Literature DB >> 24529074

Fine-tuning of NADH oxidase decreases byproduct accumulation in respiration deficient xylose metabolic Saccharomyces cerevisiae.

Jin Hou, Fan Suo, Chengqiang Wang, Xiaowei Li, Yu Shen, Xiaoming Bao1.   

Abstract

BACKGROUND: Efficiently utilizing all available carbon from lignocellulosic feedstock presents a major barrier to the production of economically feasible biofuel. Previously, to enable xylose utilization, we introduced a cofactor-dependent xylose reductase (XR) and xylitol dehydrogenase (XDH) pathway, or a cofactor-independent xylose isomerase (XI) pathway, into Saccharomyces cerevisiae. The resulting strains metabolized xylose with high efficiency. However, in both pathway recombinant strains, the cofactor imbalance caused accumulation of the byproducts glycerol and/or xylitol and reduced the ethanol production efficiency.
RESULTS: In this study, we introduced NADH oxidase from Lactococcus lactis into both XI and XR-XDH pathway recombinant strains. To reduce byproduct accumulation while maintaining xylose metabolism, we optimized the expression level of NADH oxidase by comparing its expression under the control of different promoters and plasmids. In recombinant XI strains, NADH oxidase was expressed at different levels, regulated by the GPD2 promoter or TEF1 promoter in the 2 μ plasmid. The expression under the control of GPD2 promoter decreased glycerol production by 84% and increased the ethanol yield and specific growth rate by 8% and 12%, respectively. In contrast, in the recombinant XR-XDH strains, such expression level was not efficient enough to decrease the byproduct accumulation. Therefore, higher NADH oxidase expression levels were tested. In the strain expressing NADH oxidase under the control of the TEF1 promoter in the centromeric plasmids, xylitol and glycerol production were reduced by 60% and 83%, respectively, without significantly affecting xylose consumption.
CONCLUSIONS: By fine-tuning NADH oxidase expression, we decreased the glycerol or/and xylitol production in both recombinant XI and XR-XDH xylose-metabolizing yeast strains. The optimal NADH oxidase expression levels depend on metabolic pathways. Similar cofactor engineering strategies could maximize the production of other redox dependent metabolites.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24529074      PMCID: PMC3928090          DOI: 10.1186/1472-6750-14-13

Source DB:  PubMed          Journal:  BMC Biotechnol        ISSN: 1472-6750            Impact factor:   2.563


Background

Efficient utilization of all available carbon from lignocellulosic feedstock presents a major barrier to economical biofuel production [1]. Xylose is the second predominant sugar in lignocellulosic feedstock after glucose. However, Saccharomyces cerevisiae, which is ubiquitously employed in ethanol production, cannot naturally metabolize xylose. Consequently, throughout the past few decades, the introduction of xylose metabolic pathways into S. cerevisiae has been extensively researched [2,3]. Two pathways have been studied widely for D-xylose utilization. In fungi and xylose-metabolic yeasts, D-xylose is reduced to xylitol by NAD(P)H-dependent xylose reductase (XR), encoded by XYL1 and xylitol is then oxidized to D-xylulose by NAD+-dependent xylitol dehydrogenase (XDH), encoded by XYL2[4,5]. The resulting D-xylulose is converted to xylulose-5-phosphate by endogenous xylulose kinase (XK). Alternatively, some bacteria and fungi can directly convert D-xylose to xylulose via the cofactor-independent xylose isomerase (XI) pathway. Both pathways have been successfully introduced into S. cerevisiae, allowing the recombinant strains to produce ethanol from xylose (Figure 1) [6-11]. Xylose metabolism has been improved by over-expressing the endogenous xylulose kinase genes and the genes involved in the non-oxidative pentose phosphate pathway [12,13].
Figure 1

Glucose and xylose metabolic pathways in recombinant . The introduction NADH oxidase can reduce the amount of excess NADH which is normally produced by glycerol 3-phosphate dehydrogenase (GPD) or xylitol dehydrogenase (XDH).

Glucose and xylose metabolic pathways in recombinant . The introduction NADH oxidase can reduce the amount of excess NADH which is normally produced by glycerol 3-phosphate dehydrogenase (GPD) or xylitol dehydrogenase (XDH). Introducing the Scheffersomyces stipitis XR-XDH pathway into S. cerevisiae has enabled the yeast to effectively utilize xylose [4,5,14]. Our previous work also demonstrated efficient xylose uptake by strains expressing this pathway [12,15]. However, the different cofactor dependence of XR and XDH leads to cofactor imbalance and xylitol accumulation. Recent studies have focused on metabolic engineering to balance intracellular cofactor levels or on modifying the cofactor specificities of XR or XDH to establish an oxidation-reduction cycle [16-20]. Several strategies have been implemented for balancing intracellular cofactors in recombinant S. cerevisiae. These include manipulating ammonia assimilation from being NADPH dependent to being NADH dependent by replacing GDH1 (which encodes NADPH-dependent glutamate dehydrogenase) with GDH2 (which encodes NADH-dependent glutamate dehydrogenase), expressing the Kluyveromyces lactis GDP1 gene, which encodes a fungal NADP+-dependent D-glyceraldehyde-3-phosphate dehydrogenase, expressing the gapN gene from Streptococcus mutants, which encodes a non-phosphorylating NADP+-dependent GAPDH, and over-expressing the truncated POS5 gene, which encodes cytosolic NADH kinase [15,19,21,22]. An alternative pathway for xylose catabolism is the isomerase-based pathway. This pathway is cofactor independent, and therefore could lead to higher theoretical ethanol yields. However, only a few xylose isomerase genes have been successfully expressed in S. cerevisiae, derived from organisms such as Piromyces sp.[6,23], Orpinomyces sp.[24], Clostridium phytofermentans[25] and Prevotella ruminicola[26]. Further engineering strategies, such as adaptive evolutionary engineering [8] and over-expressing downstream pathways [7,27], have been implemented to improve xylose consumption and cell growth. Recently, we obtained a new XI (xylA) gene from bovine rumen. The activity of this XI in S. cerevisiae was slightly higher than the XI from Piromyces sp.[28]. We also engineered the host strain to over-express the endogenous xylulose kinase gene (XKS1) and the genes in non-oxidative pentose phosphate pathway, eliminating the respiration by deleting cytochrome C oxidase subunit IV encoding gene COX4, and adaptive evolution [13]. The recombinant strain showed high xylose metabolism capability and high ethanol yield under both aerobic and anaerobic conditions. However, although no xylitol was accumulated, substantial amounts of glycerol were produced as the major byproduct [28]. In industrial ethanol processes, up to 4% of the sugar feedstock is converted into glycerol by S. cerevisiae, which is an unwanted loss of carbon source [29,30]. Glycerol synthesis plays important roles in yeast osmoregulation and in regulating intracellular redox balance [31]. It is produced from dihydroxyacetone phosphate (DHAP) through the catalysis of glycerol-3-phosphate dehydrogenase (GPD, encoded by genes GPD1 and GPD2) and glycerol-3-phosphate phosphatase (GPP, encoded by genes GPP1 and GPP2). Researchers have expended considerable effort in minimizing glycerol formation. One approach is to delete one or both of GPD1 and GPD2 as well as the genes involved in glycerol transport, such as FPS1[32,33]. Because cells lacking the GPD1 and GPD2 genes cannot grow anaerobically, the promoter of GPD1 has been engineered in GPD2 deletion background [34]. Alternative approaches aim at manipulating the redox cofactor metabolism to reduce cytosolic NADH accumulation [35]. For example, Nissen et al. deleted GDH1 (encoding NADPH-dependent glutamate dehydrogenase), while overexpressing GLN1 and GLT1 (encoding glutamine synthetase and glutamate synthase, respectively). Their engineered strains demonstrated reduced glycerol yield and increased ethanol yield [36]. Guo et al. simultaneously deleted GPD1 and introduced the non-phosphorylating NADP+-dependent GAPDH gene gapN into strains overexpressing the trehalose synthesis genes TPS1 and TPS2, thereby obtaining a high ethanol-yielding strain [32]. Zhang et al. combined the expression of NADP+-dependent GAPDH gene gapN with either a NAD+-dependent fumarate reductase gene frdA, or an acetylating NAD+-dependent acetaldehyde dehydrogenase for reoxidizing NADH [37]. Water-forming NADH oxidase can oxidize cytosolic NADH to NAD+, accompanied by a reduction of O2 to H2O, when oxygen is available. Previous studies have demonstrated the capability of NADH oxidase expression to reduce xylitol production during xylose metabolism [20], but in this approach, aerobic cultivation combined with oxygen-limited fermentation has to be performed to supply oxygen for NADH oxidase, which results in low ethanol production. However, if the ethanol yield is enhanced by purely anaerobic cultivation, the NADH oxidase reaction is deprived of its required oxygen. In our previous work, we demonstrated that respiration-deficient xylose-metabolizing strains can efficiently produce ethanol from xylose and glucose under both aerobic and anaerobic conditions [12]. Therefore, in the present study, we expressed water-forming NADH oxidase derived from Lactococcus lactis in our respiration-deficient xylose-metabolizing strains (Figure 1). The fermentation process is aerobically controlled to supply oxygen for NADH oxidase without compromising ethanol production. The impact on byproduct accumulation and ethanol production was studied in both recombinant XI strains and recombinant XR-XDH strains. To decrease the byproduct accumulation without affecting yeast growth and sugar metabolism, different NADH oxidase expression levels were compared by expressing the noxE gene controlled by different promoters in the 2 μ or centromeric plasmids under glucose and xylose co-cultivation conditions.

Results

NADH oxidase expression decreases glycerol production in recombinant XI strains

As mentioned previously, glycerol is the main byproduct of xylose metabolism in recombinant XI strains [7]. We therefore aimed to suppress glycerol production by expressing the NADH oxidase gene. Two different NADH oxidase expression levels were selected under the control of either the TEF1 or GPD2 promoter in the 2 μ plasmid. The relative transcription of noxE in XITN was about 13 fold higher than that in XIGN (Figure 2A). The specific enzyme activities of NADH oxidase in XITN and XIGN were 1.85 and 0.08 U mg-1 protein, respectively (Table 1). As a consequence of NADH oxidase expression, the intracellular NADH/NAD+ ratio decreased by 67% and 23% in XITN and XIGN, respectively, relative to XICO (Figure 2B).
Figure 2

The evaluation of the transcription and expression of gene in the recombinant strains. Relative transcription of noxE gene (A) and intracellular concentrations of NADH/NAD+ ratio (B) in the recombinant strains. Measurements are the average value ± standard error from independent duplicate experiments.

Table 1

NADH oxidase activities in recombinant strains of

StrainDescriptionNADH oxidase activity (U mg -1 total protein)
XICO
XI, pYX242-WS
0
XIGN
XI, pYX242-GPD2nox
0.08 ± 0.01
XITN
XI, pYX242-TEF1nox
1.85 ± 0.06
XRCO
XR-XDH, pYX242-WS
0
XRGN
XR-XDH, pYX242-GPD2nox
0.05 ± 0.00
XRTN2
XR-XDH, pRS315-TEF1nox
0.17 ± 0.00
XRHN
XR-XDH, pYX242-HXK2nox
0.57 ± 0.03
XRTNXR-XDH, pYX242-TEF1nox1.92 ± 0.12
The evaluation of the transcription and expression of gene in the recombinant strains. Relative transcription of noxE gene (A) and intracellular concentrations of NADH/NAD+ ratio (B) in the recombinant strains. Measurements are the average value ± standard error from independent duplicate experiments. NADH oxidase activities in recombinant strains of We then studied the impact of NADH oxidase expression on glucose and xylose co-cultivations. As shown in Figure 3 and Table 2, expressing NADH oxidase under the strong constitutive TEF1 promoter in the 2 μ plasmid completely suppressed glycerol production, but also significantly reduced glucose and xylose metabolism, and decreased the ethanol yield by about 17% (relative to the control strain). This may be because the strong NADH oxidase expression in XITN depleted the pool of NADH (Figure 2B). When NADH oxidase was regulated by the GPD2 promoter in the 2 μ plasmid, the glycerol yield reduced by 84% in XIGN, while the ethanol yield and specific growth rate increased by 8% and 12%, respectively (Figure 3B and Table 2). The biomass yield also increased slightly, without significantly affecting the xylose consumption. These results show that expressing NADH oxidase under the control of the GPD2 promoter in recombinant XI strains can effectively reduce glycerol production and increase the ethanol yield.
Figure 3

Aerobic batch cultivations of recombinant XI strains with a mixture of 20 g/L glucose and 20 g/L xylose. The experiments were performed in duplicate. (A), XICO; (B), XIGN; and (C), XITN. Symbols: ◆, glucose; ■, xylose; ●, ethanol; ▲, glycerol; ×, biomass. Measurements are the average value ± standard error from independent duplicate cultivations.

Table 2

Physiological parameters of recombinant strains from batch cultivations on glucose and xylose

Strain
μ max (h -1 ) a
Consumed xylose in 72 h (g L -1 )Sugar consumption rate (g L -1 h -1 ) b
Yield on sugars (g g -1 ) c
Carbon balance
  GlucoseXyloseBiomassEthanolGlycerol 
XICO
0.17
20.14
1.34
0.48
0.10
0.35
0.084
0.92
XIGN
0.19
18.81
1.33
0.46
0.12
0.38
0.021
0.97
XITN0.164.500.730.140.100.290.0030.90

Average values from independent duplicate cultivations. In all cases, the standard error is less than 3%.

aMaximum specific growth rate (h-1).

bSpecific volumetric rate of glucose or xylose (g L-1 h-1).

cBiomass, ethanol or glycerol yield on consumed sugars (g g-1 sugar).

Aerobic batch cultivations of recombinant XI strains with a mixture of 20 g/L glucose and 20 g/L xylose. The experiments were performed in duplicate. (A), XICO; (B), XIGN; and (C), XITN. Symbols: ◆, glucose; ■, xylose; ●, ethanol; ▲, glycerol; ×, biomass. Measurements are the average value ± standard error from independent duplicate cultivations. Physiological parameters of recombinant strains from batch cultivations on glucose and xylose Average values from independent duplicate cultivations. In all cases, the standard error is less than 3%. aMaximum specific growth rate (h-1). bSpecific volumetric rate of glucose or xylose (g L-1 h-1). cBiomass, ethanol or glycerol yield on consumed sugars (g g-1 sugar).

NADH oxidase expression decreases xylitol and glycerol accumulation in recombinant XR-XDH strains

We also investigated the effect of NADH oxidase expression in recombinant XR-XDH strains (Figure 3 and Table 3). Controlling NADH oxidase expression under the GPD2 promoter was much less effective than in the recombinant XI strains; the glycerol and xylitol yields were reduced by only 50% and 15%, respectively (Figure 4B and Table 3). This suggested that the NADH oxidation level in XRGN was not sufficiently high to suppress byproduct accumulation. However, increased expression under the TEF1 promoter led to a large reduction of ethanol yield and inhibited glucose or xylose consumption, indicating that NADH oxidation level in XRTN were prohibitively high (Figure 4E and Table 3). Therefore, we introduced two medium levels of noxE expression, under the control of the HXK2 promoter in the 2 μ plasmid (strain XRHN) and the TEF1 promoter in the centromeric plasmid (strain XRTN2). The transcription levels of the noxE gene and the specific enzyme activities of NADH oxidase were then compared. The relative transcriptions of noxE in XITN and XRHN were about 7 fold and 1 fold higher than in XRTN2, respectively, while the relative transcription of noxE in XIGN was slightly lower than in XRTN2 (Figure 2A). The specific enzyme activities of NADH oxidase in XRTN, XRHN, XRTN2 and XIGN were 1.92, 0.57, 0.17 and 0.05 U mg-1 protein respectively (Table 1). Relative to XRCO, the intracellular NADH/NAD+ ratio decreased by 66%, 39%, 33% and 21% in XRTN, XRHN, XRTN2 and XRGN, respectively, when NADH oxidase was expressed (Figure 2B).
Table 3

Physiological parameters of recombinant strains from batch cultivations on glucose and xylose

Strain
μ max (h -1 ) a
Consumed xylose in 78 h (g L -1 )
Sugar consumption rate (g L -1 h -1 ) b
Yield on sugars (g g -1 ) c
Xylitol yield (g g -1 ) d
Carbon balance
   GlucoseXyloseBiomassEthanolGlycerol  
XRCO
0.17
18.53
1.37
0.37
0.085
0.35
0.121
0.53
0.90
XRGN
0.18
18.47
1.39
0.37
0.094
0.37
0.035
0.45
0.86
XRTN2
0.16
13.79
1.20
0.29
0.080
0.36
0.023
0.21
0.82
XRHN
0.17
10.69
1.18
0.24
0.098
0.35
0
0.03
0.91
XRTN0.153.310.980.080.0940.29000.84

Shown are the average values from independent duplicate cultivations. In all cases, the standard error is less than 3%.

a Maximum specific growth rate (h-1).

b Specific volumetric rate of glucose or xylose (g L-1 h-1).

c Biomass, ethanol or glycerol yield from consumed sugars (g g-1 sugar).

d Xylitol yield on xylose (g g-1 xylose).

Figure 4

Aerobic batch cultivations of recombinant XR-XDH strains with a mixture of 20 g/L glucose and 20 g/L xylose. The experiments were performed in duplicate. (A), XRCO; (B), XRGN; (C), XRTN2; (D), XRHN; and (E), XRTN. Symbols: ◆, glucose; ■, xylose; ●, ethanol; ▲, glycerol; ×, xylitol. Measurements are the average value ± standard error from independent duplicate cultivations.

Physiological parameters of recombinant strains from batch cultivations on glucose and xylose Shown are the average values from independent duplicate cultivations. In all cases, the standard error is less than 3%. a Maximum specific growth rate (h-1). b Specific volumetric rate of glucose or xylose (g L-1 h-1). c Biomass, ethanol or glycerol yield from consumed sugars (g g-1 sugar). d Xylitol yield on xylose (g g-1 xylose). Aerobic batch cultivations of recombinant XR-XDH strains with a mixture of 20 g/L glucose and 20 g/L xylose. The experiments were performed in duplicate. (A), XRCO; (B), XRGN; (C), XRTN2; (D), XRHN; and (E), XRTN. Symbols: ◆, glucose; ■, xylose; ●, ethanol; ▲, glycerol; ×, xylitol. Measurements are the average value ± standard error from independent duplicate cultivations. As shown in Figure 4, although glycerol and xylitol accumulation was completely prevented in XRHN, the specific xylose consumption rate was 35% lower than in the control strain XRCO (Figure 4D and Table 3). However, in strain XRTN2, the glycerol yield and xylitol accumulation were reduced by 83% and 60% respectively, but the specific xylose consumption rate was 21% lower than in XRCO (Figure 4C and Table 3). Relative to the control strain, byproduct formation was reduced in strain XRTN2 without significantly affecting xylose metabolism. However, none of the recombinant strains improved the ethanol yield relative to XRCO. This indicates that, although NADH oxidase decreased glycerol and xylitol production in recombinant XR-XDH strains, it did not increase the ethanol production in recombinant XR-XDH pathway strains.

Discussion

In the presence of oxygen, water-forming NADH oxidase can oxidize cytosolic NADH to NAD+, with simultaneous reduction of O2 to H2O. Although NADH oxidase expression is known to reduce xylitol production during xylose metabolism, it requires aerobic cultivation combined with oxygen-limited fermentation; otherwise the enzyme cannot function [20]. However, aerobic cultivation reduces ethanol production. Our respiratory-deficient strain can efficiently generate ethanol from aerobic glucose and xylose cultivations. As such, it provides a solid platform for NADH oxidase expression [12]. During the catabolism of glucose or xylose through the XI pathway, S. cerevisiae yields a surplus of cytosolic NADH, mainly through biosynthesis of proteins, nucleic acids and lipids [38,39]. Although cytosolic NADH is required for converting acetaldehyde to ethanol, ethanol production is a redox-neutral process, hence does not contribute to surplus NADH oxidation. The additional NADH generated from catabolism is oxidized via the mitochondrial electron transport chain and glycerol production. In the recombinant XR-XDH strains, the cofactor imbalance between XR and XDH and the increase in cytosolic NADH generated by XDH lead to xylitol accumulation and low ethanol conversion. The difference in cytosolic NADH accumulation between these two situations alters the requirement for NADH oxidase. Indeed, we observed that the recombinant XR-XDH strains required higher NADH oxidase expression than the recombinant XI strain to eliminate glycerol and xylitol. Glycerol production is consequent to accumulation of excess NADH in the cytosol [40]. The glycerol formation reaction is mediated by glycerol 3-phosphate dehydrogenase (encoded by genes GPD1 and GPD2). Gpd1p is involved in osmosensing and regulation, while Gpd2p is responsible for reoxidation of excess cytosolic NADH [41]. When NADH oxidase is expressed under the control of the GPD2 promoter, the enzyme competes to oxidize excess NADH that is normally reoxidized by glycerol 3-phosphate dehydrogenase during glycerol production. Therefore, NADH oxidase could be fine-tuned in strain XIGN to eliminate glycerol production without draining the NADH pool. Conversely, when NADH oxidase was expressed under the control of the GPD2 promoter in the recombinant XR-XDH strains, the excess cytosolic NADH production reduced the effect of the enzyme. Consequently, the expressed NADH oxidase was insufficient to eliminate both xylitol and glycerol, and higher expression was necessary. Although xylitol and glycerol production was completely inhibited in the XRHN (in which NADH oxidase expression is controlled by the HXK2 promoter on the 2 μ plasmid), xylose consumption by this strain was decreased by 35% relative to the control strain. XRTN2 (in which NADH oxidase expression is controlled by the TEF1 promoter on the centromeric plasmid) demonstrated lower NADH oxidase activity than XRHN, and yielded low xylitol and glycerol levels without significantly compromising xylose consumption. However, xylose metabolism was decreased by 21% in this strain and some xylitol accumulation was observed. This indicates that NADH oxidase expression in XRTN2 was insufficient to eliminate byproducts, but was sufficiently high to affect substrate metabolism. Comparing the optimal modified strains in both pathways, the recombinant XI strain XIGN accumulated little byproduct, and demonstrated a higher xylose consumption rate and ethanol yield than the recombinant XR-XDH strain XRTN2. Therefore, the performance of the recombinant XI strain surpassed that of the recombinant XR-XDH strain. Additionally, our recombinant rumen XI strains XIGN performed similarly to an S. cerevisiae strain expressing Piromyces sp. xylA[8,11,13] in terms of ethanol production, but accumulated considerably less glycerol. Consequently, the recombinant XI strain emerges as a preferable choice for lignocellulosic feedstock utilization.

Conclusion

In this study, we investigated the impact of NADH oxidase on two xylose metabolism pathways: the cofactor independent XI pathway and the cofactor dependent XR and XDH pathway. According to our results, NADH oxidase expression decreases glycerol and xylitol accumulation in respiration-deficient xylose-metabolizing S. cerevisiae. By controlling the promoter strength of noxE gene and the plasmid copy number, we obtained an efficient xylose-metabolizing strain that accumulated little byproduct. Such fine-tuned cofactor engineering is an attractive strategy for bioprocessing, and is applicable to production of other redox dependent metabolites.

Methods

Plasmids and strains construction

The primers used in this study are listed in Table 4. The noxE gene (GenBank Accession no. 4796799) was amplified from the genomic DNA of Lactococcus lactis subsp. MG1363. A 2 μ plasmid pYX242-WS (constructed from pYX242 by inserting the TEF1 promoter in front of the polyA terminator) and a centromeric plasmid pRS315 were used for noxE gene expression. Ligation was performed using T4 DNA ligase or a one-step enzymatic DNA assembly protocol [42]. The noxE gene was constructed under the control of TEF1, GPD2 or HXK2 promoters and polyA terminator in pYX242-WS [42], or the TEF1 promoter and polyA terminator in pRS315 (Table 5). The genetic reference strain was BSPX042 (ura3-52, XKS1::loxP-TEF1p, gre3(-241,+338)::TPI1p-RKI1-RKI1t-PGK1p-TAL1-TAL1t-FBA1p-TKL1-TKL1t-ADH1p-RPE1-RPE1t-loxP, cox4::loxP, adaptive evolution) as described in our previous work [28] (Table 5). The recombinant yeast strains and plasmids used in this study are listed in Table 5. The leucine auxotrophic strain, obtained by deleting the LEU2 gene in BSPX042, was named BSLS000. The recombinant XR-XDH and XI strains were constructed by transforming the pJX1 (XYL1 and XYL2 genes from S. stipitis) and pJX7 (xylA gene from bovine rumen, GenBank Accession no. JF496707) plasmids, respectively, into BSLS000. The empty plasmid pYX242-WS or plasmids containing the noxE gene was then transformed into the recombinant XR-XDH or XI strains, to construct XICO (XI, pYX242-WS), XITN (XI, pYX242-TEF1nox), XIGN (XI, pYX242-GPD2nox), XRCO (XR-XDH, pYX242-WS), XRTN (XR-XDH, pYX242- TEF1nox), XRGN (XR-XDH, pYX242-GPD2nox), XRHN (XR-XDH, pYX242-HXK2nox) and XRTN2 (XR-XDH, pRS315-TEF1nox) (Table 5).
Table 4

Primers used in this study

Primer nameSequence (5′ → 3′)TemplatePurpose
Leu2 up
ATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACAGCTGAAGCTTCGTACGCTG
pUG6
LEU2 gene deletion
Leu2 down
CACCAGTTCTGATACCTGCATCCAAAACCTTTTTAACTGATAGGCCACTAGTGGATCTG
pUG6
LEU2 gene deletion
TEF1W up
CCCAAGCTTCACAATGCATACTTTGTACGTTa
BSPX042 chromosome
pYX242-WS
TEF1W down
GCGCGTCGACTTGTAATTAAAACTTAGATTAGb
BSPX042 chromosome
pYX242-WS
noxE up
ACGCGTCGACATGAAAATCGTAc
L. lactis chromosome
pYX242- TEF1nox
noxE down
GTCCGAGCTCTTATTTGGCATTCd
L. lactis chromosome
pYX242- TEF1nox
GPD2p up
TTTAATAACTCGAAAATTCTGCGTTCGTTAAAGCTTCGACATATCTATTATAGTGGGGAGA
BSPX042 chromosome
pYX242- GPD2nox
GPD2p down
GCCTGCGTGGTTTGTACCGATAACTACGATTTTCATGTCGACACGACTAGTGACAGCAAGCATT
BSPX042 chromosome
pYX242- GPD2nox
HXK2p up
TAAGTTTAATAACTCGAAAATTCTGCGTTCGTTAAAGCTTTTGAAAAAAAGTGCGGGGC
BSPX042 chromosome
pYX242-HXK2nox
HXK2p down
CTGCGTGGTTTGTACCGATAACTACGATTTTCATGTCGACTTTATTTAATTAGCGTACT
BSPX042 chromosome
pYX242-HXK2nox
TEF1p up
TGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCACAATGCATACTTT
BSPX042 chromosome
pRS315-TEF1nox
TEF1p down
GGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTAGCCGGCGAACGTGGC
BSPX042 chromosome
pRS315-TEF1nox
ACT1qPCR up
CAAACCGCTGCTCAATCTTC
cDNA
qPCR
ACT1qPCR down
AGTTTGGTCAATACCGGCAG
cDNA
qPCR
NOXqPCR up
TACTGCCAACAGTGCCTTGG
cDNA
qPCR
NOXqPCR downTTCCTGACCGAACAGCGTTTcDNAqPCR

aunderline: Hind III restriction site used for ligation.

bunderline: SalI restriction site used for ligation.

cunderline: SalI restriction site used for ligation.

dunderline: SacI restriction site used for ligation.

Table 5

Plasmids and strains used in this study

Strain/plasmidGenotype/propertiesSource of reference
S. cerevisiae
 
 
CEN.PK113-5D
MATa SUC2 MAL8C ura3-52
Peter Kötter
BSPX042
CEN.PK113-5D, XKS1::loxP-TEF1p, gre3(-241, +338) ::TPI1p-RKI1-RKI1t-PGK1p-TAL1-TAL1t-FBA1p-TKL1-TKL1t-ADH1p-RPE1-RPE1t-loxP, cox4::loxP, adaptive evolution, ura3-52
[28]
BSLS000
BSPX042, leu2::loxp-KanMX-loxp
This study
XICO
BSLS000, pJX7&pYX242-WS
This study
XITN
BSLS000, pJX7&pYX242-TEF1nox
This study
XIGN
BSLS000, pJX7&pYX242-GPD2nox
This study
XRCO
BSLS000, pJX1&pYX242-WS
This study
XRTN
BSLS000, pJX1&pYX242-TEF1nox
This study
XRGN
BSLS000, pJX1&pYX242-GPD2nox
This study
XRHN
BSLS000, pJX1&pYX242-HXK2nox
This study
XRTN2
BSLS000, pJX1&pRS315-TEF1nox
This study
Plasmids
 
 
pYX242-WS
2 μ plasmid with TEF1 promoter and Poly A terminator, LEU2 marker
This study
pRS315
Centromeric plasmid with LEU2 marker
ATCC77144
pYX242-TEF1nox
pYX242-WS, noxE gene with TEF1 promoter, LEU2
This study
pYX242-GPD2nox
pYX242-WS, noxE gene with GPD2 promoter, LEU2
This study
pYX242-HXK2nox
pYX242-WS, noxE gene with HXK2 promoter, LEU2
This study
pRS315-TEF1nox
pRS315, noxE gene with TEF1 promoter, LEU2
This study
pJX1
YCplac33, XYL1 with TEF1 promoter, XYL2 with TDH3 promoter
[12]
pJX7YEplac195, 2 μ, Ru-xylA with TEF1 promoter, URA3[28]
Primers used in this study aunderline: Hind III restriction site used for ligation. bunderline: SalI restriction site used for ligation. cunderline: SalI restriction site used for ligation. dunderline: SacI restriction site used for ligation. Plasmids and strains used in this study

Growth conditions

E. coli recombinant cells were grown in Luria-Bertani medium (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl, pH 7.0) in the presence of ampicillin (100 mg/L) at 37°C. Recombinant strains of S. cerevisiae were cultured in SD medium (1.7 g/L yeast nitrogen base, 5 g/L (NH4)2SO4) with amino acid lacking uracil and/or leucine and 20 g/L glucose at 30°C, with rotation at 200 rpm.

Batch cultivations

Preculture was prepared by inoculating the strains in 400 mL SD medium containing 20 g/L glucose in 1 L shake flasks. The batch cultivations were carried out in 1.4 L fermenters (Infors AG, Switzerland) with a working volume of 1 L and controlled at 30°C, 600 rpm and 0.1 vvm. The pH was maintained at 5.0 by automatic addition of 1 M H3PO4 or 1 M NaOH. The quantity of CO2 and O2 in the exhaust gases was measured with a gas analyzer. All cultivations were carried out in defined medium containing 5 g/L (NH4)2SO4, 1.7 g/L yeast nitrogen base, 20 g/L glucose and 20 g/L xylose. The initial OD600 was adjusted to 1. All cultivations were performed in duplicate.

Extracellular metabolite analysis

Samples from the fermenters were centrifuged and filtered through a 0.45 μm pore size syringe filter and frozen at -20°C for subsequent analysis. Concentrations of glucose, xylose, xylitol, glycerol, ethanol and acetic acid were analyzed by HPLC. The separation column was an Aminex HPX-87H ion exchange column (Bio-Rad, Hercules, USA) operating at 45°C with mobile phase 5 mM H2SO4 at a flow rate of 0.6 mL/min. The peaks were detected by RI and UV detectors.

Cell mass determination

The optical density of the culture at 600 nm was measured in a spectrophotometer (Eppendorf AG, 22331 Hamburg, Germany). The dry cell weight (DCW) was measured by filtering a known volume of the culture through a pre-dried and pre-weighed nitrocellulose filter (pore size 0.45 μm). The filters were dried at 105°C until their weight had stabilized, and re-weighed. The dry cell weight was the weight difference between the filter membrane with dried cells and the membrane without cells. The dry cell weight was estimated from the measured OD600-dry weight correlation, where 1 g/L biomass equals 0.246× (OD600) - 0.0012.

NADH oxidase activity measurement

Samples were harvested during the mid-exponential phase of the cultivation and centrifuged immediately (4,000 g at 1°C for 5 min). Cell-free extracts were prepared using a Fast Prep cell homogenizer. NADH oxidase activity was assayed spectrophotometrically in 50 mM potassium phosphate buffer (pH 7.0), 0.3 mM β-NADH and 0.3 mM EDTA at 340 nm, as previously described [43]. Protein concentrations were measured following the Bradford method. One unit (U) of enzyme activity was defined as the oxidation of 1.0 μmol NADH per min.

NAD+ and NADH quantification

Samples were taken and quenched in 30 mL pure methanol in pre-weighed tubes maintained at -40°C. The cells were then collected by centrifugation at -20°C at 12000 g for 5 minutes. Next, 1 ml of 17% (v/v) alcoholic 1 M KOH (for NADH extraction) or 1 ml 35% (v/v) HClO4 (for NAD+ extraction) was added to the cell pellet. The extracts were frozen by liquid nitrogen, thawed and then neutralized by adding 2 M HCl (for NADH extraction) or 2 M KOH (for NAD+ extraction). The cellular debris was removed by centrifuging at 12,000 g for 5 min. Supernatants were transferred to new tubes and stored at -80°C. Intracellular NAD(H) concentrations were determined by HPLC as previously described [44].

Real-time quantitative PCR (qPCR)

Total RNA was isolated using UNIQ-10 spin column RNA extraction kits (Sangon Biological Engineering, China). The first cDNA strand was synthesized using the PrimeScript™ RT Reagent Kit (TaKaRa, Japan) and was used for qPCR amplification in the Light Cycle PCR System (SYBR Green Real-time PCR Master Mix, Japan). The reference gene was ACT1. The gene-specific primers are listed in Table 4.

Abbreviations

XI: Xylose isomerase; XR: Xylose reductase; XDH: Xylitol dehydrogenase; NADH: Reduced form of nicotinamide adenine dinucleotide; DHAP: Dihydroxyacetone phosphate; GPD: Glycerol-3-phosphate dehydrogenase; GPP: Glycerol-3-phosphate phosphatase; EDTA: Ethylenediaminetetraacetic acid.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JH designed the study, performed the data analysis and wrote the manuscript. SF performed the experiments and edited the manuscript. WC and LX performed some experiments. YS participated in design and drafted the manuscript. BX participated in the design and coordination and drafted the manuscript. All authors read and approved the final manuscript.
  43 in total

1.  Expression of different levels of enzymes from the Pichia stipitis XYL1 and XYL2 genes in Saccharomyces cerevisiae and its effects on product formation during xylose utilisation.

Authors:  M Walfridsson; M Anderlund; X Bao; B Hahn-Hägerdal
Journal:  Appl Microbiol Biotechnol       Date:  1997-08       Impact factor: 4.813

2.  Comparative metabolic network analysis of two xylose fermenting recombinant Saccharomyces cerevisiae strains.

Authors:  Thomas Grotkjaer; Paul Christakopoulos; Jens Nielsen; Lisbeth Olsson
Journal:  Metab Eng       Date:  2005-09-01       Impact factor: 9.783

3.  Minimization of glycerol synthesis in industrial ethanol yeast without influencing its fermentation performance.

Authors:  Zhong-peng Guo; Liang Zhang; Zhong-yang Ding; Gui-yang Shi
Journal:  Metab Eng       Date:  2010-11-30       Impact factor: 9.783

4.  Evolutionary engineering of mixed-sugar utilization by a xylose-fermenting Saccharomyces cerevisiae strain.

Authors:  Marko Kuyper; Maurice J Toirkens; Jasper A Diderich; Aaron A Winkler; Johannes P van Dijken; Jack T Pronk
Journal:  FEMS Yeast Res       Date:  2005-07       Impact factor: 2.796

Review 5.  Towards industrial pentose-fermenting yeast strains.

Authors:  Bärbel Hahn-Hägerdal; Kaisa Karhumaa; César Fonseca; Isabel Spencer-Martins; Marie F Gorwa-Grauslund
Journal:  Appl Microbiol Biotechnol       Date:  2007-02-09       Impact factor: 4.813

6.  High-level functional expression of a fungal xylose isomerase: the key to efficient ethanolic fermentation of xylose by Saccharomyces cerevisiae?

Authors:  Marko Kuyper; Harry R Harhangi; Ann Kristin Stave; Aaron A Winkler; Mike S M Jetten; Wim T A M de Laat; Jan J J den Ridder; Huub J M Op den Camp; Johannes P van Dijken; Jack T Pronk
Journal:  FEMS Yeast Res       Date:  2003-10       Impact factor: 2.796

7.  Xylose isomerase overexpression along with engineering of the pentose phosphate pathway and evolutionary engineering enable rapid xylose utilization and ethanol production by Saccharomyces cerevisiae.

Authors:  Hang Zhou; Jing-Sheng Cheng; Benjamin L Wang; Gerald R Fink; Gregory Stephanopoulos
Journal:  Metab Eng       Date:  2012-08-16       Impact factor: 9.783

8.  Effect of the reversal of coenzyme specificity by expression of mutated Pichia stipitis xylitol dehydrogenase in recombinant Saccharomyces cerevisiae.

Authors:  J Hou; Y Shen; X P Li; X M Bao
Journal:  Lett Appl Microbiol       Date:  2007-08       Impact factor: 2.858

9.  Engineering redox cofactor regeneration for improved pentose fermentation in Saccharomyces cerevisiae.

Authors:  Ritva Verho; John Londesborough; Merja Penttilä; Peter Richard
Journal:  Appl Environ Microbiol       Date:  2003-10       Impact factor: 4.792

10.  The metabolic costs of improving ethanol yield by reducing glycerol formation capacity under anaerobic conditions in Saccharomyces cerevisiae.

Authors:  Julien Pagliardini; Georg Hubmann; Sandrine Alfenore; Elke Nevoigt; Carine Bideaux; Stephane E Guillouet
Journal:  Microb Cell Fact       Date:  2013-03-28       Impact factor: 5.328

View more
  10 in total

1.  Enhanced xylose fermentation by engineered yeast expressing NADH oxidase through high cell density inoculums.

Authors:  Guo-Chang Zhang; Timothy L Turner; Yong-Su Jin
Journal:  J Ind Microbiol Biotechnol       Date:  2017-01-09       Impact factor: 3.346

Review 2.  Redox cofactor engineering in industrial microorganisms: strategies, recent applications and future directions.

Authors:  Jiaheng Liu; Huiling Li; Guangrong Zhao; Qinggele Caiyin; Jianjun Qiao
Journal:  J Ind Microbiol Biotechnol       Date:  2018-03-27       Impact factor: 3.346

3.  Dynamic control of ERG20 expression combined with minimized endogenous downstream metabolism contributes to the improvement of geraniol production in Saccharomyces cerevisiae.

Authors:  Jianzhi Zhao; Chen Li; Yan Zhang; Yu Shen; Jin Hou; Xiaoming Bao
Journal:  Microb Cell Fact       Date:  2017-01-31       Impact factor: 5.328

Review 4.  Engineering redox homeostasis to develop efficient alcohol-producing microbial cell factories.

Authors:  Chunhua Zhao; Qiuwei Zhao; Yin Li; Yanping Zhang
Journal:  Microb Cell Fact       Date:  2017-06-24       Impact factor: 5.328

5.  Promiscuous activities of heterologous enzymes lead to unintended metabolic rerouting in Saccharomyces cerevisiae engineered to assimilate various sugars from renewable biomass.

Authors:  Eun Ju Yun; Eun Joong Oh; Jing-Jing Liu; Sora Yu; Dong Hyun Kim; Suryang Kwak; Kyoung Heon Kim; Yong-Su Jin
Journal:  Biotechnol Biofuels       Date:  2018-05-14       Impact factor: 6.040

Review 6.  Enhancing the Co-utilization of Biomass-Derived Mixed Sugars by Yeasts.

Authors:  Meirong Gao; Deon Ploessl; Zengyi Shao
Journal:  Front Microbiol       Date:  2019-01-22       Impact factor: 5.640

7.  Overexpression of a Water-Forming NADH Oxidase Improves the Metabolism and Stress Tolerance of Saccharomyces cerevisiae in Aerobic Fermentation.

Authors:  Xinchi Shi; Yanan Zou; Yong Chen; Cheng Zheng; Hanjie Ying
Journal:  Front Microbiol       Date:  2016-09-13       Impact factor: 5.640

8.  Efficient conversion of xylose to ethanol by stress-tolerant Kluyveromyces marxianus BUNL-21.

Authors:  Sukanya Nitiyon; Chansom Keo-Oudone; Masayuki Murata; Noppon Lertwattanasakul; Savitree Limtong; Tomoyuki Kosaka; Mamoru Yamada
Journal:  Springerplus       Date:  2016-02-27

9.  Engineering a wild-type diploid Saccharomyces cerevisiae strain for second-generation bioethanol production.

Authors:  Hongxing Li; Yu Shen; Meiling Wu; Jin Hou; Chunlei Jiao; Zailu Li; Xinli Liu; Xiaoming Bao
Journal:  Bioresour Bioprocess       Date:  2016-11-24

Review 10.  Engineering of Pentose Transport in Saccharomyces cerevisiae for Biotechnological Applications.

Authors:  Jeroen G Nijland; Arnold J M Driessen
Journal:  Front Bioeng Biotechnol       Date:  2020-01-29
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.