Glycosylation plays an important role in epithelial cancers, including pancreatic ductal adenocarcinoma. However, little is known about the glycoproteome of the human pancreas or its alterations associated with pancreatic tumorigenesis. Using quantitative glycoproteomics approach, we investigated protein N-glycosylation in pancreatic tumor tissue in comparison with normal pancreas and chronic pancreatitis tissue. The study lead to the discovery of a roster of glycoproteins with aberrant N-glycosylation level associated with pancreatic cancer, including mucin-5AC (MUC5AC), carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), insulin-like growth factor binding protein (IGFBP3), and galectin-3-binding protein (LGALS3BP). Pathway analysis of cancer-associated aberrant glycoproteins revealed an emerging phenomenon that increased activity of N-glycosylation was implicated in several pancreatic cancer pathways, including TGF-β, TNF, NF-kappa-B, and TFEB-related lysosomal changes. In addition, the study provided evidence that specific N-glycosylation sites within certain individual proteins can have significantly altered glycosylation occupancy in pancreatic cancer, reflecting the complexity of the molecular mechanisms underlying cancer-associated glycosylation events.
Glycosylation plays an important role in epithelial cancers, including pancreatic ductal adenocarcinoma. However, little is known about the glycoproteome of the humanpancreas or its alterations associated with pancreatic tumorigenesis. Using quantitative glycoproteomics approach, we investigated protein N-glycosylation in pancreatic tumor tissue in comparison with normal pancreas and chronic pancreatitis tissue. The study lead to the discovery of a roster of glycoproteins with aberrant N-glycosylation level associated with pancreatic cancer, including mucin-5AC (MUC5AC), carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), insulin-like growth factor binding protein (IGFBP3), and galectin-3-binding protein (LGALS3BP). Pathway analysis of cancer-associated aberrant glycoproteins revealed an emerging phenomenon that increased activity of N-glycosylation was implicated in several pancreatic cancer pathways, including TGF-β, TNF, NF-kappa-B, and TFEB-related lysosomal changes. In addition, the study provided evidence that specific N-glycosylation sites within certain individual proteins can have significantly altered glycosylation occupancy in pancreatic cancer, reflecting the complexity of the molecular mechanisms underlying cancer-associated glycosylation events.
Pancreatic cancer is
a highly lethal disease that is difficult
to detect in an early stage.[1] While surgical
resection offers the only chance for improved survival for the ∼20%
of pancreatic cancerpatients with resectable disease, there is a
lack of effective treatment options for the majority of patients who
are diagnosed in a late stage with locally advanced tumor or metastatic
disease.[2,3] One approach for developing better diagnostic
and therapeutic strategies involves targeting cancer-associated aberrant
glycosylation. As one of the most common protein post-translational
modifications (PTMs), the glycoproteome of the humanpancreas and
its mechanistic roles in the pathogenesis of pancreatic cancer have
not yet been fully elucidated. In fact, limited information is available
describing the glycoproteome in normal pancreas and even less in pancreaticcancer. Protein glycosylation plays a crucial role in many biological
functions, including immune response and cellular regulation.[4,5] The glycosylation form and density of glycans on specific glycosylation
sites within a protein can be significantly altered due to changes
in cellular physiology resulting from disease, such as malignancy.
For many epithelial cancers, including pancreatic ductal adenocarcinoma
(PDAC), aberrant glycosylation has long been recognized as a molecular
feature of malignant transformation.[6−9] CA19-9, which detects the epitope of sialyl
Lewis(a) on mucins and other adhesive molecules, is currently the
best known clinical blood biomarker for pancreatic cancer.[10] Tumor-specific glycoproteins, such as the well-studied
mucins (MUCs) and carcinoembryonic antigen-related cell adhesion molecules
(CEACAMs),[11−15] are actively involved in neoplastic progression and metastasis of
pancreatic cancer.The efficiency of glycan attachment on N-glycosylation
sites can
vary with different biological conditions, resulting in variable site
occupancy.[16,17] Recent proteomics investigations
of glycoproteins associated with pancreatic cancer have focused on
discovering altered glycan structures in blood.[18−21] These observations in serum or
plasma may reflect an abnormal glycoproteome in pancreatic tumor tissue;
that is, the glycoproteins that are secreted from pancreatic tumor
cells into the circulation system may have abnormal glycosylation
resulting from malignancy compared with normal cells.In this
study, we applied a global, quantitative glycoproteomics
approach to investigate the N-glycoproteome of pancreatic tumor tissues.
We discovered changes in N-glycosylation level that were specific
to certain proteins and glycosylation sites in pancreatic cancer,
implying complex molecular mechanisms in cancer-associated glycosylation
pathways. The new biological evidence and hypothesis provided by this
study may help to shed light on the molecular mechanisms underlying
glycosylation events in pancreatic tumorigenesis, which in turn may
be of clinical utility for diagnosis and treatment of this deadly
disease.
Materials and Methods
Patients and Specimens
This study
was approved by the
Institutional Review Board at the University of Washington (Seattle,
WA). The IRB approval was obtained with a waiver of informed consent.
Pancreatic tissue specimens were collected from six patients with
PDAC, six patients with chronic pancreatitis (CP), and five nondiseased
controls (NL). For each study category, the pooled samples were generated
by pooling an equal amount of specimens from the patients included
in the study. Two quantitative glycoproteomics experiments were performed
to identify differential glycosylation associated with PDAC and CP
compared with NL, respectively, that is, PDAC versus NL and CP versus
NL.
Lysates Preparation
Snap frozen tissue was homogenized
in T-per (Thermo Scientific, Rockford, IL) with protease inhibitor
and incubated on ice for 15 min. To pellet any cell debris, the lysate
was centrifuged at 13 000g for 15 min at 4
°C. The supernatant was transferred into a new tube, and its
concentration was measured by BCA assay (Pierce, Rockford, IL).
Sample Preparation
Each pooled lysate sample (1000
μg) was mixed with 50 μg of a glycoprotein standard (yeast
invertase 2, heat treated at 90–95 °C for 10 min) (Sigma-Aldrich,
St. Louis, MO), diluted in 50 mM ammonium bicarbonate solution, and
reduced with dl-dithiothreitol (DTT) at 50 °C for 1
h. The samples were then alkylated with iodoacetamide at room temperature
for 30 min in the dark. To purify the sample, we performed TCA precipitation
by adding 1/4 volume of 100% w/v trichloroacetic acid. The samples
were incubated on ice for 10 min and spun down at 14 000g for 5 min. Pellets were washed twice with ice-cold acetone
and air-dried before resuspension in 300 μL of 50 mM sodium
bicarbonate solution. Each lysate was digested with sequencing-grade
trypsin (Promega, Madison, WI) with a 1:50 trypsin-to-sample ratio
at 37 °C for 18 h.
Stable Isotopic Labeling
The digested
samples were
buffer-exchanged to 100 mM sodium acetate, pH 5.5. Equal amounts of
control and diseased sample were separately labeled with formaldehyde-H2
(light) and formaldehyde-D2 (heavy) (Isotec, Champaign, Illinois),
respectively. To label each sample, we added 5 μL of 20% labeling
agent to a 100 μL sample, immediately followed by the addition
of 5 μL of freshly prepared 3 M sodium cyanoborohydride solution.
The samples were incubated for 15 min at room temperature, with vigorous
vortex every few minutes. The light- and heavy-labeled samples were
combined and purified through C18 purification columns (the Nest Group,
Southborough, MA) following the manufacturer’s instructions.
Glycopeptide Enrichment with Hydrazide Beads
Peptides
was resuspended in coupling buffer (100 mM sodium acetate, 150 mM
sodium chloride, pH 5.6) and oxidized with sodium meta-periodate at
the final concentration of 10 mM for 1 h at room temperature in the
dark with gentle rotation. The excess sodium meta-periodate was quenched
by the addition of sodium sulfite at the final concentration of 20
mM for 10 min at room temperature with gentle rotation. The sample
was then combined with rinsed resinhydrazide beads (Thermo Scientific)
and coupled at room temperature overnight (>10 h) with gentle rotation.
After the coupling, beads were washed with 80% acetonitrile/0.1% trifluoroacetic
acid (TFA) solution once, followed by five washes with phosphate-buffered
saline (PBS). Beads were resuspended in PBS and incubated with PNGase
F (New England BioLabs, Ipswich, MA) at 37 °C for 6 h with vortexing
every 30 min. Cleaved glycopeptides were collected by centrifuging
the sample at 1000g for 2 min and collecting the
supernatant. Beads were washed once with fresh 250 μL of PBS
to collect any remaining glycopeptides.
Mass Spectrometry Analysis
An LTQ-Orbitrap hybrid mass
spectrometer (Thermo Fisher Scientific, Waltham, MA) coupled to a
nanoflow HPLC (Eksigent Technologies, Dublin, CA) was used in this
study. 2 μg of sample was injected for the mass spectrometric
analysis. The samples were first loaded onto a 1.5 cm trap column
(IntegraFrit 100 μm, New Objective, Woburn, MA) packed with
Magic C18AQ resin (5 μm, 200 Å particles; Michrom Bioresources,
Auburn, CA) with Buffer A (D.I. water with 0.1% formic acid) at a
flow rate of 3 μL/minute. The peptide samples were then separated
by a 27 cm analytical column (PicoFrit 75 μm, New Objective)
packed with Magic C18AQ resin (5 μm, 100 Å particles; Michrom
Bioresources), followed by mass spectrometric analysis. A 90 min LC
gradient was used as follows: 5–7% Buffer B (acetonitrile with
0.1% formic acid) versus Buffer A over 2 min, then to 35% over 90
min. The flow rate for the peptide separation was 300 nL/min. For
MS analysis, a spray voltage of 2.25 kV was applied to the nanospray
tip. The mass spectrometric analysis was performed using data-dependent
acquisition with a m/z range of
400–1800, consisting of a full MS scan in the Orbitrap followed
by up to 5 MS/MS spectra acquisitions in the linear ion trap using
collision-induced dissociation (CID). Other mass spectrometer parameters
include: isolation width 2 m/z,
target value 1e4, collision energy 35%, and max injection time 100
ms. Lower abundance peptide ions were interrogated using dynamic exclusion
(exclusion time 45 s, exclusion mass width −0.55 m/z low to 1.55 m/z high). Charge-state screen was used, allowing for MS/MS of any ions
with identifiable charge states +2, +3, and +4 and higher.
Data Analysis
Raw machine output files of MS/MS spectra
were converted to mzXML files and searched with X!Tandem,[22,23] against the human International Protein Index (IPI) database version
3.69 with the addition of yeast invertase 2. N-glycosylation can occur
at asparagine residues in a protein sequence with unique consensus
Asn-X-Ser/Thr sequence (NXT/S, X can be any amino acid except proline).[24] The PNGase F enzymatic cleavage of N-glycans
(except α1→3 linked core fucose[25]) converts asparagine into aspartic acid, introducing a mass difference
of 0.9840 Da, which can be explicitly distinguished by high-resolution
mass spectrometry and was used for N-glycosylation site identification.
The search parameters were therefore as follows: enzyme: trypsin;
maximum missed cleavages: 1; static modifications: carboxamidomethylation
on cysteine, light dimethyl on N-terminus and lysine; dynamic modifications:
oxidation on methionine, difference between light and heavy dimethyl
labeled on N-terminus and lysine, enzymatic conversion of asparagine
to aspartic acid; parent monoisotopic mass tolerance: 2.5 Da. Peptide
identifications were assigned probability by PeptideProphet, which
provides statistical validation of MS/MS search for peptide assignments.[26] Relative quantitation of heavy and light peptide
abundance was performed with Xpress[27] version
2.1. Proteins present in sample were inferred using ProteinProphet.[26]
Periodic Acid Schiff Staining
Periodic
Acid Schiff
(PAS) staining was performed on 5 μm sections of paraffin-embedded
PDAC tissue microarray (TMA) according to the manufacturer’s
protocol (Abcam, Cambridge, MA) with minor modifications. In brief,
the section was deparaffinized, followed by Periodic Acid Solution
for 3 min, Schiff’s solution for 15 min, hematoxylin solution
for 2 min, Bluing Reagent for 30 s, and Light Green Solution for 2
min. The Aperio ScanScope Systems (Aperio, Vista, CA) was used for
visualization. The tissue cores (including normal pancreas, CP, PanINs,
and PDAC) were scored blindly of the diagnosis using semiquantitative
histoscores (range 0–300). Histoscores were the products of
staining intensity (0–3) and the percentage of pancreatic cells
(including ductal epithelial cells, acinar cells, stroma cells, and
extracellular matrix) staining at that intensity (0–100). The
histoscores reflect the overall staining of each core.
Real-Time PCR
HDF cells[28] were a generous gift from
Dr. Peter Rabinovitch (University of Washington,
Seattle, WA). HPDE cells[29] were provided
by Dr. Ming-Sound Tsao (University of Toronto, Toronto, Ontario, Canada).
All other cells were purchased from ATCC (Manassas, VA). Cells were
cultured in complete media under standard conditions. HDF cells were
treated with 5 ng/mL TGFβ1 for 4 days. Total RNA was isolated
from cell pellets using the RNeasy Mini kit (Qiagen, Hilden, Germany)
as per manufacturer’s instructions. 100 ng of input RNA was
used for first-strand cDNA synthesis using the SuperScript III first
strand synthesis system (Invitrogen). Standard PCR conditions were
used for amplification reactions. STT3A and STT3B were amplified using
the following PCR primers: STT3Aforward: 5′CTGGTTTGATGACCGAGCCT3′;
STT3Areverse: 5′GCCTaACCAGAGAGATGACGC3′;
STT3Bforward: 5′CGAGTTCGACCCGTGGTTTA3′;
STT3Breverse: TGCAGCAATGCAAAGACACC3′.
PCR reactions were run on an agarose gel and the images were analyzed
using ImageJ (version 1.45i) to determine relative band intensities.
Lanes of interest were marked with the rectangular selection tool
and profile plots were generated. Lines were used to select the peaks
of interest, and a wand tool was used to select peaks for measurement.
Each sample was measured in triplicate.
Results and Discussion
Quantitative
Glycoproteomics Profiling of Pancreatic Tissue
The quantitative
glycoproteomics method[30] used in this study
is illustrated in Figure 1a. In brief, equal
amounts of pancreatic tissue protein from the
diseased and healthy control groups were digested with trypsin, labeled
with heavy and light versions of formaldehyde individually, combined,
and subjected to hydrazide chemistry-based solid phase extraction
to enrich for N-glycopeptides. The glycopeptide extract was separated
with reverse-phase liquid chromatography (LC) followed by in-line
MS/MS analysis. The resulting data were searched against a human proteome
database and validated for peptide/protein identification, followed
by quantitative analysis. Only peptides identified with a PeptideProphet
probability score ≥0.95 (∼1.2% error rate) were retained
for analysis. Notably, before N-glycopeptide enrichment, a small portion
of the combined sample was taken for global profiling to obtain protein
expressional data. Two sets of quantitative glycoproteomics profiling
experiments were carried out to globally compare the N-glycoproteome
of pancreatic tissues between diseased and healthy controls: (1) PDAC
versus healthy normal controls (PDAC/NL) and (2) CP versus healthy
normal controls (CP/NL). In each experiment, replicate samples were
analyzed and combined data were used for the final analysis. A nonhumanglycoprotein standard (yeast invertase 2) was used to monitor and
control variations that may have been introduced during the sample
preparation. This glycoprotein standard has 13 N-glycosylation sites.
Among them, 7 N-glycosylation sites represented by five formerly glycosylated
N-glycopeptides were consistently detected. In both experiments, the
average ratio of the standard peptides remained ∼1.0 before
and after glyco-enrichment, affirming the robustness of this method.
The comparison of duplicate biological samples demonstrated that in
experiments PDAC/NL and CP/NL, more than 73 and 78% of the total annotated
glycoproteins identified were detected in both replicates, respectively
(Figure 1b). The quantitative ratios of the
glycopeptides showed a reasonable correlation between the replicates
(Figure 1c).
Figure 1
Quantitative glycoproteomics analysis
of PDAC/NL and CP/NL. (a)
Glycoproteomics analytical flow. The disease and control samples are
digested and differentially labeled with heavy and light stable isotope
labeling. The combined sample is subjected to N-glycopeptide enrichment
followed by LC–MS/MS analysis. (b) Overlap of glycoproteins
identified in replicates. In both PDAC/NL and CP/NL experiments, the
majority of the glycoproteins were identified in both replicates.
(c) Correlation of glycopeptide ratios between replicates. The quantitative
ratios of the glycopeptides are well-correlated between the replicates
in both experiments, with an R2 value
of 0.88 and 0.83 for PDAC/NL and CP/NL, respectively.
Quantitative glycoproteomics analysis
of PDAC/NL and CP/NL. (a)
Glycoproteomics analytical flow. The disease and control samples are
digested and differentially labeled with heavy and light stable isotope
labeling. The combined sample is subjected to N-glycopeptide enrichment
followed by LC–MS/MS analysis. (b) Overlap of glycoproteins
identified in replicates. In both PDAC/NL and CP/NL experiments, the
majority of the glycoproteins were identified in both replicates.
(c) Correlation of glycopeptide ratios between replicates. The quantitative
ratios of the glycopeptides are well-correlated between the replicates
in both experiments, with an R2 value
of 0.88 and 0.83 for PDAC/NL and CP/NL, respectively.One advantage of enriching glycopeptides for mass
spectrometry
analysis is to reduce the possibility of false identification of N-glycosylation
sites due to deamidation of asparagine. Using solid-phase extraction,
glycopeptides were retained on the solid phase with covalent bonding
between the protein carbohydrate groups and the surface-attached hydrazide
groups. Thus, the majority of the nonglycopeptides, including deamidated
peptides, were washed off during sample preparation process and were
not included in the mass spectrometric analysis. In fact, among the
peptides identified (PeptideProphet probability ≥0.95) with
NXT/S motifs, 94% were confirmed with the Uniprot Knowledgebase with
annotated N-glycosylation site(s).Altogether, 637 N-glycopeptides
derived from 374 (based on gene
symbol) nonredundant glycoproteins were identified with stringent
criteria, representing 649 annotated N-linked glycosylation sites.
The N-glycopeptides identified in pancreas tissue are summarized in
Supplemental Table 1 in the Supporting Information. More than 62% of the glycoproteins identified are membrane proteins,
and over 46% are extracellular proteins, involving a variety of biological
processes, including cellular process regulation, protein metabolism,
immune system response, transport, and biological adhesion.
Presence
of Pancreas N-Glycoproteins in Blood
Because
glycosylated proteins, in particular, N-linked glycoproteins, are
destined for extracellular environments,[31] many tumor-associated glycoproteins are shed into the blood and
may be detectable by various methods. This could partially explain
why many cancer biomarkers, including CA19-9, are glycoproteins.[32] In comparing with the proteins identified in
human plasma by the HUPO human plasma project[33,34] and our previous plasma proteomics study,[35] nearly half (46%) of the pancreas tissue glycoproteins identified
in this study were also present in plasma. When the same hydrazide-chemistry-based
solid-phase extraction approach was used for glycoenrichment, 157
N-glycoproteins identified in pancreas tissue were also captured and
identified in human plasma.[25,36] The cellular locations
of these glycoproteins are presented in Figure 2a. Whether the presence of these pancreatic tissue glycoproteins
in plasma quantitatively represents their association with cancer
in tumor tissue poses an important question for blood biomarker development
and warrants further investigation. Figure 2b shows the plasma concentration range for some of the glycoproteins
identified in pancreatic tissue, which were previously proposed as
potential cancer biomarker candidates.[37] The majority of these glycoproteins have at least one N-glycopeptide
upregulated in pancreatic tumor tissue.
Figure 2
Presence of pancreas
glycoproteins in plasma. (a) GO annotation
of the cellular components for the pancreas glycoproteins that were
also identified in plasma studies. The majority of these N-glycoproteins
are extracellular or membrane proteins. (b) Plasma concentrations
(on log10 scale) of selected N-glycoproteins identified
in pancreas tissue. The up and down arrows indicate that at least
one N-glycopeptide derived from these proteins was either up- (≥2
fold) or down- (≤0.5 fold) regulated in pancreatic tumor tissue,
respectively.
Presence of pancreasglycoproteins in plasma. (a) GO annotation
of the cellular components for the pancreasglycoproteins that were
also identified in plasma studies. The majority of these N-glycoproteins
are extracellular or membrane proteins. (b) Plasma concentrations
(on log10 scale) of selected N-glycoproteins identified
in pancreas tissue. The up and down arrows indicate that at least
one N-glycopeptide derived from these proteins was either up- (≥2
fold) or down- (≤0.5 fold) regulated in pancreatic tumor tissue,
respectively.
Changes in N-Glycosylation
Level Associated with Pancreatic
Cancer and Inflammation
While the peptide abundance ratio
distribution before glycopeptide enrichment reflects the comparison
of the whole proteome between diseases (PDAC or CP) and control (NL)
for a given analytical sensitivity, the postenrichment peptide abundance
ratio distribution represents a more specific comparison of the N-glycoproteome
between the disease and control samples. Figure 3a shows the peptide ratio distribution of PDAC/NL and CP/NL after
glycopeptide enrichment (mostly glycopeptides in their deglycosylated
form). Following glycopeptide enrichment, the median peptide ratio
of PDAC/NL shifted from 1.2 before glycopeptide enrichment to 2.5,
indicating an overall increase in N-glycosylation level in pancreaticcancer samples. While this alteration in the N-glycoproteome was obscured
in the whole proteome analysis due to the sample complexity, it was
clearly revealed by the quantitative glycoproteomics analysis. A similar
phenomenon was observed upon comparison of CP to healthy control.
These observations may be related to our previous tissue proteomics
study,[38] which indicated that N-glycoproteins
were significantly enriched among the overexpressed proteins of PDAC
and severe CP tissues compared with healthy control.
Figure 3
(a) Distribution of peptide
abundance ratio after glycopeptide
enrichment. Most of the peptides identified after glyco-enrichment
are N-glycopeptides in their deglycosylated form and showed an upward
shift in peptide abundance ratio distribution in both PDAC/NL and
CP/NL experiments. While the majority of the total peptides (before
glyco-enrichment) did not show a significant difference in abundance
between diseases and controls, a significant portion of the N-glycopeptides
(after glyco-enrichment) were associated with an abundance elevation
in cancer and pancreatitis tissue. (b) Distribution of the N-glycopeptides
based on their abundance ratio in PDAC and CP compared with the normal
control. The glycopeptides are categorized into nine regions based
on their relative glycosylation level in PDAC and CP, as described
in the text.
(a) Distribution of peptide
abundance ratio after glycopeptide
enrichment. Most of the peptides identified after glyco-enrichment
are N-glycopeptides in their deglycosylated form and showed an upward
shift in peptide abundance ratio distribution in both PDAC/NL and
CP/NL experiments. While the majority of the total peptides (before
glyco-enrichment) did not show a significant difference in abundance
between diseases and controls, a significant portion of the N-glycopeptides
(after glyco-enrichment) were associated with an abundance elevation
in cancer and pancreatitis tissue. (b) Distribution of the N-glycopeptides
based on their abundance ratio in PDAC and CP compared with the normal
control. The glycopeptides are categorized into nine regions based
on their relative glycosylation level in PDAC and CP, as described
in the text.Quantitative evaluation
of the glycoproteomics method using identical
pancreas tissue samples indicated that when a two-fold change was
used as a cutoff threshold the false discovery rate for quantification
was ∼4%.[30] By that criteria, 392
N-glycopeptides (316 up- and 76 down-regulated) derived from 252 proteins
were found to have aberrant N-glycosylation level (≥2-fold
change) in pancreatic cancer tissue. Figure 3b summarizes the abundance ratio changes of the formerly glycosylated
N-glycopeptides in pancreatic cancer and CP compared with the nondiseased
controls. A significant portion of N-glycopeptides showed a ≥2-fold
change in pancreatic cancer (regions B, I, and H). Notably, the N-glycopeptides
derived from several CA19-9 carrier proteins, including mucins, apolipoprotein
B, and kininogen-1,[39] fell within these
regions. Some of these cancer-associated N-glycopeptides were also
elevated in CP (region B) in accordance with the notion that proteins
dysregulated in CP are frequently involved in pancreatic cancer.[38,40] Among the N-glycopeptides that were up-regulated in both PDAC and
CP using NL as a background, some showed an even greater elevation
in PDAC compared with CP. The group of the glycopeptides that were
up-regulated in pancreatic cancer but not in CP (region I) are largely
associated with cancer and will be discussed in the pathway analysis
section. In contrast, there were fewer glycopeptides that were down-regulated
in pancreatic cancer (regions D–F). Glycopeptides that were
down-regulated in pancreatic cancer but not in CP clustered in region
E.One last group of glycopeptides was identified in only one
experiment
(PDAC/NL or CP/NL) but not both. These glycopeptides were not presented
in Figure 3b, which only includes glycopeptides
with both PDAC/NL and CP/NL ratios. The detection of these glycopeptides
in only one set of samples may be attributed to their abundant difference
in PDAC/NL and CP/NL sample set or limited by the scope of current
“shotgun” proteomics approach. Some of the differential
glycopeptides identified exclusively in PDAC/NL experiment are highly
relevant to pancreatic cancer, including N-glycopeptides derived from
MUC5AC, MUC5B, CECAM5, and CECAM6.Periodic acid Schiff (PAS)
staining was performed on a TMA to detect
the overall level of polysaccharides presented on tissue sections
of PDAC, CP, and NL. As shown in Figure 4,
PAS staining (red) on the majority of the tumor tissues and CP lesions
is significantly stronger than the normal pancreas tissues, reflecting
an overall increase in glycosylation level in pancreatic tissue of
PDAC and CP.
Figure 4
PAS staining of an TMA that includes tissue sections of
PDAC, CP,
and NL. (a) Images of PAS staining on the tissue sections. PAS staining
(red) on most of the PDAC and CP tissue sections appeared to be stronger
than the NL tissue sections. (b) Histoscores of PAS staining were
significantly higher in PDAC and CP groups compared with NL group.
PAS staining of an TMA that includes tissue sections of
PDAC, CP,
and NL. (a) Images of PAS staining on the tissue sections. PAS staining
(red) on most of the PDAC and CP tissue sections appeared to be stronger
than the NL tissue sections. (b) Histoscores of PAS staining were
significantly higher in PDAC and CP groups compared with NL group.
Preferential Detection
of Formerly N-Linked Glycosylation Sites
in Cancer
The measurement of abundance of an N-glycosylated
peptide may represent the glycosylation level of its corresponding
glycosylation site and is a convoluted outcome of the core protein
expression and the glycosylation occupancy of the specific glycosylation
site. Therefore, quantitative difference in the detection of a specific
glycopeptide between cancer and control may reflect the overall difference
of the glycosylation level on the corresponding protein site, although
such detection can be influenced by the complexity, number, and spacing
of glycans at the specific site. By knowing the relative changes in
glycopeptide abundance and core protein expression, the relative change
of an N-glycosylation site occupancy can be further estimated as follows:
fold change in N-glycosylation site occupancy = fold change in N-glycopeptide
abundance/fold change in core protein expression. Table 1 exemplifies that for some proteins N-glycosylation site occupancy
changes within an individual protein can vary substantially in cancer
or CP. Kininogen-1 (KNG1) is a CA19-9 protein carrier and has been
associated with pancreatic cancer and pancreatitis. The occupancy
of two N-glycosylation sites of KNG1 was significantly increased (>3
fold) in PDAC and CP tissues compared with normal controls, whereas
its core protein expression was only slightly elevated in the disease
samples. Notably, the increase in sialylation and fucosylation of
kininogen-1 has been observed in the sera of pancreatic cancerpatients.[21] Versican (VCAN) is an extracellular matrix proteoglycan
that plays a role in inflammation and cancer metastasis and has been
associated with pancreatic cancer.[38,41] While its
core protein expression was significantly increased in PDAC and CP
tissue (20-fold and 8-fold in PDAC and CP, respectively), the changes
in its glycosylation site occupancy were less dramatic. Biglycan (BGN)
is a pancreatic cancer-associated extracellular matrix proteoglycan
that interacts with collagens. Two of its N-glycosylation sites were
heavily hyper-glycosylated in PDAC and CP, respectively. Apolipoprotein
B-100 (APOB) is also one of the CA19-9 protein carriers and is involved
in regulating plasma lipid metabolism. Two N-glycosylation sites of
APOB were detected at a >3-fold higher level in PDAC and CP compared
with normal pancreas, while its three other N-glycosylation sites
were detected at <0.5-fold reduced levels. Fibrillin 1 (FBN1) is
secreted by fibroblasts and is a major component of the elastin microfibrils,
which impact tumor cell-extracellular matrix interactions.[42] While the core protein expression of FBN1 is
significantly increased in PDAC and CP, glycosylation occupancies
of its three N-glycosylation sites were decreased (≤0.3 fold)
in the diseased states. These observations suggest that inherent changes
in the N-glycosylation of specific proteins at certain glycosylation
sites in the disease settings may be important and independent of
core protein expression levels. As a reference, the five formerly
N-glycosylated peptides derived from yeast invertase 2, which was
spiked in the samples and used as a control for glycopeptide capturing,
maintained abundance ratios around 1.0 in the comparison of diseases
(PDAC or CP) and normal control (NL) (Supplemental Figure 1 in the Supporting Information).
Table 1
Exemplification
of Changes in N-Glycosylation
Site Occupancy Associated with PDAC and CP in Comparison with Healthy
Controla
PDAC versus NL
CP versus NL
glycoprotein
gene symbol
N-glycopeptide
fold change in glycopeptide abundance
fold change in protein abundance
fold change in glycosylation site occupancy
fold change in glycopeptide
abundance
fold change in protein abundance
fold change in glycosylation site occupancy
apolipoprotein B-100
APOB
R.FEVDSPVYN∼ATWSASLK.N
1.7
4.9
0.3
1.3
2.6
0.5
R.FN∼SSYLQGTNQITGR.Y
17.4
3.5
12.3
4.6
K.FVEGSHN∼STVSLTTK.N
0.5
0.1
0.9
0.3
R.VNQNLVYESGSLN∼FSK.L
2.6
0.5
0.9
0.3
K.YDFN∼SSM″LYSTAK.G
18.0
3.6
18.4
6.9
biglycan
BGN
K.LLQVVYLHSNN∼ITK.V
15.9
3.0
5.3
9.0
0.8
12.0
R.M″IEN∼GSLSFLPTLR.E
9.0
3.0
8.2
11.0
complement factor H
CFH
K.IPCSQPPQIEHGTIN∼SSR.S
12.4
1.8
6.9
21.2
2.5
8.6
R.ISEEN∼ETTCYM″GK.W
25.0
14.0
16.9
6.9
K.MDGASN∼VTCINSR.W
1.0
0.5
9.1
3.7
clusterin
CLU
K.EDALN∼ETR.E
5.5
2.7
2.0
4.1
3.8
1.1
R.LAN∼LTQGEDQYYLR.V
4.1
1.5
4.5
1.2
K.M″LN∼TSSLLEQLNEQFNWVSR.L
5.4
2.0
5.7
1.5
R.QLEEFLN∼QSSPFYFWM″NGDR.I
5.0
1.8
4.4
1.1
CP protein
CP
K.EHEGAIYPDN∼TTDFQR.A
15.8
2.6
6.0
10.6
7.1
1.5
K.ELHHLQEQN∼VSNAFLDK.G
14.4
5.5
5.9
0.8
K.EN∼LTAPGSDSAVFFEQGTTR.I
9.9
3.8
9.9
l.4
fibrillin 1
FBN1
K.AWGTPCEMCPAVN∼TSEYK.I
2.0
9.7
0.2
2.5
7.9
0.3
K.CTDLDECSN∼GTHM″CSQHADCK.N
1.9
0.2
2.2
0.3
R.VLPVN∼VTDYCQLVR.Y
1.3
0.1
1.8
0.2
pancreatic secretory granule membrane major glycoprotein
GP2
R.DPN∼CSSILQTEER.N
0.1
0.2
0.5
0.1
0.3
0.5
R.QDLN∼SSDVHSLQPQLDCGPR.E
0.4
2.3
0.6
2.4
K.VSLQAALQPIVSSLN∼VSVDGNGEFIVR.M
0.6
3.5
0.8
3.1
hemopexin
HPX
K.ALPQPQN∼VTSLLGCTH.-
13.1
7.4
1.8
9.5
3.5
2.8
R.CSDGWSFDATTLDDN∼GTM″LFFK.G
4.8
0.6
4.8
1.4
R.N∼GTGHGN∼STHHGPEYM″R.C
14.0
1.9
8.1
2.3
R.SWPAVGN∼CSSALR.W
15.1
2.0
10.9
3.1
endoplasmin
HSP90B1
R.EEEAIQLDGLN∼ASQIR.E
0.6
0.4
1.7
0.9
0.5
2.0
K.GVVDSDDLPLN∼VSR.E
0.1
0.3
0.1
0.3
kininogen-1
KNG1
R.ITYSIVQTN∼CSK.E
9.6
1.4
6.6
13.1
1.9
7.1
K.YNSQN∼QSNNQFVLYR.I
7.0
4.8
6.4
3.5
lumican
LUM
K.AFEN∼VTDLQWLILDHNLLENSK.I
2.4
4.3
0.6
3.7
3.0
1.2
K.LGSFEGLVN∼LTFIHLQHNR.L
2.5
0.6
4.7
1.6
K.LHINHNN∼LTESVGPLPK.S
2.7
0.6
5.0
1.6
R.LSHNELADSGIPGNSFN∼VSSLVELDLSYNK.L
2.0
0.5
3.9
1.3
PRELP protein
PRELP
R.IHYLYLQNNFITELPVESFQN∼ATGLR.W
14.1
7.6
1.8
10.3
3.1
3.3
K.IN∼GTQICPNDLVAFHDFSSDLEN∼VPHLR.Y
l.8
0.2
2.0
0.6
prosaposin
PSAP
K.DN∼ATEEEILVYLEK.T
2.2
1.5
1.5
3.3
1.6
1.1
R.TN∼STFVQALVEHVK.E
4.6
3.0
2.7
0.9
versican
VCAN
R.FEN∼QTGFPPPDSR.F
38.4
20.8
1.9
17.9
8.2
2.2
R.GQFESVAPSQN∼FSDSSESDTHPFVIAK.T
22.6
1.1
3.2
0.4
Fold change in glycosylation site
occupancy = Fold change in glycopeptide abundance/Fold change in protein
abundance. N∼ - N-glycosylation site, M″
- oxidized methionine.
Fold change in glycosylation site
occupancy = Fold change in glycopeptide abundance/Fold change in protein
abundance. N∼ - N-glycosylation site, M″
- oxidized methionine.A
small group of known cancer-associated glycoproteins, including
carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5),
mucin-5AC (MUC5AC), insulin-like growth factor binding protein (IGFBP3),
and platelet endothelial cell adhesion molecule (PECAM1 or CD31),
were only detected in the PDAC/NL experiment. For this group of proteins,
the formerly N-glycosylated peptides, which represent different N-glycosylation
sites, derived from the same protein also showed various levels of
abundance change in cancer (Supplemental Table 1 in the Supporting Information), mirroring the heterogeneity
of N-glycosylation changes at different glycosylation sites within
a protein. Notably, for these proteins, not all N-glycosylation sites
were detected as expected. For example, according to UniProtKB (http://www.uniprot.org), CEACAM5 has two referenced and 26
potential N-glycosylation sites (including some N-glycopeptides that
have repeated sequences), but only two formerly glycosylated peptides,
representing the two referenced N-glycosylation sites, were detected
in pancreatic tumor tissues in this study. This may be due to several
reasons, including: (1) Some glycopeptides may not have a molecular
mass within the mass spectrometry detection range. (2) Protein glycosylation
varies significantly in different organ tissues. Some potential N-glycosylation
sites may not be glycosylated in pancreatic tissue, and (3) some glycopeptide
sequences may inherently afford low mass spectrometric sensitivity.
Nonetheless, our observation supports the fact that the glycosylation
levels between individual N-glycosylation sites within a glycoprotein
can be different in corresponding to pancreatic cancer; and such difference
may result from the nature of macro-heterogeneity of N-glycosylation[16] and the influence of malignancy on the complex
mechanisms that regulate glycosylation events.
Changes in Oligosaccharyltransferase
Subunits
N-Glycosylation
involves a complex process in determining the mature form of a glycoprotein,
including the biosynthesis of dolichol-linked oligosaccharide and
the transfer of the oligosaccharide from the lipiddonor substrate
to the nascent polypeptide. This complex process occurs in endoplasmic
reticulum (ER) and other cellular compartments, engaging a variety
of enzymes and proteins, including glycotransferases, glycosidases,
and oligosaccharyltransferase (OST) complex.[43] The main function of OST, which is located at the membrane of the
ER, is to transfer preassembled, lipid-linked oligosaccharides to
selected asparagine residues within the consensus sequence Asn-X-Ser/Thr
on nascent polypeptides. Several OST subunits, including STT3A, DAD1,
RPN1, RPN2, and DDOST (OST48), were found slightly under-expressed
in pancreatic tumor tissues as well as CP tissues (Figure 5a). Real-time PCR was used to measure the expression
of two major OST catalytic subunits, STT3A and STT3B, in three pancreaticcancer cell lines (AsPC1, MiaPaCa, and Panc1) as well as in TGFβ1-activated
fibroblast cells (TGFβ-HDF) using normal pancreatic ductal epithelial
cells (HPDE) and normal fibroblast cells (HDF) as a comparison, respectively
(Figure 5b). As demonstrated in Figure 5c, in all three pancreatic cancer cell lines we
observed a slight decrease in expression of both STT3A and STT3B relative
to HPDE; and in the stimulated fibroblast cells, no significant change
of STT3A and STT3B expression was observed compared with the parental
HDF. The observations in pancreatic cancer cell lines appeared to
be coherent with the tissue proteomics data, suggesting that a minor
down-regulation of OST proteins was associated with the alterations
in pancreatic tissue due to pancreatic adenocarcinoma or severe inflammation.
The efficiency of N-glycan attachment on glycoprotein sites may be
cell-type-dependent and differentially regulated at different levels
of protein co- and post-translational modifications and can be affected
genetically or functionally by altered physiological status due to
malignancy. While OST plays a crucial role in facilitating N-glycosylation,
it is only one of many modules within the N-glycosylation pathway
in determining the mature form of a glycoprotein.[16,43] These data support further investigations to examine OST functional
changes and other key factors accounting for the protein specific
alterations in N-glycosylation level observed in pancreatic tumor
tissue.
Figure 5
(a) Relative abundance of some of the OST subunits (STT3A, DAD1,
RPN1, RPN2, and DDOST) in pancreatic tumor tissue and chronic pancreatitis
tissue compared to normal pancreas (DDOS was not detected in CP/NL
experiments). (b) Real-time PCR analysis of STT3A and STT3B expression
in three pancreatic cancer cell lines (AsPC1, MiaPaCa, and Panc1)
and in TGFβ1-activated fibroblast cells (TGFB-HDF) compared
with normal pancreatic ductal epithelial cells (HPDE) and normal fibroblast
cells (HDF), respectively. (c) Relative intensities of STT3A and STT3B
in the cell lines. The intensity for STT3A or STT3B was relative to
GAPDH and then normalized to HPDE for pancreatic cancer cells and
normalized to HDF for TGFβ1-activated HDFs.
(a) Relative abundance of some of the OST subunits (STT3A, DAD1,
RPN1, RPN2, and DDOST) in pancreatic tumor tissue and chronic pancreatitis
tissue compared to normal pancreas (DDOS was not detected in CP/NL
experiments). (b) Real-time PCR analysis of STT3A and STT3B expression
in three pancreatic cancer cell lines (AsPC1, MiaPaCa, and Panc1)
and in TGFβ1-activated fibroblast cells (TGFB-HDF) compared
with normal pancreatic ductal epithelial cells (HPDE) and normal fibroblast
cells (HDF), respectively. (c) Relative intensities of STT3A and STT3B
in the cell lines. The intensity for STT3A or STT3B was relative to
GAPDH and then normalized to HPDE for pancreatic cancer cells and
normalized to HDF for TGFβ1-activated HDFs.Although it remains unclear how malignancy influences the
sophisticated
N-glycosylation pathway in modulating N-glycosylation efficiency,
our observations implicate the fact that cancer-associated aberrant
glycosylation may involve changes in N-glycosylation site occupancy,
and such changes may be protein- and glycosylation-site-specific,
influencing the detection of the abundance of specific glycopeptides
for certain proteins. The ability to quantitatively probe glycosylation
level at individual glycosylation sites (using specific glycopeptides)
may reveal information about highly specific cancer-associated molecular
changes and provide clues to elucidate the roles of protein glycosylation
in pancreatic cancer pathways.
Glycosylation of Galectin-3-Binding
Protein (LGALS3BP)
Galectin-3-binding protein (LGALS3BP or
M2BP) belongs to the Scavenger
Receptor Cysteine-Rich domain (SRCR) superfamily of proteins, and
its significant N-glycosylation change in PDAC is notable in this
study. LGALS3BP is a known tumor-associated antigen and plays a role
in immune defense against tumor cells and was previously associated
with shorter cancer survival and drug resistance.[44,45] The core protein expression of LGALS3BP was elevated 2.5-fold in
pancreatic tumor tissue compared with normal pancreas (Figure 6a). We further observed that the abundance of several
of its N-glycopeptides were significantly up-regulated in PDAC, with
over 10-fold and 3-fold increase compared with normal pancreas and
chronic pancreatitis, respectively (Figure 6b). Highly glycosylated LGALS3BP may stimulate and intensify the
interaction of its major binding partners, such as galectin-1 (LGALS1)
and galectin-3 (LGALS3), both of which have been associated with pancreaticcancer[46−48] and found to be overexpressed in PDAC in this study
with 5.8 and 3.3 fold increase in pancreatic tumor tissue, respectively
(Figure 6a). Other endogenous ligands of galectin-1
and -3, including fibronectin, lysosome-associated membrane glycoproteins,
receptor-type tyrosine-protein phosphatase C, CD7 antigen and integrin
alpha-M also showed different levels of increase in glycopeptides
detected (Supplemental Table 1 in the Supporting
Information) but less substantial than LGALS3BP. The up-regulation
of galectins and significant hyper N-glycosylation of LGALS3BP in
tumor tissue (Figure 6c) may imply an increased
cell–cell interaction to facilitate tumor cell aggregation
and metastatic diffusion.[49]
Figure 6
Core protein expression
and N-glycosylation site occupancy changes
of LGALS3BP in PDAC. (a) Relative abundance of LGALS3BP and its major
binding partners LGALS1and LGALS3 in PDAC compared with NL. The core
protein expressions of these proteins were all elevated in tumor tissues.
(b) Relative abundance of N-glycopeptides derived from LGALS3BP in
PDAC compared with NL and CP. The glycosylation level of the corresponding
N-glycosylation sites increased in PDAC. (c) Changes in N-glycosylation
site occupancy of LGALS3BP in PDAC compared with NL.
Core protein expression
and N-glycosylation site occupancy changes
of LGALS3BP in PDAC. (a) Relative abundance of LGALS3BP and its major
binding partners LGALS1and LGALS3 in PDAC compared with NL. The core
protein expressions of these proteins were all elevated in tumor tissues.
(b) Relative abundance of N-glycopeptides derived from LGALS3BP in
PDAC compared with NL and CP. The glycosylation level of the corresponding
N-glycosylation sites increased in PDAC. (c) Changes in N-glycosylation
site occupancy of LGALS3BP in PDAC compared with NL.
Pathways and Networks Associated with Glycoproteins
with Increased
N-Glycosylation Level in PDAC
Among the glycoproteins identified,
197 and 175 glycoproteins have at least one N-glycopeptide up-regulated
in PDAC and CP, respectively. A significant number (n = 137) of the glycoproteins with elevated N-glycosylation level
associated with PDAC overlapped with those associated with CP. Analysis
using ingenuity pathway analysis (IPA) (Ingenuity Systems) revealed
some interesting differences and similarities. For PDAC-associated
glycoproteins, cancer is the primary disease, and for CP-associated
glycoproteins, inflammatory response is the major pathway. While the
significant molecular and cellular functions associated with the glycoproteins
of both disease groups include cell movement and interaction of leukocyte
and other immune cells, the PDAC-associated glycoproteins were also
involved in the movement and interaction of endothelial and tumor
cells (Supplemental Table 2 in the Supporting
Information). Further analysis of the glycoproteins that were
PDAC-specific (n = 60) revealed that the top biological
functions associated with these proteins are cancer, pancreatic cancer,
and epithelial neoplasia and the top upstream regulators are TGFB1,
TNF, TFEB, and NFKBIA (Supplemental Table 2 in the Supporting Information). Figure 7 displays
the downstream protein networks for TGFB1, TNF, TFEB, and NFKBIA.
It is important to note that the IPA analysis was based on the elevated
level of N-glycosylation of these glycoproteins. Thus, the results
may reflect the relationship of N-glycosylation level and activities
of these glycoproteins and their roles in the corresponding pathways.
Figure 7
Ingenuity
pathway analysis: Significant upstream regulators (TGFB1,
TNF, TFEB, and NFKBIA) of the glycoproteins that had elevated N-glycosylation
levels in PDAC compared with normal pancreas and chronic pancreatitis.
Orange line denotes leads to activation and yellow lines denote that
the finding is inconsistent with the downstream molecule based on
the database. Most of these yellow lines are associated with NFKBIA,
implying a possible negative influence on NFKBIA function with the
increase in N-glycosylation level of its downstream glycoproteins
in PDAC.
Ingenuity
pathway analysis: Significant upstream regulators (TGFB1,
TNF, TFEB, and NFKBIA) of the glycoproteins that had elevated N-glycosylation
levels in PDAC compared with normal pancreas and chronic pancreatitis.
Orange line denotes leads to activation and yellow lines denote that
the finding is inconsistent with the downstream molecule based on
the database. Most of these yellow lines are associated with NFKBIA,
implying a possible negative influence on NFKBIA function with the
increase in N-glycosylation level of its downstream glycoproteins
in PDAC.While numerous studies have demonstrated
the important role of
TGFB1, TNF, and NF-kappa-B in cancer and pancreatic tumorigenesis,[50−52] their involvement with glycosylation has been largely uncovered.
Increased N-glycosylation level of a large number of TGFB1-regulated
glycoproteins, whose main molecular functions are cell–cell
interaction, tumor cell movement, and immune cell trafficking, may
implicate glycosylation events in the activation of TGF-β-related
pathways in PDAC. The glycoproteins involved in the TNF pathways have
various functions related to tumorigenesis, including proliferation,
regulation of apoptosis, and cell migration. Over half of the PDAC-associated
glycoproteins involved in the TNF pathway also participated in the
TGF-β pathway, suggesting that increased N-glycosylation activities
of these proteins may involve coactivation of TNF- and TGFB1-related
pathways in the pathogenesis of PDAC. The finding of TFEB as a significant
upstream activator for PDAC-associated glycoproteins may link increased
N-glycosylation level and altered activity of lysosomal proteins in
pancreatic tumorigenesis. For NFKBIA, we observed that the IκB
inhibitor, NFKBIA, is negatively associated with the N-glycosylation
level of its downstream glycoproteins in PDAC (Figure 7). This phenomenon implies that increased N-glycosylation
of these glycoproteins may possibly reduce the function of NFKBIA
to complex with NF-κB transcription factor and thus promote
the activity of NF-κB transcription factor in pancreatic tumorigenesis.
Summary
Using a quantitative glycoproteomics approach, we
have investigated
the N-glycoproteome of humanpancreas and its alteration associated
with pancreatic cancer and inflammation. On a large scale, we observe
an overall increase in N-glycosylation level, which represents an
overall outcome of changes in N-glycosylation occupancy and core protein
expression across a broad range of glycoproteins in pancreatic tumor
tissue and CP tissue. The upward shifting of the distribution of N-glycopeptide
ratio may reflect an overall increase in N-glycosylation activity
resulting from or implicated with pancreatic tumorigenesis or associated
complications such as inflammation. Many pancreatic cancer-associated
glycoproteins were found to have elevated N-glycosylation level in
tumor tissues compared with normal pancreas, including MUC5AC, CEACAM5,
IGFBP3, LGALS3BP, and others. Notably, LGALS3BP was found both increased
in protein expression and substantially hyper-glycosylated in tumor
tissue. The implication of LGALS3BP N-glycosylation in pancreatictumorigenesis was possibly through intensifying the specific interplay
between LGALS3BP and galectins to mediate cell–cell and cell-extracellular
matrix interactions, angiogenesis, and apoptosis of tumor cells.[49]For many of these aberrant glycoproteins,
glycosylation site occupancy
at specific N-glycosylation sites could correspond to pancreatic malignancy
or inflammation differently, reflecting the complex molecular mechanisms
involved. These observations support the fact that for certain glycoproteins,
in addition to glycan structure alterations, specific changes in N-glycosylation
level appeared to be quantitatively associated with pancreatic cancer
or inflammation. Such molecular feature may be represented by specific
glycopeptides, which, in turn, can be quantitatively detected in clinical
specimens using targeted proteomics.[53−55] Examination of OST subunits
did not indicate a significant change in the expression of these proteins
in pancreatic tumor tissues, CP tissues, as well as pancreatic cancer
cell lines. Further investigations are needed to clarify the role
of OST in tumor-associated N-glycosylation alterations on proteins.The pathway analysis of increased N-glycosylation level on many
glycoproteins implicates several known pancreatic cancer pathways,
including TGF-β, TNF, NF-kappa-B, and TFEB-related lysosomal
changes. Although these pathways have been previously associated with
pancreatic tumorigenesis, the increased N-glycosylation level in pancreaticcancer pathways is an emerging phenomenon that may help decode how
glycosylation is involved in metastasis and invasion of pancreaticcancer. The majority of the glycoproteins with increased N-glycosylation
level were involved in cell movement and signaling functions related
to tissue development. Protein–protein interaction analysis
of all PDAC-associated glycoproteins involved in TGF-β, TNF,
TFEB, and NF-kappa-B pathways further revealed that these glycoproteins
are highly interactive among themselves and involve ECM-receptor interactions
and focal adhesions (Supplemental Figure 2 in the Supporting Information), which may be relevant to site-specific
glycosylation changes, thereby affecting specific protein–protein
interactions, protein conformation, and structure involved in cancer
progression and metastasis.While this global study reveals
the aberrant N-glycosylation levels
associated with pancreatic tumor tissues from a proteomic perspective,
much work remains to follow-up these leads and is beyond the scope
of this report. The orchestrated mechanism underlying the differential
changes of N-glycosylation occupancy in cancer, which appears to be
not only protein- but also glycosylation-site-specific, remains poorly
understood.
Authors: Diane M Simeone; Baoan Ji; Mousumi Banerjee; Thiruvengadam Arumugam; Dawei Li; Michelle A Anderson; Ann Marie Bamberger; Joel Greenson; Randal E Brand; Vijaya Ramachandran; Craig D Logsdon Journal: Pancreas Date: 2007-05 Impact factor: 3.327
Authors: L Renee Ruhaak; Sandra L Taylor; Carol Stroble; Uyen Thao Nguyen; Evan A Parker; Ting Song; Carlito B Lebrilla; William N Rom; Harvey Pass; Kyoungmi Kim; Karen Kelly; Suzanne Miyamoto Journal: J Proteome Res Date: 2015-09-30 Impact factor: 4.466