA from FHMNV infected fish of 1.6 × 105 to 0 fg, respectively. The sizes of the DNA fragment produced by the RT-PCR were 278 bp, as shown by the arrowhead. M, 1 Kb plus DNA Ladder.

Sensitivity of RT-LAMP and RT-PCR detection methods for the fathead minnow nidovirus (FHMNV). (A) Sensitivity of RT-LAMP detection of pCR®2.1-FHMNV plasmid containing the targeted DNA fragment from the spike protein gene of FHMNV. In lanes 1–9 the reaction was conducted using 10-fold serial dilutions of the plasmid (pCR®2.1-FHMNV) DNA of 5.4 × 107 to 0 copies, respectively, while lane 10 served as a negative control. (B) Sensitivity of RT-LAMP detection of RNA from EPC cells infected by FHMNV. In lanes 1–8 the reaction was conducted using 10-fold serial dilutions of RNA from FHMNV infected fish of 1.6 × 105 to 0 fg, respectively. (C) Sensitivity of RT-PCR detection of RNA from FHMNV infected fathead minnow tissues. In lanes 1–8, the reaction was conducted using 10-fold serial dilutions of RNA from FHMNV infected fish of 1.6 × 105 to 0 fg, respectively. The sizes of the DNA fragment produced by the RT-PCR were 278 bp, as shown by the arrowhead. M, 1 Kb plus DNA Ladder.

Application of the newly developed RT-LAMP assay for detection of FHMNV in tissue culture and fish tissue samples

Eight FHMNV isolates and 60 spontaneously infected fish samples were used simultaneously to compare between the RT-LAMP and RT-PCR methods. Results of both RT-LAMP and RT-PCR confirmed the identity of the eight isolates as FHMNV. RT-PCR results indicated that 13 of the 60 fish samples were infected by FHMNV and the rest of the samples were FHMNV-negative. The RT-LAMP assay showed that the RNA templates from the 13 FHMNV-positive samples as determined by the RT-PCR also produced positive RT-LAMP results. Furthermore, two of the 47 samples that were FHMNV-negative by RT-PCR yielded a positive result by the RT-LAMP (Table 2, Table 3 ). Therefore, the DSe and DSp of the RT-LAMP method compared to the RT-PCR method were 100% and 95.7%, respectively.
Table 2

Detection of the fathead minnow nidovirus from infected EPC cell culture and infected fish tissue samples by both the newly developed RT-LAMP and conventional RT-PCR of Batts et al. (2012).

Detection resultsRT-PCR positiveRT-PCR negativeTotal
FHMNV-RT-LAMP positive382a40
FHMNV-RT-LAMP negative04545
Total384785

Both negative samples by RT-PCR were from infected fish samples.

Table 3

Comparison of results of conventional RT-PCR (Batts et al., 2012) assay and the newly developed qRT-LAMP for the detection of the fathead minnow nidovirus in fish tissue samples of spontaneously and experimentally infected muskellunge and fathead minnows. Virus load is expressed as copies/mg tissues.

#RT-PCRqRT-LAMP #copies#RT-PCRqRT-LAMP #copies#RT-PCRqRT-LAMP #copies
1aNone27None53None
2None28None54None
3None29None55None
4None30None56None
5None31None57None
6None32+3.1 × 10458d6.1 × 104
7None33None59None
8+2.4 × 10434None60None
9+9 × 10335None61b+4.7 × 1010
10+1.2 × 10536None62+3.8 × 104
11+6.7 × 10337None63+4.3 × 107
12None38None64+3.6 × 105
13None39None65+3.9 × 106
14None40+1.6 × 10466+4.8 × 103
15None41+1.5 × 10467+2.0 × 105
16+1.6 × 10442+2.7 × 10468+4.3 × 102
17+1.3 × 10443+2.6 × 10469c+1.2 × 105
18None44None70+3.5 × 106
19None45None71+1.8 × 105
20None46None72+8.6 × 104
21None47None73+1.6 × 106
22None48None74+2.6 × 104
23None49None75+1.6 × 104
24None50d4.1 × 10376+1.1 × 105
25d2.7 × 10351None77+9.2 × 103
26+6.4 × 10452None
PC+4.0 × 104NCNone

PC represents positive control and NC represents negative control.

Samples 1–60 are from spontaneously infected muskellunge.

Samples 61–68 are from experimentally infected juvenile muskellunge.

Samples 69–77 are from experimentally infected fathead minnows.

Notice samples 25, 50, and 58 were negative by RT-PCR but tested positive by qRT-LAMP.

Detection of the fathead minnow nidovirus from infected EPC cell culture and infected fish tissue samples by both the newly developed RT-LAMP and conventional RT-PCR of Batts et al. (2012). Both negative samples by RT-PCR were from infected fish samples. Comparison of results of conventional RT-PCR (Batts et al., 2012) assay and the newly developed qRT-LAMP for the detection of the fathead minnow nidovirus in fish tissue samples of spontaneously and experimentally infected muskellunge and fathead minnows. Virus load is expressed as copies/mg tissues. PC represents positive control and NC represents negative control. Samples 1–60 are from spontaneously infected muskellunge. Samples 61–68 are from experimentally infected juvenile muskellunge. Samples 69–77 are from experimentally infected fathead minnows. Notice samples 25, 50, and 58 were negative by RT-PCR but tested positive by qRT-LAMP.

Quantitative RT-LAMP assay

For the quantitative detection of FHMNV in samples, a standard curve was generated for FHMNV qRT-LAMP by plotting a graph between different concentrations of pCR®2.1-FHMNV plasmids ranging from 107 to 102 copy numbers to cycle threshold (Ct) value through real-time monitoring of the amplification. A high correlation coefficient (r 2  = 0.9926) was obtained by the qRT-LAMP (Fig. 5A and B). Based on the Ct value of all RNA samples, the quantitation of viral copies in the kidney and spleen of 77 clinical samples was extrapolated by employing the standard curve. The viral loads of the positive clinical samples varied within the range of 4.3 × 102 to 4.7 × 1010 copies per mg tissue (Table 3).
Fig. 5

The amplification plots and standard curve of the serial 10-fold dilution plasmids by qRT-LAMP. (A) The amplification plots of qRT-LAMP of serial 10-fold dilution plasmids. Copies of pCR®2.1-FHMNV plasmids: 5.4 × 107, 5.4 × 106, 5.4 × 105, 5.4 × 104, 5.4 × 103 and 5.4 × 102 (from left to right). (B) Standard curve and standard curve equation for the fathead minnow nidovirus-specific qRT-LAMP assay generated from the amplification plots between the serial 10-fold diluted pCR®2.1-FHMNV plasmid and Ct value.

The amplification plots and standard curve of the serial 10-fold dilution plasmids by qRT-LAMP. (A) The amplification plots of qRT-LAMP of serial 10-fold dilution plasmids. Copies of pCR®2.1-FHMNV plasmids: 5.4 × 107, 5.4 × 106, 5.4 × 105, 5.4 × 104, 5.4 × 103 and 5.4 × 102 (from left to right). (B) Standard curve and standard curve equation for the fathead minnow nidovirus-specific qRT-LAMP assay generated from the amplification plots between the serial 10-fold diluted pCR®2.1-FHMNV plasmid and Ct value.

Discussion

Early detection of FHMNV is important for the effective health management of this emerging infection. The developed single tube, accelerated RT-LAMP combines reverse transcription and amplification in one step, amplifies target nucleic acids efficiently, is both time- and cost-effective, and represents a valuable diagnostic tool for the detection and titration of FHMNV. This is useful for compliance with current regulations within the bait industry requiring timely and accurate health certifications for the transport and use of fish in public waters. As a first step, we optimized the assay conditions to run at 8 mM Mg2+ concentration in the amplification buffer and incubation at 63 °C for 40 min. These conditions are consistent with those found for other single-stranded RNA viruses such as the infectious hematopoietic necrosis virus (Gunimaladevi et al., 2005), the rift valley fever virus (Peyrefitte et al., 2008) and the Crimean Congo hemorrhagic fever virus (Osman et al., 2013). The results of the temperature optimization showed that Bst DNA polymerase effectively amplified the nucleic acid templates at temperatures of 63–66 °C, which is consistent with the classic reports on LAMP (Notomi et al., 2000, Mori et al., 2001, Mori et al., 2006). The effective amplification of FHMNV nucleic acid by RT-LAMP in a wide temperature range should greatly benefit the future application of the method under field conditions. With 16 ng RNA (approximately 106 copies of virus, determined by quantitative RT-LAMP) from EPC cells infected with FHMNV as template, clear positive bands can be observed even when the incubation time is 20 min due to the addition of loop primers, which proved to accelerate the LAMP reaction (Nagamine et al., 2002, Yang et al., 2012) and also showed the advantage of rapid RT-LAMP. The data generated by testing several viruses (the closely related WBV, two other nidoviruses, and other common fish-pathogenic viruses), along with the non-alignment of the FHMNV target sequence with any viral sequences currently available in public databases demonstrate that the RT-LAMP assay developed in this study is specific for FHMNV. We plan to regularly validate and, if needed, further improve the specificity of the assay when novel closely related nidoviruses are discovered. The developed assay is estimated to detect as little as five copies, which is considered very sensitive. These results are in line with previously described LAMP assays developed for a number of viruses, such as the severe acute respiratory syndrome coronavirus (Hong et al., 2004), noroviruses (Yoda et al., 2007, Suzuki et al., 2011), human astrovirus (Wei et al., 2013), and influenza A virus (H7N9, Ge et al., 2013). On the other hand, the analytical sensitivities of the RT-LAMP method and RT-PCR were 1.6 fg and 1.6 pg of RNA extracted from FHMNV-infected EPC cells, respectively. This suggests a 1000-fold higher analytical sensitivity of the RT-LAMP assay than that of the RT-PCR assay. This finding is in agreement with the reports of Chen et al. (2011) for the Scylla serrata reovirus; Arunrut et al. (2011) for the Laem-Singh virus; and Wang et al. (2013) for the hepatitis delta virus genotype I, which reveals that RT-LAMP is more sensitive than the conventional RT-PCR for these viruses. This increased sensitivity makes the RT-LAMP a better choice than the conventional RT-PCR for the detection of FHMNV, particularly when virus titers are very low. A standard curve was constructed using serial 10-fold dilutions of the pCR®2.1-FHMNV plasmid with reference to the Ct value. Based on the standard curve, an equation was calculated using regression analysis comparing the Ct value to the standard copy number. In the range of 107–102 plasmid copies, the correlation coefficient was high (r 2  = 0.9926), which indicates that the qRT-LAMP is appropriate as a quantitation tool. However, when numbers of plasmid decrease to less than 100 copies, the correlation coefficient declines significantly (r 2  = 0.9437, data not shown). Previous reports also demonstrated that it is difficult to determine the exact correlation of virus quantity and Ct value at very low concentrations of template (Suzuki et al., 2011, Wei et al., 2013). In conclusion, we report the development of an RT-LAMP assay for the detection of FHMNV from cell culture and fish tissues. This novel assay has the advantage of being rapid, sensitive, and specific. Moreover, the qRT-LAMP established in this study provides a low-cost quantitation method for FHMNV.
  24 in total

1.  Comparison of real-time reverse-transcription loop-mediated isothermal amplification and real-time reverse-transcription polymerase chain reaction for detection of noroviruses in municipal wastewater.

Authors:  Yoshihiro Suzuki; Shogo Narimatsu; Takashi Furukawa; Akira Iwakiri; Miho Miura; Shogo Yamamoto; Hiroyuki Katayama
Journal:  J Biosci Bioeng       Date:  2011-08-06       Impact factor: 2.894

2.  Rapid and sensitive detection of mud crab Scylla serrata reovirus by a reverse transcription loop-mediated isothermal amplification assay.

Authors:  Jigang Chen; Juan Xiong; Bojing Cui; Jifang Yang; Zhijuan Mao; Wenchen Li; Xiaoxuan Chen; Xiaojuan Zheng
Journal:  J Virol Methods       Date:  2011-09-17       Impact factor: 2.014

3.  A novel method of real-time reverse-transcription loop-mediated isothermal amplification developed for rapid and quantitative detection of human astrovirus.

Authors:  Haiyan Wei; Jing Zeng; Congliang Deng; Chengzhong Zheng; Ximeng Zhang; Dan Ma; Yong Yi
Journal:  J Virol Methods       Date:  2012-12-26       Impact factor: 2.014

4.  A loop mediated isothermal amplification (LAMP) method for detection of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss).

Authors:  I Gunimaladevi; T Kono; S E Lapatra; M Sakai
Journal:  Arch Virol       Date:  2005-01-19       Impact factor: 2.574

5.  Development of a new method for diagnosis of rubella virus infection by reverse transcription-loop-mediated isothermal amplification.

Authors:  Nobuo Mori; Yoshie Motegi; Yasushi Shimamura; Takashi Ezaki; Tomo Natsumeda; Toshihiro Yonekawa; Yoshinori Ota; Tsugunori Notomi; Tetsuo Nakayama
Journal:  J Clin Microbiol       Date:  2006-09       Impact factor: 5.948

6.  Development of a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) system for rapid detection of HDV genotype 1.

Authors:  C Wang; X Shen; J Lu; L Zhang
Journal:  Lett Appl Microbiol       Date:  2013-01-22       Impact factor: 2.858

7.  Development of a reverse transcription loop-mediated isothermal amplification assay for rapid detection of grass carp reovirus.

Authors:  Qing-Li Zhang; Yi Yan; Jin-Yu Shen; Gui-Jie Hao; Cheng-Yin Shi; Qin-Tao Wang; Hong Liu; Jie Huang
Journal:  J Virol Methods       Date:  2012-11-14       Impact factor: 2.014

8.  Mesoniviridae: a proposed new family in the order Nidovirales formed by a single species of mosquito-borne viruses.

Authors:  Chris Lauber; John Ziebuhr; Sandra Junglen; Christian Drosten; Florian Zirkel; Phan Thi Nga; Kouichi Morita; Eric J Snijder; Alexander E Gorbalenya
Journal:  Arch Virol       Date:  2012-04-24       Impact factor: 2.574

9.  An insect nidovirus emerging from a primary tropical rainforest.

Authors:  Florian Zirkel; Andreas Kurth; Phenix-Lan Quan; Thomas Briese; Heinz Ellerbrok; Georg Pauli; Fabian H Leendertz; W Ian Lipkin; John Ziebuhr; Christian Drosten; Sandra Junglen
Journal:  mBio       Date:  2011-06-14       Impact factor: 7.867

10.  Rapid and sensitive detection of novel avian-origin influenza A (H7N9) virus by reverse transcription loop-mediated isothermal amplification combined with a lateral-flow device.

Authors:  Yiyue Ge; Bin Wu; Xian Qi; Kangchen Zhao; Xiling Guo; Yefei Zhu; Yuhua Qi; Zhiyang Shi; Minghao Zhou; Hua Wang; Lunbiao Cui
Journal:  PLoS One       Date:  2013-08-01       Impact factor: 3.240

View more
  1 in total

1.  Retail Baitfish in Michigan Harbor Serious Fish Viral Pathogens.

Authors:  Traimat Boonthai; Thomas P Loch; Qingli Zhang; Michelle Gunn Van Deuren; Mohamed Faisal; Gary E Whelan; Seth J Herbst
Journal:  J Aquat Anim Health       Date:  2018-10-12       Impact factor: 1.625

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.