Literature DB >> 23863776

Development of 65 novel polymorphic cDNA-SSR markers in common vetch (Vicia sativa subsp. sativa) using next generation sequencing.

Jong-Wook Chung1, Tae-Sung Kim, Sundan Suresh, Sok-Young Lee, Gyu-Taek Cho.   

Abstract

Vetch (Vicia sativa L.) is one of the most important annual forage legumes in the World due to its multiple uses (i.e., hay, grain, silage and green manure) and high nutritional value. However, detrimental cyanoalanine toxins in its plant parts including seeds and its vulnerability to hard winter conditions are currently reducing the agronomic values of vetch varieties. Moreover, the existence in the public domain of very few genomic resources, especially molecular markers, has further hampered breeding efforts. Polymorphic simple sequence repeat markers from transcript sequences (cDNA; simple sequence repeat [SSR]) were developed for Vicia sativa subsp. sativa. We found 3,811 SSR loci from 31,504 individual sequence reads, and 300 primer pairs were designed and synthesized. In total, 65 primer pairs were found to be consistently scorable when 32 accessions were tested. The numbers of alleles ranged from 2 to 19, frequency of major alleles per locus were 0.27-0.87, the genotype number was 2-19, the overall polymorphism information content (PIC) values were 0.20-0.86, and the observed and expected heterozygosity values were 0.00-0.41 and 0.264-0.852, respectively. These markers provide a useful tool for assessing genetic diversity, population structure, and positional cloning, facilitating vetch breeding programs.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23863776      PMCID: PMC6270072          DOI: 10.3390/molecules18078376

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

Vicia sativa subsp. sativa, known as the common vetch, is one of the most commonly grown winter cover crops, or green manure, and is also used as pasture, silage, and hay [1,2]. It is cultivated with mixtures of cereal grains, providing cool-weather weed suppression and preventing fall N scavenging. It has been successfully applied in vineyards and orchards [1,2]. Due to its economic and ecological advantages, common vetch is now widespread through many parts of World, including the Mediterranean basin, west and central Asia, China, eastern Asia, India, and the USA [1,2,3]. The common vetch produces seeds that are quite similar to those of lentils in physical appearance and are highly nutritious [3,4,5,6,7]. However, due to the presence of cyanoalanine toxin in the seeds, which is detrimental to mono-gastric animals, including humans, the common vetch is currently tightly restricted as a feed or food source [3,4,5,6]. Moreover, its vulnerability to severe winter conditions (<−10 °C) further reduces its true agricultural potential [8,9]. Thus, to address these drawbacks, it is imperative to genetically improve this legume species either through conventional breeding or biotechnology approaches. However, a severe lack of genomic resources in the public domain has hampered such efforts. Next-generation transcriptome sequencing is an excellent solution for enriching relevant genomic resources for non-model crop species such as the common vetch, providing functional annotations as well as genetic marker information [10,11,12]. In particular, cDNA-SSR markers generated from this approach can facilitate marker-assisted selection for vetch improvement programs, because these may be associated with functionally annotated transcribed genes, are cost-effective, and are easily transferable to related species [10,11,12,13]. Recently, we sequenced transcriptomes of common vetch using 454 pyrosequencing technology, and found 3,811 SSR loci from 31,504 individuals. In the present study, we developed and characterized polymorphic cDNA-SSR markers based on these transcriptome sequences to further contribute to breeding and molecular genetic studies of this species.

2. Results and Discussion

V. sativa subsp. sativa transcriptome sequencing yielded about 28 Mb and GS De Novo yielded 86,532 raw sequencing reads, based on the GS-FLX sequencer. SSRs are one of the most popular marker systems, consisting of various numbers of tandem-repeat di-, tri-, or tetra-nucleotide DNA motifs [14]. To identify SSR markers, we used the ARGOS program with default settings for V. sativa subsp. sativa singleton collections. In total, 3,811 potential SSR motifs were identified, with the majority being trinucleotide (76.3%) and dinucleotide (14.6%) repeats. There was a low rate (9%) of all other types of SSRs (e.g., tetra-, penta-, and hexa-nucleotide motifs) and the majority of trinucleotide SSRs had the GGT/GTG//TGG motif, followed by those with the ACC/CCA/CAC motif. In addition, CT/TC, AT/TA, and GA/AG motifs were abundant among the dinucleotide cDNA-SSRs. The relative proportion of SSR motif types was comparable to that of other plant species [15,16,17,18,19,20]. Kaur et al. [18] reported in theory, the frequencies of di-, tri-, tetra-, penta-, and hexanucleotide repeats should progressively decrease, based on the relative probability of replication slippage events. However, trinucleotide repeat units were predominant, followed by tetra-, di-, hexa-, and pentanucleotide repeat units. Among the identified SSR loci, we selected 100 primer pairs on the basis of same annealing temperature, only 65 primer pairs produced single dominant polymerase chain reaction (PCR) products that were scorable for 32 accessions (Table 1 and Figure S1), The selected 65 polymorphic primer pairs sequences that were deposited in GenBank to provide a foundation for community genomic resources for vetch breeding and biotechnology research. The number of alleles (N) per locus varied widely among the markers (Table 2) and ranged from 2 to 19, with an average of 6.6 alleles. The frequency of major alleles (M) per locus was 0.27–0.87 with an average of 0.508. In addition, the H values were 0.00–0.86 with an average of 0.106, and the H values were 0.264–0.852 with an average of 0.670. Lastly, polymorphic index content (PIC) values were 0.20–0.91, with an average of 0.59 Table 2. Considering the relatively high polymorphism levels, the cDNA-SSR markers developed in the present study will be useful for marker-assisted selection and population genetic studies to improve vetch varieties.
Table 1

Chaμracteristics of the 65 cDNA-SSR markers for common vetch (Vicia sativa subsp. sativa).

MarkerPrimer sequence (5'-3')MotifGenBank Acc. No.Ta (°C)BLAST top hit Acc. No.DescriptionE-value
GBSSR-VSspS-020F: CATTTGGCTGATCCTGTCAR: GGCTTCATCATGAGACAAGAA(TAT)5KF00848655L19651.1Pisum sativum chloroplast photosystem I 24 kDa light harvesting protein (lhca3) mRNA, complete cds7e-92
GBSSR-VSspS-023F: CCTGCATTCACAACCATTTR: CGCCATCGATGTTTTGTT(CAT)5KF00848755NoneNoneNone
GBSSR-VSspS-024F: ACGGTGTTAACGGTCACGR: TCTCCAAACCGACACCAG(AGA)5KF00848855AF262939.1Pisum sativum chloroplast protein import component Toc159mRNA. complete cds1e-160
GBSSR-VSspS-028F: TGAGCCGTTGACACAACAR: GGCGATCCTCCTACTTGAA(TGC)5KF00848955NoneNoneNone
GBSSR-VSspS-037F: GAAACAAGCTGAAGGCCCR: TCAGGAAATGACCAAACCA(GAA)5KF00849055X76774.1P.sativum mRNA for HMG1 protein2e-123
GBSSR-VSspS-038F: CTCCCCAACTTGTTCCCTR: GGGAACTTGTCGATGTGG(TTC)5KF00849155BT143793Medicago truncatula clone JCVI-FLMt-3P13 unknown mRNA3e-41
GBSSR-VSspS-042F: GGTTCGAGAGCTTTGCTGR: CTGTGCCACTTGACCTCC(CGT)5KF00849255JF965421.1Medicago sativa ethylene response factor 11 (ERF11) mRNA, complete cds2e-37
GBSSR-VSspS-057F: GAGGTTTCCGGTGAGGAGR: GTTCCAGCAGGTGAAGCA(GGT)7KF00849355XM_003548374.1PREDICTED: Glycine max DEAD-box ATP-dependent RNA helicase 31-like (LOC100799999), mRNA7e-28
GBSSR-VSspS-066F: AGGAGAGGCAAGGACCAGR: CACGGCTATTTTCTTCTTTTTC(GA)10KF00849455AB078603.1Pisum sativum SN4TDR mRNA for 110kDa 4SNc-Tudor domin protein, complet cds1e-93
GBSSR-VSspS-067F: CAAACTTGTCACCACATATACAAR: GGTGGTCACTAGTGGAGGTG(CCA)5KF00849555KC218790.1Vicia faba clone NAC-VF- 218 microsatellite sequence3e-39
GBSSR-VSspS-071F: GTATTCCTCTGGTGGTGGGR: CACCACCAAGACCTCCAA(TGG)5KF00849655XM 003617084.1Medicago truncatula Heterogeneous nuclear ribonucleoprotein DO (MTR 5g088220) mRNA, complete cds9e-108
GBSSR-VSspS-073F: CCTCCCAATCCTCCATTCR: CCCTAGTCCTCCAATTTCG(GTT)5KF00849755XM_004506417.1PREDICTED: Cicer arietinum scarecrow-like protein 6-like (LOC101497219), mRNA2e-58
GBSSR-VSspS-075F: TTCAGCAAGCCCATCATTR: CGTCCGTCCAATCAACAA(TTA)6KF00849855JF768700.1Lens culinaris microsatellite LcSSR535 sequence1e-71
GBSSR-VSspS-076F: CCTGGTCCCAGAAATGGTR: AAGCCAGAGGGCATTGAT(CTG)6KF00849955XM_003602555.1Medicago truncatula NAC domin protein (MTR_3g096140) mRNA complete cds1e-136
GBSSR-VSspS-079F: AAAGCAAATTGTTAAAGAAAGGGR: GAGGATGCTGCACATATGTAGTT(AAT)5KF00850055NoneNoneNone
GBSSR-VSspS-080F: AATGCATGGATCGAGGTGR: GAATCCATCGGCAACGTA(TGG)5KF00850155XM_004510745.1PREDICTED: Cicer arietinum uncharacterized LOC 101512367 (LOC 101512367), transcript variant X3, mRNA6e-110
GBSSR-VSspS-088F: CGAAGAGGTAAATGACGCCR: AGTGACCTATATTTAGCATCGTT(TGG)5KF00850255NoneNoneNone
GBSSR-VSspS-090F: AGACGCACCACAACAGAAAR: GGGCTAGACATGGCACAA(AGC)6KF00850355BT149661.1Medicago truncatula clone JCVI-FLMt-1507 unknown mRNA7e-62
GBSSR-VSspS-091F: CCAAACCAGCAAGAGCAGR: GAGCAGCGTTGTCTCGTC(CTT)5KF00850455XM_003594377.1Medicago trancatula Endoglucanase (MTR_2g028480) mRNA complete cdse-122
GBSSR-VSspS-099F: ATCCATGCCTCTTTTGCCR: AGCCTCATTTCAGCAGCA(TCT)5KF00850555BT137674.1Medicago truncatula clone JCVIMt-1708 unknown mRNA3e-77
GBSSR-VSspS-102F: TTCAACGGAGATGGATCGR: CGTCTTCTTTCAGAGGCG(GTT)5KF00850655X59773.1Pisum sativum mRNA for P protein. a part of glycine cleavage complex0.0
GBSSR-VSspS-107F: TGGTTTCTTTCTAAAGGGGTGR: CGGCTCGATGGACAGTAG(GTT)5KF00850755BT146949.1Medicago truncatula clone JCVI-FLMt-19I1 unknowne-127
GBSSR-VSspS-115F: CATAAACAAGGGCAAGAAAAR: GAGGAAAACATTGGTGGGA(TGC)6KF00850855XM_004501895.1PREDICTED: Cicer arietinum nucleobase- ascorbate transporter 6-like (LOC101504609), transcript X2, mRNA6e-59
GBSSR-VSspS-117F: CGGTGCACTAAGTGGGAAR: TTAATGATGGTGGCGAGG(AGG)5KF00850955BT135350.1Medicago truncatula clone JCVI-FLMt-9H4 unknown mRNA2e-114
GBSSR-VSspS-118F: GCATTTCCCTTGGTCTCCR: CAGAAAGAGCAACCGTGC(TGG)5KF00851055XM_004514512.1PREDICTED: Cicer arietinum N-alpha-acetyltransferase 10-like (LOC101504041), mRNA3e-68
GBSSR-VSspS-119F: CACCACCAAGACCTCCAAR: CCATCATCATCACCAGCC(ACC)5KF00851155XM_003617084.1Medicago truncatula Heterogeneous nuclear ribonucleoprotein D0 (MTR_5g088220), complete cds9e-98
GBSSR-VSspS-125F: GGCCGGTATTCGTCAACTR: CCCCGTATTTTCTCGGTC(TGG)5KF00851255XM_004510745.1PREDICTED: Cicer arietinum uncharacterized LOC 101512367 (LOC101512367), transcript variant X3, mRNA2e-134
GBSSR-VSspS-126F: TGGCGCTTATCGCTATGTR: TCCACTCATTCCACTCGT(TG)7KF00851355XM_003623363.1Medicago truncatula Patellin-6 (TR_7G070480) mRNA, complete cds5e-81
GBSSR-VSspS-129F: AGGAGAGGCAAGGACCAGR: CTTTTTCTCTAACTCATTCATGTC(GA)10KF00851455AB0786031Pisum sativum SN4TDR mRNA for 110kDa 4SNc-Tudor domain protein, complete cds8e-117
GBSSR-VSspS-135F: TGGTGGAGATTTGTTGGGR: CTTCATCTTCCCACACCG(TGG)5KF00851555BT136030.1Medicago truncatula clone JCVI-FLMt-16L14unknown mRNA4e-40
GBSSR-VSspS-138F: CGGAGTTCACATAAAACATACTACR: TGGGAGTGTTGAGATGGG(TTA)7KF00851655AB176563.1Vicia faba MET mRNA for type 2 metallothionein, complete cds6e-98
GBSSR-VSspS-140F: TTGCTTTGATGTTTGGAGCR: CCCTAAATTCCCAACCCA(GGT)7KF00851755XM_003613856.1Medicago truncatula Cysteine-rich receptor-like protein kinase (MTR_5g042440) mRNA, complete cds3e-86
GBSSR-VSspS-156F: GGCCAATTTAGCGAGCTTR: CACTATCATCAACCTCTAACGGA(GTG)5KF00851955BT134176.1Medicago truncatula clone JCVI-FLMt-15D24 unknown mRNA2e-118
GBSSR-VSspS-158F: TGAGCTTATTGCCAGTGGAR: CCATGTCATCATCGGATTC(TGG)5KF00852055KC218603.1Vicia faba clone NAC-VF-31 microsatellite sequence7e-124
GBSSR-VSspS-162F: GAGACAGTGGAAGTATCGGCR: CACAGCAAATGCATCGGT(AAG)6KF00852155BT146412.1Medicago truncatula clone JCVI-FLMt-21014 unknown mRNA1e-75
GBSSR-VSspS-166F: GTGGCCATGATCCATTTGR: TTCCTCGAGAGGGAAAGC(TGG)5KF00852255XM_003605932.1Medicago truncatula DnaJ (MTR_4g50420) mRNA complete cds0.0
GBSSR-VSspS-172F: GCTTTGGAAGAGCCCAATR: TCCAGGATTGTAACCCCC(TGG)5KF00852355XM_003617084.1Medicago truncatula Heterogeneous nuclear ribonucleoprotein D0 (MTR_5g088220) mRNA, complete cds5e-90
GBSSR-VSspS-173F: GGGCACGGTGGTCACTAR: TGACTACCACCACCTCCG(TGG)5KF00852455AJ831469.1Pisum sativum mRNA for putative glycine rich protein precursor (grp1 gene)2e-13
GBSSR-VSspS-179F: AGCTATGCGAGAGGCTCCR: CTGTGGGAAGGCACATCT(TGA)6KF00852555NoneNoneNone
GBSSR-VSspS-181F: CACTGTGACTCAGTTTCGTTGR: CGATTTTGAACCCTAACCG(TTC)5KF00852655NoneNoneNone
GBSSR-VSspS-182F: GCGTTGTGGCGTATTTCTR: TGGAGGAAAGGAAACTACTCA(GCA)6KF00852755AB676029.1Lathyrus japonicas DNA, 61 locus, haplotype: D4e-62
GBSSR-VSspS-185F: CTCCTCAATTTTCCCCCAR: TTTGGTGCGATTGTTTCC(CAT)5KF00852855Ap009676.1Lotus japonicas genomic DNA, clone: LjT30I08, TM04924e-26
GBSSR-VSspS-187F: CCAGGTTGCTTTCCTTACTTTR: TTAGCCCTCAAAGCCTCC(ATC)5KF00852955X54359.1P.sativum mRNA of cDNA clone 26g2e-154
GBSSR-VSspS-192F: AGGGTCTTCCTTCCCACAR: TATGGTGACACGTTCGCA(ATC)5KF00853055XM_004505980.1PREDICTED: Cicer arietinum uncharacterized LOC101500025 (LOC101500025), transcript variant X2, mRNA1e-100
GBSSR-VSspS-203F: TCCATCTGGTTGGTGGTGR: GAAAGCCAATTTTTCAGCAA(GTT)7KF00853155BT147294.1Medicago truncatula clone JCVI-FLMt-15A20 unknown mRNA2e-50
GBSSR-VSspS-217F: CCATCGCCACCACCAR: TCCCGGAACAAAAATCAA(AAC)7KF00853255EF447278.1Pisum sativum cultivar Finale SYM8 (SYM8) gene, partial cds5e-58
GBSSR-VSspS-245F: CAATAGGGGGACCCTTCAR: GCTGCAAGCTGCTACCAT(GGA)5KF00853355HQ439603.1Phalaenopsis hybrid cultivar candidate developmental transcription factor TCP1 mRNA, partial cds5e-04
GBSSR-VSspS-247F: GGTTCAATACGATCCATAGAATAR: TGATCGCCAATTCTGGAC(CAC)6KF00853455KC294548.1Aeschynomene ciliate voucher IRRI 13078 cyclophilin 1 (CYP1) gene, complete cds3e-46
GBSSR-VSspS-249F: AAAACATGGTTGAGTGTTTTTGR: TAACCCTCTCGGTTTCGG(ATA)5KF00853555KC218749.1Vicia faba clone NAC-VF-177 microsatellite sequence 2e-55
GBSSR-VSspS-251F: TGGTGGACGTCACTATGGAR: CATGGTGCTTCCGACAAT(TGG)5KF008536 *55KC218790.1Vicia faba clone NAC-VF-218 microsatellite sequence 5e-30
GBSSR-VSspS-252F: CATGGTGCTTCCGACAATR: TCGAAATCAGGACTTACCACA(CCA)5KF008536 *55KC218790.1Vicia faba clone NAC-VF-218 microsatellite sequence 5e-30
GBSSR-VSspS-262F: ATTGGGCCCTCTTTTTGAR: GGGGGTAGAAAAGTTGCG(AT)7KF00853755XM_004500781.1PREDICTED: Cicer arietinum dolichyl- diphoshooligosaccharide-protein glycosyltransferase subunit 1A-like (LOC101502563), mRNA1e-37
GBSSR-VSspS-268F: AAATTTGTCTGACGAAAAACGR: TGCTTGAGAGTGCCATCA(TAC)5KF00853855BT144509.1Medicago truncatula clone JCVI-FLMt-13M6 unknown mRNA2e-47
GBSSR-VSspS-269F: TTCCATTTATCCTCCTATCCTCTR: CTTGAATGCGAAACGAGG(CGC)5KF00853955XM_004507695.1PREDICTED: Cicer arietinum eukaryotic translation initiation factorisoform 4G-1-like (LOC101492356), mRNA1e-56
GBSSR-VSspS-284F: TGGAAGGAAATGGCAGTGR: ATCCGTTTCGGATTGGTT(GCA)5KF00854055JX539287.1Vigna radiata cultivar MCV-1 clone GGSSR_911 microsatellit sequence2e-120
GBSSR-VSspS-291F: CCCAACCGAACCACTTATTR: TAATAGCTCCGGCCCAGT(CTA)5KF00854155NoneNoneNone
GBSSR-VSspS-301F: AACCAAACAACAATGGGTTR: TCAACCGGTGAAAGATGG(CAA)5KF00854255JN849865.1Medicago falcata voucher PI494662A caffeic acid-O- methyltransferase (COMT) gene.exon 1 and partial cds2e-128
GBSSR-VSspS-304F: CCGTTCTACGCAATTCTCCR: CGACCAAGAACACCAGGA(TTC)5KF00854355XM_003593951.1Medicago truncatula hypothetical protein (MTR_2g020190) mRNA,complete cds1e-55
GBSSR-VSspS-305F: CATGAAAGAGTTTTGCACCTTR: CCGACGACGAGATTGAGA(GCA)5KF00854455NoneNoneNone
GBSSR-VSspS-308F: TGAGAGCATAGACAGCAAACAR: TGGATTTGGTCGCATAGC(AAC)5KF00854555NoneNoneNone
GBSSR-VSspS-309F: TCTTCAAAAGAGTACAAAAGGGAR: GAATTGGACACCTTGGCA(AAT)5KF00854655BT137399.1Medicago truncatula clone JCVI-FlMt-19L22 unknown mRNA5e-124
GBSSR-VSspS-310F: GGGTGCCCTAGCATTTGTR: ATCTCCGGCGTCAGTTTC(CTC)6KF00854755M69105.1Pisum sativum outer membrane protein (OM14) mRNA, complete cds9e-96
GBSSR-VSspS-311F: TTGAGGCGGTGTTGGTAGR: ATGTCATGGCCAACTGCT(GGA)6KF00854855NoneNoneNone
GBSSR-VSspS-313F: GAACAATGCAGCCTGGAAR: GCTGCAATCGCATTCTCT(TTG)5KF00854955XM_003613196.1Medicago truncatula U-box domin containing protein (MTR_5g034440) mRNA, complete cds2e-112

TA, annealing temperature. * same sequence two primers identified.

Table 2

Diversity statistics from initial primer screening in 32 accessions of common vetch (Vicia sativa subsp. sativa).

Marker NA MAF HO HE PIC
GBSSR-VSspS-02040.630.000.510.43
GBSSR-VSspS-02370.340.000.750.71
GBSSR-VSspS-02470.470.000.710.67
GBSSR-VSspS-02840.380.000.730.68
GBSSR-VSspS-03740.380.000.710.65
GBSSR-VSspS-03870.280.000.790.76
GBSSR-VSspS-04220.840.000.260.23
GBSSR-VSspS-05780.360.030.770.74
GBSSR-VSspS-06670.250.000.830.81
GBSSR-VSspS-06760.500.000.670.62
GBSSR-VSspS-07130.500.000.620.54
GBSSR-VSspS-07380.310.000.810.79
GBSSR-VSspS-07560.380.030.760.72
GBSSR-VSspS-07630.560.000.570.50
GBSSR-VSspS-07960.550.000.640.60
GBSSR-VSspS-08030.500.000.590.51
GBSSR-VSspS-08850.380.000.740.70
GBSSR-VSspS-09070.410.000.750.71
GBSSR-VSspS-09140.470.000.680.64
GBSSR-VSspS-09940.560.000.600.54
GBSSR-VSspS-10280.440.030.750.73
GBSSR-VSspS-10730.660.000.510.45
GBSSR-VSspS-11540.480.030.540.44
GBSSR-VSspS-11760.410.000.710.67
GBSSR-VSspS-11830.530.000.610.54
GBSSR-VSspS-11920.650.000.460.35
GBSSR-VSspS-12530.410.000.630.56
GBSSR-VSspS-12670.250.000.820.79
GBSSR-VSspS-12970.250.000.810.79
GBSSR-VSspS-13550.500.000.620.55
GBSSR-VSspS-138110.320.060.830.81
GBSSR-VSspS-14080.220.030.810.79
GBSSR-VSspS-15150.670.030.520.48
GBSSR-VSspS-15650.660.000.530.50
GBSSR-VSspS-15850.590.000.570.52
GBSSR-VSspS-16260.530.000.660.63
GBSSR-VSspS-16660.380.000.740.70
GBSSR-VSspS-17230.410.000.650.57
GBSSR-VSspS-17340.580.000.580.53
GBSSR-VSspS-17980.560.030.640.61
GBSSR-VSspS-181110.280.000.850.84
GBSSR-VSspS-18270.380.000.760.73
GBSSR-VSspS-185100.310.030.820.80
GBSSR-VSspS-18750.440.000.690.64
GBSSR-VSspS-19230.630.000.510.43
GBSSR-VSspS-20360.340.000.760.72
GBSSR-VSspS-217110.280.000.830.81
GBSSR-VSspS-24570.280.000.810.78
GBSSR-VSspS-24760.690.030.490.46
GBSSR-VSspS-24960.560.000.640.61
GBSSR-VSspS-25150.450.000.700.66
GBSSR-VSspS-25230.500.000.610.53
GBSSR-VSspS-26290.470.000.720.70
GBSSR-VSspS-26830.470.000.640.57
GBSSR-VSspS-26940.500.000.580.49
GBSSR-VSspS-28460.440.000.660.60
GBSSR-VSspS-29150.530.000.640.59
GBSSR-VSspS-30130.530.000.580.50
GBSSR-VSspS-30470.460.000.680.63
GBSSR-VSspS-30530.690.000.480.43
GBSSR-VSspS-30860.540.000.660.63
GBSSR-VSspS-30980.340.000.780.75
GBSSR-VSspS-31080.380.030.750.71
GBSSR-VSspS-31170.440.000.730.70
GBSSR-VSspS-31350.440.000.710.67
Mean5.70.4600.0060.6700.624

NA, number of alleles; MAF, major allele frequency; HO, observed heterozygosity; HE, expected heterozygosity; PIC, polymorphic information content.

The dendrogram showed that the 32 common vetch accessions fell into five distinct clusters (Figure 1). Cluster 1 comprised accessions from South west Europe, West Asia and Central Europe each regions had 2 accessions. Cluster 2contained 3 accessions one from Eurasian, one from middle East Asia and one from North Africa. Cluster 3 contained eight accessions, five accessions from Central Europe and remaining accessions from South East Europe, north Europe and West Europe each region had one accessions. Cluster 4 contained six accessions, two accessions from South East Europe and one accession from each geographical region (Central Europe, South West Europe, Europe and North West Europe). Cluster 5 included nine accessions, two accessions from central Europe and two accessions from Europe regions, with rest of the accessions from East Asia, West Europe, South West Europe, Central and South East Europe and West General Europe, North Europe and West Europe each having one accession.
Figure 1

Dendrogram generated using UPGMA cluster analysis based on genetic diversity of 32 common vetch (Vicia sativa subsp. sativa) accessions.

Dongi et al [21] reported cluster analysis of Trigonella foenumgraecum there was no clear clustering pattern of geographically closer accessions indicating that the association between genetic similarity and geographical distance was less significant. However, it is necessary to use more number of accessions from each geographical location to confirm the available pattern. Chaμracteristics of the 65 cDNA-SSR markers for common vetch (Vicia sativa subsp. sativa). TA, annealing temperature. * same sequence two primers identified. Diversity statistics from initial primer screening in 32 accessions of common vetch (Vicia sativa subsp. sativa). NA, number of alleles; MAF, major allele frequency; HO, observed heterozygosity; HE, expected heterozygosity; PIC, polymorphic information content. Dendrogram generated using UPGMA cluster analysis based on genetic diversity of 32 common vetch (Vicia sativa subsp. sativa) accessions.

3. Experimental

3.1. Plant Material

Vicia sativa sativa seeds were selected from the National Agrobiodiversity Center, Rural Development Administration, Suwon, Korea (Table 3). Seedlings were germinated and grown in a glasshouse. The leaves of young seedlings were used to extract the mRNA required to synthesize the cDNA library and for 454 sequencing.
Table 3

List of common vetch (Vicia sativa subsp. sativa) accessions.

No.Temp. IDUSDA-ARS No.Country of originGeographical region of origin
1K193581PI 226487IranWest Asia
2K193582PI 284058Czech RepublicCentral Europe
3K193583PI 284068GermanyWestern Central Europe
4K193584PI 284078GreeceSouth East Europe
5K193585PI 284402CyprusEurope
6K193586PI 284409CyprusEurope
7K193587PI 284470Czech RepublicCentral Europe
8K193588PI 284471HungaryCentral Europe
9K193589PI 308111SlovakiaCentral Europe
10K193590PI 308118SlovakiaCentral Europe
11K193591PI 325513Soviet UnionEurasian
12K193592PI 381065IranWest Asia
13K193593PI 393870PolandCentral Europe
14K193594PI 393871RomaniaCentral and South East Europe
15K193595PI 393872Czech RepublicCentral Europe
16K193596PI 393873Czech RepublicCentral Europe
17K193597PI 393877NetherlandsNorth West Europe
18K193598PI 393878FranceWest Europe
19K193599PI 393891BulgariaSouth East Europe
20K193600PI 393904BelgiumWest Europe
21K193601PI 393907FinlandNorth Europe
22K193602PI 393909IsraelMiddle East Asia
23K193603PI 393910United KingdomEurope
24K193604PI 393912PortugalSouth West Europe
25K193605PI 493307PortugalSouth West Europe
26K193606PI 517191MoroccoNorth Africa
27K193607PI 533741SpainSouth West Europe
28K193608PI 533743SpainSouth West Europe
29K193609PI 557498TurkeySouth East Europe
30K193610PI 577751ChinaEast Asia
31K193611PI 628288UzbekistanCentral Europe
32K193612PI 664293TajikistanCentral Europe

(Temp ID), Korean GeneBank ID; (ARS No.), USDA-ARS Number.

List of common vetch (Vicia sativa subsp. sativa) accessions. (Temp ID), Korean GeneBank ID; (ARS No.), USDA-ARS Number.

3.2. cDNA Preparation

Total RNA was extracted from Vicia sativa subsp. sativa leaves that were frozen in liquid nitrogen, ground into a powder, and then extracted using an RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. The integrity of total RNA was determined using a BIOSPEC-NANO spectrophotometer (Shimadzu, Kyoto, Japan) and agarose gel electrophoresis. mRNA was purified using the PolyATract mRNA Isolation System IV (Promega, Madison, WI, USA), and the purified products were used to synthesize full-length cDNAs using a ZAP-cDNA Synthesis kit (Stratagene, Santa Clara, CA, USA). Finally, cDNA was fragmented by nebulization for library construction.

3.3. Library Preparation

Approximately 1 µg cDNA was used to generate a DNA library to use with the Genome Sequencer GS-FLX Titanium System (Roche, 454 Life Science, Branford, CT, USA). The cDNA fragment ends were polished (blunted), and two short adapters were ligated to both ends according to standard procedures described previously. The adapters, along with the sequencing key, a short sequence of four nucleotides used by the system’s software for base calling, provided priming of the sequences for both the amplification and sequencing of the sample library fragments. Following the repair of any nicks in the double-stranded library, the unbound strand of each fragment was released (with 5-Adaptor A). Finally, the quality of this single-stranded template DNA library was assessed using a 2100 BioAnalyzer (Agilent, Waldbronn, Germany). The library was quantified to determine the optimal amount needed as input for emulsion-based clonal amplification.

3.4. 454 Pyrosequencing

Single effective copies of template species from the DNA library to be sequenced were hybridized to DNA capture beads. Then the immobilized library was resuspended in an amplification solution, and the mixture was emulsified, followed by PCR amplification. The DNA-carrying beads were recovered from the emulsion and enriched after amplification. The second strands of the amplified products were melted, leaving the amplified single-stranded DNA library bound to the beads. Then the sequencing primer was annealed to the immobilized amplified DNA templates. After amplification, a single DNA-carrying bead was placed into each well of a PicoTiterPlate (PTP) device. Simultaneous sequencing with multiple samples on a single PTP (four-region gasket) was used. Then the PTP was inserted into the FLX Genome Titanium sequencer for pyrosequencing [22,23], and sequencing reagent was flowed sequentially over the plate. Information from the PTP wells was captured simultaneously by a camera, and the images were processed in real-time by an onboard computer. Multiplex identifiers were used to specifically tag unique samples in a GS FLX Titanium sequencing run, which were recognized by the GS data analysis software after the sequencing run and provided high confidence for assigning individual sequencing reads to the correct sample. Sequence assembly was performed after sequencing using GS De Novo Assembler software (Roche) to produce contigs and singletons. All sequence data were conformed to references using GS Reference Mapper software (Roche).

3.5.Discovery of cDNA-SSR Markers

All contigs and singletons from both transcriptomes were used to mine SSR motifs, and SSR motifs were identified using the ARGOS pipeline program (version 1.46) at the default settings to survey the molecular markers present in the V. sativa subsp. sativa accessions. Parameters were designed for identifying perfect di-, tri-, tetra-, penta-, and hexa-nucleotide motifs with a minimum of six repeats. The primer design parameters were set as follows: length range, 18–23 nucleotides with 21 as optimum; PCR product size range, 100–400 bp; optimum annealing temperature, 55 °C; and GC content 40–60%, with 50% as optimum. Vicia sativa subsp. sativa genomic DNA was extracted from 32 diverse common vetch accessions for cDNA-SSR marker validation using a DNeasy® Plant Mini kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. Fresh leaf tissue from each accession was used for each extraction and ground well using liquid nitrogen. DNA was resuspended in 100 μL water, and dilutions were made to 10 ng/μL followed by storage at either −20 °C or −80 °C. Randomly selected cDNA-SSR primer pairs were validated experimentally, and forward primers were synthesized by adding the M13 sequence to enable the addition of a fluorescent tail through the PCR amplification process [24]. PCR conditions included a hot-start at 95 °C for 10 min, followed by 10 cycles at 94 °C for 30 s, 60–50 °C for 30 s and 72 °C for 30 s, followed by 25 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s, with a final elongation step of 72 °C for 10 min. PCR products were separated and visualized using the QIAxcel Gel Electrophoresis System (Qiagen).

3.6. Data Analysis

The amplified SSR loci were scored for 32 accessions. The total number of alleles (NA), major allele frequency (allele with the highest frequency) (M), observed heterozygosity (counting heterozygocity) (H), expected heterozygosity (H), number of genotypes (N), and polymorphic information content (PIC) were calculated using PowerMarker and GenAlEx (version 6.5) [25]. The expected heterozygosity formula is as follows: A closely related diversity measure is the polymorphism information content (PIC) [26]: The cluster analysis of 32 accessions was carried out based onunweighted pair group method with arithmetic mean (UPGMA ) phylogenetic and uprooted tree construction, based on the “CS chord 1967” distance method [27] in powermarker

4. Conclusions

We developed 65 cDNA-SSR markers, which were used successfully to investigate the genetic diversity among 32 accessions of Vicia stiva subsp. sativa. Considering the relatively high PIC values (0.59 in average), cDNA-SSR in Vicia sativa subsp. sativa is suggested to be an informative genetic marker system, which can also be applied to population genetic studies and marker-assisted selection to mine and accumulate useful alleles to increase the agronomic potential of vetch varieties.
  8 in total

1.  Genome-Wide Identification and Development of LTR Retrotransposon-Based Molecular Markers for the Melilotus Genus.

Authors:  Zifeng Ouyang; Yimeng Wang; Tiantian Ma; Gisele Kanzana; Fan Wu; Jiyu Zhang
Journal:  Plants (Basel)       Date:  2021-04-28

2.  Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing.

Authors:  Qiang Zhou; Dong Luo; Lichao Ma; Wengang Xie; Yu Wang; Yanrong Wang; Zhipeng Liu
Journal:  Sci Rep       Date:  2016-02-08       Impact factor: 4.379

3.  Ecogeographic variability and genetic diversity associated with seed albumins, globulins and prolamins patterns in Vicia taxa from Algeria.

Authors:  Sakina Bechkri; Imane Medoukali; Douadi Khelifi
Journal:  Bot Stud       Date:  2017-06-21       Impact factor: 2.787

4.  Transcriptome Analyses Reveal Candidate Pod Shattering-Associated Genes Involved in the Pod Ventral Sutures of Common Vetch (Vicia sativa L.).

Authors:  Rui Dong; Deke Dong; Dong Luo; Qiang Zhou; Xutian Chai; Jiyu Zhang; Wengang Xie; Wenxian Liu; Yang Dong; Yanrong Wang; Zhipeng Liu
Journal:  Front Plant Sci       Date:  2017-04-27       Impact factor: 5.753

Review 5.  Mining and Development of Novel SSR Markers Using Next Generation Sequencing (NGS) Data in Plants.

Authors:  Sima Taheri; Thohirah Lee Abdullah; Mohd Rafii Yusop; Mohamed Musa Hanafi; Mahbod Sahebi; Parisa Azizi; Redmond Ramin Shamshiri
Journal:  Molecules       Date:  2018-02-13       Impact factor: 4.411

6.  Optimizing Sample Size to Assess the Genetic Diversity in Common Vetch (Vicia sativa L.) Populations Using Start Codon Targeted (SCoT) Markers.

Authors:  Xutian Chai; Rui Dong; Wenxian Liu; Yanrong Wang; Zhipeng Liu
Journal:  Molecules       Date:  2017-03-31       Impact factor: 4.411

7.  Transcriptome Analysis of Two Vicia sativa Subspecies: Mining Molecular Markers to Enhance Genomic Resources for Vetch Improvement.

Authors:  Tae-Sung Kim; Sebastin Raveendar; Sundan Suresh; Gi-An Lee; Jung-Ro Lee; Joon-Hyeong Cho; Sok-Young Lee; Kyung-Ho Ma; Gyu-Taek Cho; Jong-Wook Chung
Journal:  Genes (Basel)       Date:  2015-11-02       Impact factor: 4.096

8.  Cross-species transferability of EST-SSR markers developed from the transcriptome of Melilotus and their application to population genetics research.

Authors:  Zhuanzhuan Yan; Fan Wu; Kai Luo; Yufeng Zhao; Qi Yan; Yufei Zhang; Yanrong Wang; Jiyu Zhang
Journal:  Sci Rep       Date:  2017-12-20       Impact factor: 4.379

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.