Literature DB >> 24086368

An epistatic interaction between the PAX8 and STK17B genes in papillary thyroid cancer susceptibility.

Iñigo Landa1, Cesar Boullosa, Lucía Inglada-Pérez, Ana Sastre-Perona, Susana Pastor, Antonia Velázquez, Veronika Mancikova, Sergio Ruiz-Llorente, Francesca Schiavi, Ricard Marcos, Nuria Malats, Giuseppe Opocher, Ramon Diaz-Uriarte, Pilar Santisteban, Alfonso Valencia, Mercedes Robledo.   

Abstract

Papillary Thyroid Cancer (PTC) is a heterogeneous and complex disease; susceptibility to PTC is influenced by the joint effects of multiple common, low-penetrance genes, although relatively few have been identified to date. Here we applied a rigorous combined approach to assess both the individual and epistatic contributions of genetic factors to PTC susceptibility, based on one of the largest series of thyroid cancer cases described to date. In addition to identifying the involvement of TSHR variation in classic PTC, our pioneer study of epistasis revealed a significant interaction between variants in STK17B and PAX8. The interaction was detected by MD-MBR (p = 0.00010) and confirmed by other methods, and then replicated in a second independent series of patients (MD-MBR p = 0.017). Furthermore, we demonstrated an inverse correlation between expression of PAX8 and STK17B in a set of cell lines derived from human thyroid carcinomas. Overall, our work sheds additional light on the genetic basis of thyroid cancer susceptibility, and suggests a new direction for the exploration of the inherited genetic contribution to disease using association studies.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24086368      PMCID: PMC3781145          DOI: 10.1371/journal.pone.0074765

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Follicular-cell-derived thyroid carcinomas are the most common endocrine malignancies and their incidence has remarkably increased in recent years [1], [2]. Among them, papillary thyroid carcinoma (PTC, 80–85% of cases), and follicular thyroid carcinoma (FTC, 5–10%) are the most frequent subtypes [3]. It is widely accepted that follicular-cell-derived thyroid cancer behaves as a complex disease, where multiple genetic variants, located on low-penetrance genes (LPG), interact with each other and with the environment, thus modulating individual susceptibility [4]–[6]. We previously reported the association of the FOXE1 gene with PTC susceptibility [7], a result that has been extensively replicated [8]–[10]. Until now, most association studies have focused on main effects and identified only single, or a very limited number of, genes involved in PTC pathogenesis. Variants in these genes explain a relatively small proportion of cases. While additional low-penetrance genes may be identified by future studies of main effects, it is also likely that common variants at different loci interact to modify susceptibility. When genetic variants affect the phenotype jointly in a non-additive way, this gene-gene interaction is known as epistasis. The detection of epistatic interactions represents not only statistical, but also computational challenges [11], [12]. These can be overcome by focusing association studies on genes that a priori could play a role together, either because they are located on the same pathways, or because they are differentially expressed in thyroid tumors. The relative risk of thyroid cancer for first degree relatives of probands is higher than that for any other non-Mendelian neoplasia [13]–[15], suggesting a stronger genetic component to its etiology and therefore a possibly higher likelihood of identifying gene-gene interactions. The aim of this study was to obtain a more comprehensive view of the genetic basis of PTC by, on the one hand further assessing the implication of common variants in candidate genes, and on the other testing for epistatic two-way interactions between these variants. To this end, a two-step association approach was adopted, based on one of the largest differentiated thyroid cancer patient series described so far. It included a discovery set of 609 cases and 525 controls (series I), and two independent replication series, comprising 969 cases and 1040 controls (series II and III). We identified and replicated an interaction between variants in PAX8 and STK17B, suggesting they may be new players in thyroid cancer susceptibility. Functional assays confirmed that the expression of these genes is inversely correlated, although the underlying mechanism leading to the development of cancer has still to be elucidated.

Results

Expanded Replication Series Further Confirm the Involvement of FOXE1 in PTC Susceptibility

We further independently replicated the previously reported association with common variation in the FOXE1 gene [7]. In our second, more recently collected Spanish case-control series (series III), comprising 451 PTC cases and 540 controls, we confirmed the highly significant association for functional variant rs1867277 in the FOXE1 promoter region, under the same multiplicative model, with an OR (per allele) of 1.44 (95%CI = 1.19–1.74; P = 2.0×10−4). Overall, based on a combined total of 1358 PTC cases and 1551 controls of white European origin from Spain and Italy, a per-allele OR of 1.45 was estimated (95%CI = 1.30–1.61; P = 4.7×10−12).

Stratification of Patients Unveils Putative Subtype-specific Associations between Individual SNPs and Thyroid Cancer Risk

After genotyping cases and controls in the discovery stage, we selected 9 variants located on 9 different genes for inclusion in the replication stage. Each SNP was either the most significant tagSNP at a given locus, or was consistently predicted to be functional, as shown in Table 1.
Table 1

Association with risk of follicular cell-derived thyroid cancer for 9 candidate variants in the discovery and replication stages.

SNP (alleles)a GeneLocation, functionGroup of casesBest fitting modelDiscoveryd Replicatione
MAF in cont; casesOR (95% CI)b P c MAF in cont; casesOR (95% CI)b P c
rs16973034 (A/G) PRKAR1A intronic, tagSNPPTCdominant0.153; 0.1080.63 (0.47–0.84)1.8×10−3 0.138; 0.1331.00 (0.79–1.26)0.984
rs2703488 (T/C) KIT intronic, tagSNPPTCdominant0.488; 0.5511.43 (1.07–1.91)1.5×10−2 0.476; 0.4720.93 (0.75–1.16)0.522
rs4939827 (T/C) SMAD7 intronic, tagSNPPTCrecessive0.461; 0.4160.68 (0.50–0.94)1.9×10−2 0.438; 0.4781.32 (1.03–1.68)0.027
rs2066807 (G/C) STAT2 exonic, p.Met594IlePTCdominant0.033; 0.0541.69 (1.06–2.69)2.6×10−2 0.040; 0.0390.98 (0.68–1.42)0.928
rs2284734 (A/G) TSHR intronic, tagSNPcPTCrecessive0.290; 0.3882.64 (1.69–4.13)1.8×10−5 0.304; 0.3171.42 (0.99–2.03)0.058
rs1053266 (G/T) CCDC6 exonic, p.Pro470ThrcPTCrecessive0.494; 0.5431.37 (0.96–1.97)8.7×10−2 0.471; 0.5021.24 (0.96–1.60)0.103
rs2687834 (G/T) TG intronic, tagSNPfvPTCrecessive0.447; 0.5652.28 (1.50–3.46)1.1×10−4 0.491; 0.4770.74 (0.46–1.17)0.195
rs6179 (G/A) GHR exonic, ESEFTCdominant0.356; 0.2320.46 (0.27–0.80)5.4×10−3 0.299; 0.2860.87 (0.55–1.37)0.543
rs13099828 (C/G) PPARG intronic, tagSNPfvPTC+FTCdominant0.186; 0.2561.71 (1.22–2.38)1.6×10−3 0.168; 0.1891.01 (0.71–1.46)0.936

Abbreviations: MAF = minor allele frequency; OR = odds ratio; CI = confidence interval; ESE = Exonic Splicing Enhancers; PTC = Papillary Thyroid Carcinoma; cPTC = classic PTC; fvPTC = follicular variant of PTC; FTC = Follicular Thyroid Carcinoma. The table is sorted by disease subtype and, within each group, by P-value.

Major/minor allele (in controls);

OR and CI were obtained using homozygotes for the most frequent allele in controls as the reference group;

P-values are derived from Wald statistics;

Results adjusted for age and gender;

Results adjusted for age, gender and country.

Abbreviations: MAF = minor allele frequency; OR = odds ratio; CI = confidence interval; ESE = Exonic Splicing Enhancers; PTC = Papillary Thyroid Carcinoma; cPTC = classic PTC; fvPTC = follicular variant of PTC; FTC = Follicular Thyroid Carcinoma. The table is sorted by disease subtype and, within each group, by P-value. Major/minor allele (in controls); OR and CI were obtained using homozygotes for the most frequent allele in controls as the reference group; P-values are derived from Wald statistics; Results adjusted for age and gender; Results adjusted for age, gender and country. The most significant association in the discovery stage was obtained for SNP rs2284734 in the TSHR gene (recessive OR = 2.64; 95% CI = 1.69–4.13; P = 1.8×10−5), suggesting its involvement as a risk factor specific to the development of classic PTC. We also observed evidence of a subtype-specific effect for rs2687834 in the TG gene (recessive OR = 2.28; 95% CI = 1.50–3.46; P = 1.1×10−4), further suggesting that tumor stratification appears to be a relevant aspect to consider in association studies. This is shown graphically in Figure S1. The association of TSHR-rs2284734 with cPTC was marginally statistically significant in the replication stage (recessive OR = 1.42; P = 0.058, Table 1). The associations for remaining 8 SNPs were not replicated.

Epistatic Interaction between STK17B and PAX8 in Thyroid Cancer Susceptibility

Among all PTC cases, one interaction was consistently observed in analyses by three methods; epistasis between the SNP-pair rs721992 and rs6554198, located in the CCDC6 and KIT genes respectively, was detected by MDR, SNPHarvester and MB-MDR (Table 2). However, this interaction was not replicated in series II and III (p = 0.13).
Table 2

Table 2. Gene-gene interaction results for susceptibility to Papillary Thyroid Carcinoma overall.

SNP1GENESNP2GENEMDRSHMECPMMSHMBMDR*
rs721992 CCDC6 rs6554198 KIT <0.0001
rs11985450 ChGn rs3021526 FOXE1 0.0637
rs2395911 SLC26A4 rs1799977 MLH1 0.0002
rs16945753 MED13 rs2979033 TG 0.0045
rs8069645 STAT3 rs2979040 TG 0.0035
rs10119760 FOXE1 rs2958681 TG 0.0190
rs3111800 KIT rs4607021 ITGB2 0.0010
rs10119760 FOXE1 rs15866 STK17A 0.0084
rs6556301 FGFR4 rs6948512 SHH 0.0085
rs2958681 TG rs7350420 NCOA4 0.0298
rs1044217 STK17A rs2958681 TG 0.0114
rs12667481 SLC26A4 rs6180 GHR NA
rs440555 ITGB2 rs6180 GHR 0.0332
rs16945753 MED13 rs17202345 CCDC6 0.0735
rs1648305 DUOX1 rs3098233 CTHRC1 0.0854
rs2703488 KIT rs6018257 SRC 0.0785
rs17705719 TG rs15997 RAF1 0.1085

SH- SNPHarvester; MSH- MegaSNPHunter; light grey shading indicates interactions selected by each of the algorithms; dark grey shading indicates the interaction fulfilling the established cutoff (SNP pair selected by at least three methods);

associated P-value; NA- not available (all genotypes combinations classified as neutral).

SH- SNPHarvester; MSH- MegaSNPHunter; light grey shading indicates interactions selected by each of the algorithms; dark grey shading indicates the interaction fulfilling the established cutoff (SNP pair selected by at least three methods); associated P-value; NA- not available (all genotypes combinations classified as neutral). When only considering patients diagnosed with cPTC, one interaction was detected by four out of the five methods applied. This interaction, involving SNPs rs4848323 and rs1378624, located in the PAX8 and STK17B genes, respectively, had an associated p-value by MB-MDR of 0.00010 in the discovery stage and of 0.017 in the replication phase (Table 3, Figure 1). The corresponding p-value from the combined analysis of data from both stages was 0.00002, estimated by 100,000 permutations. This interaction was consistently observed by MB-MDR when the entire PTC case-series (including all subtypes) was considered (p-value = 0.026 and 0.045 for the discovery and replication stages, respectively).
Table 3

Gene-gene interaction results for susceptibility to classic Papillary Thyroid Carcinoma.

SNP1GENESNP2GENEMDRSHMECPMMSHMBMDR*
rs4848323 PAX8 rs1378624 STK17B <0.0001
rs3758249 FOXE1 rs1017141 TSHR NA
rs1465618 THADA rs1041457 ITGB2 0.0003
rs2979040 TG rs9912773 STAT3 0.0005
rs10755938 TG rs1706804 DUOX1 0.0632
rs2229642 ITPR3 rs4128209 THADA 0.0005
rs16945753 MED13 rs4682845 PTHR1 0.0027
rs10974947 JAK2 rs1051340 TRIP11 0.0045
rs12691874 CXCR4 rs4128209 THADA 0.0482
rs12941827 MED13 rs2411256 FGFR1 0.0011
rs3763743 CCDC6 rs2025488 CGA 0.0858
rs11985450 ChGn rs4927632 TPO 0.0789
rs17786733 TPO rs2017472 KIT 0.0016
rs1998008 TSHB rs6018257 SRC 0.0409
rs11972418 SLC26A4 rs901854 ITPR1 0.0024
rs2284735 TSHR rs27438 CSF2 0.0052
rs1568400 THRA rs2298566 SNX19 0.0033
rs180202 TG rs10940495 IL6ST 0.0974
rs2701684 SLC26A4 rs6948512 SHH 0.0083
rs1466018 PAX8 rs6554198 KIT 0.0232
rs7559891 THADA rs881301 FGFR1 0.0234
rs1799977 MLH1 rs7048394 FOXE1 0.0033
rs1624715 CCDC6 rs12949918 STAT3 0.0198
rs26279 MSH3 rs920964 CCDC6 NA
rs10146516 TSHR rs2464196 TCF1 0.049
rs11030043 RHOG rs2838738 ITGB2 0.0006
rs11903287 THADA rs7581626 STK17B NA
rs172310 SHH rs6018257 SRC NA
rs2734871 CXCR4 rs16945753 MED13 0.0284
rs2395911 SLC26A4 rs310247 JAK1 NS
rs1799977 MLH1 rs17413525 THADA 0.0017
rs11535853 TG rs4939827 SMAD7 0.0772
rs2235978 TRIP11 rs6873545 GHR 0.0551

SH- SNPHarvester; MSH- MegaSNPHunter; Light grey shading indicates interactions selected by each of the algorithms; dark grey green shading indicates the interaction fulfilling the established criteria to pass to stage 2 (replication) (SNP pair selected by at least three methods);

associated P-value; NA- not available (all genotypes combinations classified as neutral).

Figure 1

Epistatic model for SNPs in PAX8 and STK17B and genotype frequencies for cPTC-cases and controls.

Relative frequencies of the nine genotype combinations of the replicated interaction (PAX8-STK17B) are shown for cases and controls (red and blue columns, respectively). The cell containing the high-risk genotype combination is highlighted in light red, those with low-risk combinations in light blue, and those with neutral combinations are uncoloured. Figure1a - based on the discovery stage (series I); Figure 1b - based on the replication stage (series II and III); Figure 1c – based on both stages combined (series I, II and III).

Epistatic model for SNPs in PAX8 and STK17B and genotype frequencies for cPTC-cases and controls.

Relative frequencies of the nine genotype combinations of the replicated interaction (PAX8-STK17B) are shown for cases and controls (red and blue columns, respectively). The cell containing the high-risk genotype combination is highlighted in light red, those with low-risk combinations in light blue, and those with neutral combinations are uncoloured. Figure1a - based on the discovery stage (series I); Figure 1b - based on the replication stage (series II and III); Figure 1c – based on both stages combined (series I, II and III). SH- SNPHarvester; MSH- MegaSNPHunter; Light grey shading indicates interactions selected by each of the algorithms; dark grey green shading indicates the interaction fulfilling the established criteria to pass to stage 2 (replication) (SNP pair selected by at least three methods); associated P-value; NA- not available (all genotypes combinations classified as neutral). In order to gain functional insights into the PAX8-STK17B interaction, we first assessed the expression of these genes using data from a previous array-based study of 63 thyroid tumors [16] and observed an inverse correlation (r = −0.77; p = 8.65×10−14; Figure S2). We subsequently observed a consistent result in a series of thyroid cancer cell lines from different human tumors; high STK17B expression was observed in the most undifferentiated human anaplastic thyroid cells (8505c, Hth7 and Hth83), which are characterized by very low or null PAX8 levels (Figure 2).
Figure 2

STK17B and PAX8 mRNA levels in thyroid tumoral cell lines.

The mRNA expression levels of both genes were determined by qRT-PCR and are represented as relative units. The name of the cell line and its origin (follicular, papillary or anaplastic) is indicated.

STK17B and PAX8 mRNA levels in thyroid tumoral cell lines.

The mRNA expression levels of both genes were determined by qRT-PCR and are represented as relative units. The name of the cell line and its origin (follicular, papillary or anaplastic) is indicated. To explore the relationship between PAX8 and STK17B in thyroid cancer, rat thyroid cells were Pax8-silenced and the STK17B expression analyzed. After one day of transient silencing of PAX8, mRNA levels of PAX8 decreased by approximately 70% relative to the wild type or the siScamble transfected cells. However, no change was observed in the mRNA levels of STK17B. Pax8 protein levels were also lower in the silenced cells while STK17b levels remained unchanged relative to the siScamble transfected cells (Fig. 3A). To determine whether the absence of a correlation was due to the short-term nature of the silencing, a siPax8-stable cell line was generated and the protein levels assayed 7, 14 and 21 days after transfection. Again, a decrease in PAX8 levels was found without a substantial variation in STK17B levels. (Fig. 3B).
Figure 3

Relative expression levels of STK17B in Pax8-silenced cells.

PCCl3 cells were transiently (A) or stably (B) silenced for the transcription factor Pax8 (siPax8). As a control, wild type or siScramble transfected cells were used. The expression levels were assessed by means of qRT-PCR (A, upper panel) or western blot (A, lower panel, and B).

Relative expression levels of STK17B in Pax8-silenced cells.

PCCl3 cells were transiently (A) or stably (B) silenced for the transcription factor Pax8 (siPax8). As a control, wild type or siScramble transfected cells were used. The expression levels were assessed by means of qRT-PCR (A, upper panel) or western blot (A, lower panel, and B).

Discussion

Although the number of identified LPGs for follicular-cell-derived thyroid carcinoma has increased in recent years, it still lags behind that for other complex diseases. As recently reviewed, associations have been consistently replicated for only a limited number of loci [4], [6], thus a large proportion of the heritability of this multifactorial disease remains unexplained. Thyroid cancer has a strong genetic component, with the relative risk for first-degree relatives of probands being the highest among neoplasias not displaying regular Mendelian inheritance [13]–[15]. A focus on the identification of new genes through the assessment of gene-gene interaction may therefore unveil at least part of this unexplained genetic component. In recent years, the large number of susceptibility variants identified for complex diseases has given rise to the need to perform specific analyses to evaluate their potential epistatic effects. The importance of these analyses lies mainly in unveiling how the presence of one genetic variant influences the effect of another variant [17]–[19]. Such epistatic analyses, unlike those of genetic main effects, constitute a computational and statistical challenge. Many methods have been developed to detect epistasis, but all of them have limitations and their performance is variable. In addition, some of these methods are computationally unviable for GWAS data [20]. Since our study considered only 768 SNPs in genes chosen on the basis of their a priori putative role in the disease, it was possible to apply several more complex algorithms derived from complementary strategies, thus increasing the robustness of interaction detection. The use of MB-MDR in the second replication stage implied several advantages, including the possibility to test the exact epistatic model identified in the discovery stage, and the ability to adjust for potential confounders, as well as marginal SNP effects, the latter to avoid the influence on the results of SNP pairs acting in purely additive way. Furthermore, a permutation-based p-value could be readily obtained at a reasonable computational cost. The fact that we were able to replicate one of the two interactions detected in the discovery stage is testament to the reliability of our proposed pipeline. To date, a multitude of studies performed with yeast models have identified unequivocal gene-gene interactions [21]–[24]. On the contrary, attempts to identify epistatic or other kind of interactions in human disease susceptibility have only relatively recently started to yield results [25]–[29]. Nevertheless, few if any have been convincingly replicated. The present study has, for the first time, identified and independently replicated an epistatic association with cPTC susceptibility of common variants in two genes. This success is likely due not only to having a reduced list of candidate genes, but also to the high heritability of thyroid cancer, as well as the careful clinical characterization of the case series to identify disease subtypes with minimal error. Our analysis of epistasis, applied to a case-control study based on a candidate gene approach [7], has identified an interaction between PAX8 and STK17B. This and future findings of epistatic genetic associations could be the first step towards a deeper biological characterization of thyroid cancer. STK17B encodes DRAK2, a serine-threonine kinase involved in the regulation of apoptosis. It was initially selected as a candidate gene to study based on its differential expression in PTC tumors relative to normal thyroid tissue [7], [16]. PAX8 was chosen because it is a well-known thyroid transcription factor, related to thyroid differentiation, the regulation of specific genes, and to congenital diseases [30]–[33]. Interestingly, a recent study combining a genome-wide analysis of Pax8 binding sites with gene expression profiles has defined apoptosis as an important pathway under Pax8 regulation [34]. Although the functional assays performed by siRNA did not explain the underlying biological mechanism, gene expression studies based on both human tumors and cell lines have found an inverse correlation between PAX8 and STK17B. This latter finding corroborates the findings from the association study, suggesting that these two loci indeed interact to influence susceptibility to cPTC. Thus, it is tempting to speculate that PAX8 might play a role in the regulation of STK17B expression, pointing to this latter, relatively unknown gene as a new putative player in thyroid metabolism. Finally, our results for individual variants in TSHR and possibly TG, and the epistatic effect of the SNPs in PAX8 and STK17B, all apparently stronger for specific disease subtypes, stress the potential importance of tumor characterisation and stratification in association studies. The association of tagSNP rs2284734 in TSHR with risk of cPTC was the second most statistically significant (OR = 2.64; 95% CI = 1.69–4.13; P = 1.8×10−5), with consistent results observed in the replication stage (OR = 1.42; 95% CI = 0.99–2.03; P = 0.058). Several studies have suggested an association between TSHR and susceptibility of developing autoimmune pathologies of the thyroid gland [35]–[38], one of them involving the same tagSNP (rs2284734). An association with Graves’ disease has also been reported [39]. Few studies have assessed the association between TSHR and thyroid cancer risk and those that have, have reported negative results so far [40], [41]. However, previous studies have evaluated only a limited number of exonic TSHR variants. It seems premature to rule out this locus in thyroid cancer susceptibility. Fine-mapping of the region should be performed in order to identify a functional variant, possibly intronic and/or regulatory, to explain our observed association with cPTC. In summary, we propose additional genetic factors that may explain part of the unresolved heritability of thyroid cancer. In addition to identifying a potential role of TSHR variants in cPTC risk, we have detected and independently replicated for the first time an epistatic relationship between the PAX8 and STK17B genes in thyroid cancer susceptibility. This gene-gene interaction demonstrates that epistatic effects may play an important role on thyroid cancer, and could explain the lack of an observed association for each gene individually. Further studies are needed to determine whether gene-gene interactions can be useful as risk markers for follicular cell-derived thyroid cancers, as well as for other tumors.

Materials and Methods

Ethics Statement

Written informed consent was obtained from all participants in accordance protocols approved by the “Comité de bioética y bienestar animal del Instituto de Salud Carlos III” and the Ethics Committee of the COR (Regional Cancer Center), Padova, Italy, which approved this study.

Subjects

Three series of thyroid cancer cases and controls were recruited, as described below:

Discovery (series I)

We recruited 609 thyroid cancer patients from the Spanish hospital network. These included the main thyroid follicular-cell derived carcinomas: 520 PTC, represented by the main subtypes ‘classic PTC’ (cPTC; n = 304) and ‘follicular variant PTC’ (fvPTC; n = 146); and 69 follicular thyroid carcinomas (FTC). Medullary thyroid carcinomas (MTC) were not included in the study. A series of 525 cancer-free controls were recruited from the same geographical regions covered by the hospitals involved in the study. For both case and controls the mean age was 46 years and the female:male sex ratio was 4.6∶1.

Replication (series II and III combined)

A second case-control series (series II) comprised 412 PTC and 44 FTC patients recruited at three hospitals located in Italy and 500 controls from the same three geographical regions. A third, independent group of Spanish thyroid cancer patients were obtained, including 451 PTC and 62 FTC, as well as a complementary set of 540 Spanish controls (series III). Overall, the replication study comprised 969 thyroid cancer cases of white European ancestry, including 863 PTC (582 cPTC and 118 fvPTC ) and 106 FTC. Their mean age was 47 years and the female:male sex ratio was 4.4∶1. The mean age of the total 1040 controls was 53 years and the female:male sex ratio was 2.4∶1. Clinicians from all participating centers completed a detailed clinical questionnaire for each patient that included personal and clinical information, such as tumor subtype and stage, as well as details of surgery, treatment and the development of metastasis during follow-up.

DNA Isolation and Quantification

Blood or saliva samples were obtained from all cases and controls. Genomic DNA was extracted from peripheral blood lymphocytes by automated methods according to the manufacturer’s instructions (Magnapure, Roche, Madrid, Spain), or manually, using standard methods [42]. DNA was extracted from saliva using the Oragene DNA Self-Collection Kit (DNA Genotek, Ottawa, Canada). DNA concentration was quantified in all samples prior to genotyping using the Quant-iT PicoGreen dsDNA Reagent (Invitrogen, Eugene, OR, USA).

Gene and SNP Selection

Ninety-seven candidate genes were selected in a biologically oriented manner and 768 single nucleotide polymorphisms (SNPs) (Table S1) were identified therein, as previously described [7].

SNP Genotyping

SNPs were genotyped in the discovery stage using the Illumina GoldenGate® Genotyping Assay (San Diego, CA, USA) system, on a Sentrix Universal-96 Array Matrix multi-sample array format. Genotyping for the replication stage was carried out using the KASPar SNP Genotyping System (Kbiosciences, Herts, UK) as previously described [7].

Statistical Analysis

Departure from Hardy-Weinberg equilibrium (HWE) for all SNPs was tested in controls using Fisher’s exact test. SNP main effects were assessed by estimating genotype-specific odds ratios (OR) via unconditional logistic regression, using homozygotes of the most frequent allele in controls as the reference group. For each SNP, the best fitting genetic model was determined, and the corresponding p-value was calculated based on the Wald statistic. All models were adjusted for the putative confounding factors age, gender, and when relevant, country. We assessed heterogeneity in the per-allele OR by thyroid cancer subtype using a likelihood-ratio test, as previously described [43]. Statistical analyses were performed using SPSS for Windows 17.0 and STATA version 10®, unless otherwise stated.

Methods to Assess SNP-SNP Interactions

We tested for epistasis using cases from homogeneous and robustly represented disease groups, including PTC overall and cPTC. We assessed two-way interactions between SNPs using five different methods, Multifactor Dimensionality Reduction (MDR) [44], [45], Maximum Entropy Conditional Probability Modeling (MECPM) [46], SNPHarvester [47], MegaSNPHunter [48], and Model Based - Multifactor Dimensionality Reduction (MB-MDR) [49]; see Methods S1). We adjusted for sex and age in the discovery stage, where permitted by the method in question. Only interactions (SNP pairs) identified by at least three methods were selected for replication in series II and III. We used MB-MDR to test in the replication stage the epistatic model identified in the discovery stage (see Methods S1). Age, sex and country were included as covariates. MB-MDR assigns each of the nine possible combined two-SNP genotypes to three risk categories (high, low, and neutral) using logistic regression. We included age, sex and country as covariates and computed p-values based on a permutation test [44], [45]. Replication of interactions was assessed by forcing the genotype combinations into the risk categories determined in the discovery stage. Interactions with an associated p-value <0.05 were considered replicated. A similar strategy was applied to combined data from both stages for replicated interactions.

Functional Assays

Cell culture

Cell lines were kindly donated by Dr. Heldin (SW1736, Hth7 and Hth83 [50]), Dr. Fagin (WRO [51]) and Dr. Fusco and Dr. Santoro (BCPAP [52] and TPC-1 [53]), or obtained from the German Collection of Microorganism and Cells Culture (Cal62, 8505c) and the European collection of cell culture (NthyORI, FTC133). All cell lines were genetically fingerprinted and verified to be unique and of thyroid origin [54]. PCCl3 cells are a continuous line of rat thyroid follicular cells that express the thyroid-specific transcription factors Nkx2.1, Foxe1, and Pax8. They were grown in Coon’s modification of Ham’s F-12 medium, supplemented with 5% donor calf serum and a six-hormone mixture [55]. The human cell lines used were derived from normal thyroid tissue or from follicular, papillary or anaplastic thyroid carcinomas. 8505c, WRO and SW1736 cells, as well as NthyORI3.1 control cells were grown in RPMI medium, while FTC133, TPC1, BCPAP and Cal62 cells were growth in DMEM medium, and Hth7 and Hth83 cells in MEM medium. All the media were supplemented with 5% fetal bovine serum.

Generation of PCCl3-Pax8-silenced thyroid cells

The silencing of Pax8 was performed in PCCl3 cells either transiently or stably. Transient transfection was carried out using the DharmaFECT 1 siRNA transfection reagent both for scrambled and for Pax8 siRNA conditions (Dharmacon, Denver, CO). Stable short hairpin RNA (shRNA) was obtained by infection with pGIPZ lentiviral plasmid containing the interfering sequence of puromycin-resistant Pax8 or its control (scramble) (Open Biosystem, Denver, CO). Total RNA was obtained from control (wild type) and from transiently-Pax8-silenced cells (siPax8 or scrambled siRNA) using the TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s recommended protocol; semiquantitative RT-PCR was then performed as previously described [56] using specific primers for Pax8 (forward CAAGGTGGTGGAGAAGATTG and reverse GAGGTTGAATGGTTGCTG), STK17B (forward CCTGAGTTGGCTGAAATG and reverse TCTGTTGCTGTGGTAATGGG) or βactin (forward CACTCTTCCAGCCTTCCTT and reverse CTCGTCATACTCCTGCTTGCT). Validation of Pax8 silencing and STK17B expression was tested either by RT-PCR or by Western blot using a polyclonal Pax8 mouse antibody (Biopat, Milan, Italy) or a human STK17B antibody (RD System, Minneapolis, MN), respectively. βactin levels were used as loading control after immunoblotting with a specific antibody (Santa Cruz Biotechnology, CA). Subtype-specific Manhattan plot representations of the differences in allelic frequencies between cases and controls in the discovery series. Upper panel: classic PTC vs. controls; Lower panel: follicular variant of PTC vs. controls. Highlighted areas correspond to the variants of TSHR and TG, specifically associated to each of the mentioned PTC subtypes, respectively. The inserted table shows the results for the top two variants in their specific subtypes, as well as the correspondent P-values derived from the likelihood-ratio test, thus demonstrating the subtype-specificity of TSHR and TG associations. (TIF) Click here for additional data file. Unsupervised clustering for PAX8 and STK17B probes in our previously published mRNA array, including 63 thyroid tumors (Montero-Conde et al, 2008– ref. 26). A significant inverse correlation is observed (r = −0.77; p = 8.65×10−14). Abbreviations: PTC = Papillary Thyroid Carcinoma; FVPTC = follicular variant of PTC; FTC = Follicular Thyroid Carcinoma; FA = Follicular Adenoma; PDTC = Poorly Differentiated Thyroid Carcinoma; ATC = Anaplastic Thyroid Carcinoma; N = Normal Thyroid. (TIF) Click here for additional data file. Complete list of SNPs studied in the discovery series. (DOC) Click here for additional data file. Brief description of the methods used to detect epistatic interactions. (DOC) Click here for additional data file.
  53 in total

1.  A global view of epistasis.

Authors:  Jason H Moore
Journal:  Nat Genet       Date:  2005-01       Impact factor: 38.330

2.  SNPHarvester: a filtering-based approach for detecting epistatic interactions in genome-wide association studies.

Authors:  Can Yang; Zengyou He; Xiang Wan; Qiang Yang; Hong Xue; Weichuan Yu
Journal:  Bioinformatics       Date:  2008-12-19       Impact factor: 6.937

3.  Molecular epidemiology of papillary thyroid cancer: in search of common genetic associations.

Authors:  Erich M Sturgis; Guojun Li
Journal:  Thyroid       Date:  2009-10       Impact factor: 6.568

4.  Association studies in thyroid cancer susceptibility: are we on the right track?

Authors:  Iñigo Landa; Mercedes Robledo
Journal:  J Mol Endocrinol       Date:  2011-08-03       Impact factor: 5.098

5.  Epistasis analysis between homologous recombination genes in Saccharomyces cerevisiae identifies multiple repair pathways for Sgs1, Mus81-Mms4 and RNase H2.

Authors:  Miki Ii; Tatsuya Ii; Larisa I Mironova; Steven J Brill
Journal:  Mutat Res       Date:  2011-06-30       Impact factor: 2.433

6.  Molecular profiling related to poor prognosis in thyroid carcinoma. Combining gene expression data and biological information.

Authors:  C Montero-Conde; J M Martín-Campos; E Lerma; G Gimenez; J L Martínez-Guitarte; N Combalía; D Montaner; X Matías-Guiu; J Dopazo; A de Leiva; M Robledo; D Mauricio
Journal:  Oncogene       Date:  2007-09-17       Impact factor: 9.867

Review 7.  Genetic epidemiology of cancer: from families to heritable genes.

Authors:  Kari Hemminki; Rajesh Rawal; Bowang Chen; Justo Lorenzo Bermejo
Journal:  Int J Cancer       Date:  2004-10-10       Impact factor: 7.396

Review 8.  Exploring genetic interactions and networks with yeast.

Authors:  Charles Boone; Howard Bussey; Brenda J Andrews
Journal:  Nat Rev Genet       Date:  2007-06       Impact factor: 53.242

9.  Common variants on 9q22.33 and 14q13.3 predispose to thyroid cancer in European populations.

Authors:  Julius Gudmundsson; Patrick Sulem; Daniel F Gudbjartsson; Jon G Jonasson; Asgeir Sigurdsson; Jon T Bergthorsson; Huiling He; Thorarinn Blondal; Frank Geller; Margret Jakobsdottir; Droplaug N Magnusdottir; Sigurborg Matthiasdottir; Simon N Stacey; Oskar B Skarphedinsson; Hafdis Helgadottir; Wei Li; Rebecca Nagy; Esperanza Aguillo; Eduardo Faure; Enrique Prats; Berta Saez; Mariano Martinez; Gudmundur I Eyjolfsson; Unnur S Bjornsdottir; Hilma Holm; Kristleifur Kristjansson; Michael L Frigge; Hoskuldur Kristvinsson; Jeffrey R Gulcher; Thorvaldur Jonsson; Thorunn Rafnar; Hannes Hjartarsson; Jose I Mayordomo; Albert de la Chapelle; Jon Hrafnkelsson; Unnur Thorsteinsdottir; Augustine Kong; Kari Stefansson
Journal:  Nat Genet       Date:  2009-02-06       Impact factor: 38.330

10.  Risk of estrogen receptor-positive and -negative breast cancer and single-nucleotide polymorphism 2q35-rs13387042.

Authors:  Roger L Milne; Javier Benítez; Heli Nevanlinna; Tuomas Heikkinen; Kristiina Aittomäki; Carl Blomqvist; José Ignacio Arias; M Pilar Zamora; Barbara Burwinkel; Claus R Bartram; Alfons Meindl; Rita K Schmutzler; Angela Cox; Ian Brock; Graeme Elliott; Malcolm W R Reed; Melissa C Southey; Letitia Smith; Amanda B Spurdle; John L Hopper; Fergus J Couch; Janet E Olson; Xianshu Wang; Zachary Fredericksen; Peter Schürmann; Michael Bremer; Peter Hillemanns; Thilo Dörk; Peter Devilee; Christie J van Asperen; Rob A E M Tollenaar; Caroline Seynaeve; Per Hall; Kamila Czene; Jianjun Liu; Yuqing Li; Shahana Ahmed; Alison M Dunning; Melanie Maranian; Paul D P Pharoah; Georgia Chenevix-Trench; Jonathan Beesley; Natalia V Bogdanova; Natalia N Antonenkova; Iosif V Zalutsky; Hoda Anton-Culver; Argyrios Ziogas; Hiltrud Brauch; Christina Justenhoven; Yon-Dschun Ko; Susanne Haas; Peter A Fasching; Reiner Strick; Arif B Ekici; Matthias W Beckmann; Graham G Giles; Gianluca Severi; Laura Baglietto; Dallas R English; Olivia Fletcher; Nichola Johnson; Isabel dos Santos Silva; Julian Peto; Clare Turnbull; Sarah Hines; Anthony Renwick; Nazneen Rahman; Børge G Nordestgaard; Stig E Bojesen; Henrik Flyger; Daehee Kang; Keun-Young Yoo; Dong-Young Noh; Arto Mannermaa; Vesa Kataja; Veli-Matti Kosma; Montserrat García-Closas; Stephen Chanock; Jolanta Lissowska; Louise A Brinton; Jenny Chang-Claude; Shan Wang-Gohrke; Chen-Yang Shen; Hui-Chun Wang; Jyh-Cherng Yu; Sou-Tong Chen; Marina Bermisheva; Tatjana Nikolaeva; Elza Khusnutdinova; Manjeet K Humphreys; Jonathan Morrison; Radka Platte; Douglas F Easton
Journal:  J Natl Cancer Inst       Date:  2009-06-30       Impact factor: 13.506

View more
  4 in total

Review 1.  Genetic interactions effects for cancer disease identification using computational models: a review.

Authors:  R Manavalan; S Priya
Journal:  Med Biol Eng Comput       Date:  2021-04-11       Impact factor: 2.602

Review 2.  Thyroid transcription factors in development, differentiation and disease.

Authors:  Lara P Fernández; Arístides López-Márquez; Pilar Santisteban
Journal:  Nat Rev Endocrinol       Date:  2014-10-28       Impact factor: 43.330

3.  Mismatch repair single nucleotide polymorphisms and thyroid cancer susceptibility.

Authors:  Luís S Santos; Susana N Silva; Octávia M Gil; Teresa C Ferreira; Edward Limbert; José Rueff
Journal:  Oncol Lett       Date:  2018-02-21       Impact factor: 2.967

4.  Eigen-Epistasis for detecting gene-gene interactions.

Authors:  Virginie Stanislas; Cyril Dalmasso; Christophe Ambroise
Journal:  BMC Bioinformatics       Date:  2017-01-23       Impact factor: 3.169

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.