Literature DB >> 23457627

Role of bacterial surface structures on the interaction of Klebsiella pneumoniae with phagocytes.

Catalina March1, Victoria Cano, David Moranta, Enrique Llobet, Camino Pérez-Gutiérrez, Juan M Tomás, Teresa Suárez, Junkal Garmendia, José A Bengoechea.   

Abstract

Phagocytosis is a key process of the immune system. The human pathogen Klebsiella pneumoniae is a well known example of a pathogen highly resistant to phagocytosis. A wealth of evidence demonstrates that the capsule polysaccharide (CPS) plays a crucial role in resistance to phagocytosis. The amoeba Dictyostelium discoideum shares with mammalian macrophages the ability to phagocytose and kill bacteria. The fact that K. pneumoniae is ubiquitous in nature and, therefore, should avoid predation by amoebae, poses the question whether K. pneumoniae employs similar means to counteract amoebae and mammalian phagocytes. Here we developed an assay to evaluate K. pneumoniae-D. discoideum interaction. The richness of the growth medium affected the threshold at which the cps mutant was permissive for Dictyostelium and only at lower nutrient concentrations the cps mutant was susceptible to predation by amoebae. Given the critical role of bacterial surface elements on host-pathogen interactions, we explored the possible contribution of the lipopolysaccharide (LPS) and outer membrane proteins (OMPs) to combat phagoyctosis by D. discoideum. We uncover that, in addition to the CPS, the LPS O-polysaccharide and the first core sugar participate in Klebsiella resistance to predation by D. discoideum. K. pneumoniae LPS lipid A decorations are also necessary to avoid predation by amoebae although PagP-dependent palmitoylation plays a more important role than the lipid A modification with aminoarabinose. Mutants lacking OMPs OmpA or OmpK36 were also permissive for D. discoideium growth. Except the LPS O-polysaccharide mutants, all mutants were more susceptible to phagocytosis by mouse alveolar macrophages. Finally, we found a correlation between virulence, using the pneumonia mouse model, and resistance to phagocytosis. Altogether, this work reveals novel K. pneumoniae determinants involved in resistance to phagocytosis and supports the notion that Dictyostelium amoebae might be useful as host model to measure K. pneumoniae virulence and not only phagocytosis.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23457627      PMCID: PMC3574025          DOI: 10.1371/journal.pone.0056847

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Phagocytosis is the process by which particles are recognized, bound to the surface of cells and internalized into a plasma membrane-derived intracellular vacuole, or phagosome. In mammals, phagocytosis is a special feature of the so-called professional phagocytes, i.e. polymorphonuclear leukocytes (also known as neutrophils), dendritic cells, monocytes and macrophages. When a microorganism enters the sterile sections of the body, professional phagocytes are chemotactically attracted, bind the microorganism, ingest and kill it. In the case of macrophages and dendritic cells, the invader's antigenic molecules are presented to other immune cells hence initiating adaptive immune responses. The social amoeba Dictyostelium discoideum lives in soil, where it feeds on both Gram-negative and positive bacteria [1]. Typically, upon starvation, Dictyostelium cells initiate a multicellular development stage leading to the formation of a fruit body. However, there are D. discoideum axenic strains that can feed not only by phagocytosis but also by macropynocytosis of liquid nutrients [2]. Of special interest is the fact that Dictyostelium cytoskeleton architecture is similar to that found in mammalian cells. Furthermore, the process of particle uptake in Dictyostelium is similar to macrophage phagocytosis [1]. The fact that the strategies evolved to counteract mammalian professional phagocytes are considered essential to establish an infection has led to the notion that Dictyostelium amoebae could be used as host model to measure virulence [3], [4]. The similarities between Dictyostelium and mammalian cells also extent to membrane trafficking, endocytic transport and sorting events [1]. There are genetic tools available to manipulate D. discoideum cells thereby facilitating the study of cellular mechanisms at the molecular level. Moreover, the genome of D. discoideum strain AX4 has been sequenced [5]. Klebsiella pneumoniae is a Gram negative pathogen common cause of nosocomial infections that include urinary tract, respiratory, and wound infections [6]. K. pneumoniae isolates are frequently resistant to multiple antibiotics [7], which leads to a therapeutic dilemma. In contrast to many bacterial pathogens, K. pneumoniae is ubiquitous in nature. The non-clinical habitats include the mucosal surfaces of animals and environmental sources such as vegetation, soil and surface waters [8]. Notably, it has been shown that environmental Klebsiella isolates are nearly identical to clinical ones with respect to the expression of virulence factors and ability to infect animal models [9]. The factors mediating Klebsiella survival in the environment are poorly characterized but predominance in the environment is likely to correlate with the ability of Klebsiella to avoid predation by protozoa, including amoebae. Macrophages and neutrophils play a critical role in the clearance of bacteria from the lung and other organs by their capacity for phagocytosis and killing. In this regard, it has been shown that depletion of either neutrophils or alveolar macrophages results in reduced killing of K. pneumoniae in vivo [10], [11]. Conversely, this suggests that Klebsiella countermeasures against phagocytosis should be important virulence factors. Supporting this notion, K. pneumoniae capsule (CPS) reduces phagocytosis by neutrophils and macrophages [12]–[14] and CPS mutant strains are avirulent being not able to cause pneumonia and urinary tract infections [13], [15], [16]. Notably, CPS is also important to prevent phagocytosis by D. discoideum [17]–[19]. Therefore, a tantalizing hypothesis could be that K. pneumoniae may employ the same determinants for resistance to phagocytosis by neutrohils, macrophages and amoebae. Moreover, given the critical role of bacterial surface elements on host-pathogen interactions, we speculated that the lipopolysaccharide (LPS) and outer membrane proteins (OMPs), major components of the outer membrane (OM) of Gram negative bacteria, could be also involved in the resistance to phagocytosis by K. pneumoniae. LPS consists of a hydrophobic membrane anchor, lipid A, substituted with an oligosaccharide core region that can be extended in some bacteria, including Klebsiella, by a repeating oligosaccharide, the O-polysaccharide (OPS). The LPS contains a molecular pattern recognized by the innate immune system thereby arousing several host defence responses. The lipid A could be decorated with aminoarabinose, palmitate or phosphoethanolamine [20]. Several studies have demonstrated that these modifications are involved in the resistance to antimicrobial peptides, key weapons of the innate immune system against infections [21]–[25]. In a recent study we have shown that K. pneumoniae lipid A is decorated with palmitate and aminoarabinose which contribute to K. pneumoniae resistance to antimicrobial peptides [26]. OMPs are important for membrane integrity and transport of molecules across (for a review see [27]). OmpA is one of the best characterized OM protein and data support the notion that plays an important role in the interaction of bacteria with the innate immune system (for a review see [28]). OmpA and OmpK36 are the most abundant OMPs on K. pneumoniae OM [29]. Mounting evidence indicates that K. pneumoniae OmpA is important for immune evasion in vitro and in vivo [30], [31]. In this study, we report that K. pneumoniae employs the same determinants to counteract phagocytosis by D. discoideum and alveolar macrophages, the resident defenders of the lung against infections. We uncover that the LPS OPS, the first LPS core sugar, the lipid A decorations with palmitate and aminoarabinose, and the OMPs OmpA and OmpK36 contribute to the resistance to phagoyctosis by D. discoideum and alveolar macrophages. Finally, we report a correlation between virulence, using the pneumonia mouse model, and resistance to phagocytosis.

Materials and Methods

Ethics statement

Mice were treated in accordance with the European Convention for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes (Directive 86/609/EEC) and in agreement with the Bioethical Committee of the University of the Balearic Islands. This study was approved by the Bioethical Committee of the University of the Balearic Islands with the authorisation number 1748.

Bacterial strains and growth conditions

Bacterial strains and plasmids used in this study are listed in Table 1. Strains were grown in lysogeny broth (LB) at 37°C on an orbital shaker (180 rpm). When appropriate, antibiotics were added to the growth medium at the following concentrations: rifampicin (Rif) 25 µg/ml, ampicillin (Amp), 100 µg/ml for K. pneumoniae and 50 µg/ml for E. coli; kanamycin (Km) 100 µg/ml; chloramphenicol (Cm) 12.5 µg/ml.
Table 1

Strains and plasmids used in this study.

Bacterial strains and plasmidsGenotype or commentsSource or references
Strains
Escherichia coli
C600 Thi, thr, leuB, tonA, lacY, supE [61]
CC118-λpirΔ(ara-leu)7697 araD139 ΔlacX74 galE galK ΔphoA20 thi-1 rpsE rrpoB argE(Am) recA1
Klebsiella pneumoniae
Kp52145clinical isolate (serotype O1:K2), RifR [13], [62]
52145-ΔwcaK2 Kp52145, ΔwcaK2; the wcaK2 gene inactivated, no CPS expression; RifR [63]
52145-ΔpmrF Kp52145, ΔpmrF; the pmrF gene inactivated; nonpolar mutant; RifR [26]
52145-ΔpagPGBKp52145, ΔpagP::Km-GenBlock; the pagP gene inactivated; nonpolar mutant; RifR, KmR [26]
52145-ΔwcaK2pmrF 52145-ΔwcaK2, ΔpmrF; the pmrF gene inactivated in CPS mutant background; RifR, KmR [26]
52145-ΔwcaK2pagPGB52145-ΔwcaK2, ΔpagP::Km-GenBlock; the pagP gene inactivated in CPS mutant background; RifR, KmR [26]
52145-ΔpagPGB-ΔpmrF 52145-ΔpagPGB, ΔpmrF; the pmrF gene inactivated in pagP mutant background; RifR, KmR This work
52145-ΔwcaK2pagPGB-ΔpmrF 52145-ΔwcaK2pagPGB, ΔpmrF; the pmrF gene inactivated in cps-pagP mutant background; RifR, KmR This work
52OmpA2Kp52145, ompA gene inactivated by insertion of pKNOCKIntKpnOmpA; RifR, CmR [30]
52145-Δwca K2-ompA 52145-ΔwcaK2; ompA gene inactivated by insertion of pKNOCKIntKpnOmpA; RifR, CmR [30]
52OmpA2ComKp52145 ompA mutant harbouring mini-Tn7TKmKpnOmpA; OmpA levels restored; RifR, CmR, KmR [30]
52145- Δwca K2-ompACom52145-ΔwcaK2 ompA mutant harbouring mini-Tn7TKmKpnOmpA; OmpA levels restored; RifR, CmR, KmR [30]
52OmpK36Kp52145, ompK36 gene inactivated by insertion of pKNOCKIntKpnOmpK36; RifR, CmR [30]
52145-Δwca K2-ompK36 52145-ΔwcaK2; ompA gene inactivated by insertion of pKNOCKIntKpnOmpA; RifR, CmR This work
52OmpK36ComKp52145 ompK36 mutant harbouring mini-Tn7TKmKpnOmpK36; OmpK36 levels restored; RifR, CmR, KmR This work
52145-Δwca K2-ompK36Com52145-ΔwcaK2 ompK36 mutant harbouring mini-Tn7TKmKpnOmpK36; OmpK36 levels restored; RifR, CmR, KmR This work
52O21Kp52145, wbbM gene inactivated; RifR, KmR [13]
52145-ΔwaaL Kp52145; ΔwaaL; the waaL gene inactivated; nonpolar mutant; RifR [34]
52145-ΔwcaK2waaL 52145-ΔwcaK2, ΔwaaL; the waaL gene inactivated; nonpolar mutant; RifR This work
52145-ΔwabM Kp52145; ΔwabM; the wabM gene inactivated; nonpolar mutant; RifR [35]
52145-ΔwabH Kp52145; ΔwabH; the wabH gene inactivated; nonpolar mutant; RifR [35]
52145-ΔwabK Kp52145; ΔwabK; the wabK gene inactivated; nonpolar mutant; RifR [35]
52145-ΔwabG Kp52145; ΔwabG; the wabG gene inactivated; nonpolar mutant; RifR [34]
52145-ΔwaaQ Kp52145; ΔwaaQ; the waaQ gene inactivated; nonpolar mutant; RifR [52]
52145-ΔwaaL-ΔwaaQ 52145-ΔwaaL, ΔwaaQ; the waaQ gene inactivated; nonpolar mutant; RifR [52]
52145-ΔwcaK2wabM 52145-ΔwcaK2, ΔwabM; the wabM gene inactivated; nonpolar mutant; RifR This work
52145-ΔwcaK2wabH 52145-ΔwcaK2, ΔwabH; the wabH gene inactivated; nonpolar mutant; RifR This work
52145-ΔwcaK2wabK 52145-ΔwcaK2, ΔwabK; the wabK gene inactivated; nonpolar mutant; RifR This work
Plasmids
pGEM-T EasyCloning plasmid, AmpR Promega
pKO3Suicide vector, Psc101 replication origin, sacB gene, CmR [32]
pKOVpKO3 with the addition of a 3 kb stuffer sequence in the multiple cloning site; CmR Addgene plasmid 25769
pGEMTΔpmrF pGEM-T Easy containing ΔpmrF; AmpR [26]
pKOVΔpmrF pKOV containing ΔpmrF; CmR This study
pKO3ΔwaaL pKO3 containing engineered waaL deletion; CmR [34]
pKO3ΔwabM pKO3 containing engineered wabM deletion; CmR [35]
pKO3ΔwabH pKO3 containing engineered wabH deletion; CmR [35]
pKO3ΔwabK pKO3 containing engineered wabK deletion; CmR [35]
pKNOCKIntKpnOmpK36pKNOCK-Cm containing an internal fragment from ompK36; CmR. [30]
pUC18R6KT-mini-Tn7TKmpUC18R6KT-mini-Tn7T containing a Km cassette; AmpR, KmR [30]
pUC18R6KT-mini-Tn7TKmKpnOmpK36pUC18R6KT-mini-Tn7TKm; 1.7 kb encompassing ompK36 and its promoter; AmpR, KmR This work
pFPV25.1 rpsM::gfpmut3; AmpR [39]
pFPV25.1CmpFPV25.1; cat cassette cloned into EcoRV site; AmpR, CmR This work

Construction of K. pneumoniae mutants

To construct a pmrF mutant, pGEMTpmrF was amplified by inverse PCR to delete internal coding regions of pmrF using primers KpnpmrFinvF and KpnpmrFinvR (Table 2). The PCR product was digested with DpnI, gel purified and ligated to obtain pGEMTΔpmrF. ΔpmrF allele was PCR- amplified using Vent polymerase and primers KpnpmrFF and KpnpmrFR (Table 2), and cloned into SmaI-digested pKOV [32] to obtain pKOVΔpmrF. This vector was electroporated into 52145-ΔpagPGB and 52145-Δwca K2-ΔpagPGB and clones were selected after growth on LB agar plates supplemented with Cm at 30°C. Bacteria from 10 individual colonies were pooled in 500 Δl PBS, serially diluted in PBS, and spread on LB agar plates with Cm which were incubated at 42°C in order to select merodiploids in which the suicide vector was integrated into the chromosome by homologous recombination. 5–10 merodiploids were serially diluted in PBS and dilutions spread in LB agar plates containing 10% sucrose and without NaCl which were incubated at 30°C. The recombinants that survived 10% sucrose were checked for their antibiotic resistance. The replacement of the wild-type alleles by the mutant ones was confirmed by PCR (data not shown). Recombinants selected were named 52145-ΔpagPGB-ΔpmrF and 52145-Δwca K2-ΔpagPGB-ΔpmrF.
Table 2

Primers used in this study.

Sequences of primers used in this study
Purpose/arget geneNameSequence (5′ to 3′)
Mutagenesis
KpnpmrFF CGGATCCACCTGCGCGAGCTGGCGGAC
 pmrF KpnpmrFR CGGATCCCGGCGTCATCCGCGCCAATC
KpnpmrFinvF TCTCCTCCGGCGGGTTTTGC
KpnpmrFinvR CAAATACAGCTTTATGCGCCTG
Complementation
ompK36 ComKpnOmpK36F GGAGTGGTAGCTGAATCGCAGC
ComKpnOmpK36R AGGGAATCATTAGCCGTAGCAC
RT-qPCR
pmrI KpnyfbGF1 CGCTGGATCTACTCGGTCTC
KpnyfbGR1 TCTTTGTTCTCGATGATGCG
rpoD KpnrpoDLEFT CCGGAAGACAAAATCCGTAA
KpnrpoDRIGHT CGGGTAACGTCGAACTGTTT
Tn7 insertion
glmS KpnglmSup GCGACAACTGTTGCGACGGTG
KpnglmSdown TGGCTTATCACGTCGCGCTG
Tn7Ptn7L ATTAGCTTACGACGCTACACCC
Ptn7R CACAGCATAACTGGACTGATTTC
To confirm that pmrF mutation does not have polar effects, the expression of the downstream gene, pmrI, was analyzed by real time quantitative PCR (RT-qPCR). Bacteria were grown in 5 ml of LB on an orbital incubator shaker (180 r.p.m.) until an OD600 of 0.3. 0.5 ml of ice-cold solution EtOH/phenol [19∶1 v/v (pH 4.3)] were added to the culture and the mixture was incubated on ice for 30 min to prevent RNA degradation. Total RNA was extracted using a commercial NucleoSpin RNA II kit as recommended by the manufacturer (Macherey-Nagel). cDNA was obtained by retrotranscription of 2 µg of total RNA using a commercial M-MLV Reverse Transcriptase (Sigma), and random primers mixture (SABiosciences, Quiagen). 200 ng cDNA were used as a template in a 25 µl reaction mixture containing 1x SYBR green RT2 qPCR Master Mix (Superarray Bioscience Corporation) and primer mix (KpnyfbGF1 and KpnyfbGR1). rpoD was amplified as control using primers KpnrpoDLEFT and KpnrpoDRIGHT (Table 2). RT-qPCR analyses were performed as previously described [33]. The expression of pmrI was not significantly different between strains (data not shown). To obtain K. pneumoniae mutant strains with defects in LPS core, chromosomal in-frame nonpolar waa deletions were generated [34], [35]. pKO3ΔwabM, pKO3ΔwabH, pKO3ΔwabK suicide vectors were used to introduce each mutation into the cps mutant, strain 52145-Δwca K2, by double homologous recombination, as previously described [34], [35]. Likewise, a double mutant lacking cps and OPS was constructed by mobilizing the suicide vector pKO3ΔwaaL into 52145-Δwca K2. An ompK36 mutant in the genetic background of the cps mutant, strain 52145-Δwca K2, was obtained by insertion-duplication mutagenesis using the suicide vector pKNOCKIntKpnOmpK36. Correct insertion was verified by Southern blot (data not shown). OMPs were purified and analyzed by SDS-PAGE using 12% polyacrylamide gels as previously described [30], [36]. Proteins were visualized by Coomassie brilliant blue staining. 52145-Δwca K2-ΔompK36 did not express OmpK36 whereas the expression of other OMPs was not affected (Figure S1).

Complementation ompK36 mutants

A 1.7 kb fragment encompassing ompK36 and its promoter was PCR-amplified (using primers ComKpnOmpK36F and ComKpnOmpK36R [Table 2], Vent polymerase [New England Biolabs]) and cloned into SmaI-digested pUC18R6KT-mini-Tn7TKm to give pUC18R6KT-mini-Tn7TKmKpnOmpK36. Tn7 delivery to 52OmpK36 and 52145-Δwca K2-ΔompK36 was performed as described [37] and insertion was verified by colony-PCR with primer pairs: KpnglmSup/Ptn7L; and KpnglmSdown/Ptn7R [37]. Tn7 transposon integrates at the site-specific attTn7, located downstream of the glmS gene, thereby introducing ompK36 gene under the control of its own promoter into the chromosome. The complemented strains, 52OmpK36Com and 52145-Δwca K2-ΔompK36Com, expressed amounts of OmpK36 similar to those of the wild-type strain (Figure S1).

Construction of pFPV25.1Cm plasmid

A cat cassette, obtained by SmaI digestion of p34S-Cm [38], was cloned into EcoRV-digested pFPV25.1 [39], [40] to obtain pFPV25.1Cm. This plasmid expresses gfpmut3 under the control of Salmonella rpsM promoter region. This fusion has been reported to be expressed at similar levels in various environments, including growth media and mammalian cells [39], [40]. pFPV25.1Cm was introduced into E. coli CC118-λpir from which it was mobilized into Klebsiella strains by triparental conjugation using the helper strain E. coli HB101/pRK2013.

LPS analysis

Small scale LPS extraction using hot phenol was performed following the procedure described by Marolda et al. [41], with the exception that ethyl ether was replaced by ethanol for the washing of the LPS pellet. The LPS was run on a 12% SDS-PAGE and visualized using Pro-Q Emerald 300 Lipopolysaccharide Gel Stain Kit (Invitrogen).

Eukaryotic cells culture

D. discoideum AX2 cells were grown at 21°C in HL5 medium (pH 6.5) supplemented with 1.12 mg/ml glucose, 20 µg/ml streptomycin and 10 µg/ml tetracycline, and subcultured twice a week to maintain a density <106 cells/ml [42], [43]. Murine alveolar macrophages MH-S (ATTC, CRL-2019) were grown on RPMI 1640 tissue culture medium supplemented with 10% heat-inactivated fetal calf serum (FCS) and Hepes 10 mM at 37°C in an humidified 5% CO2 atmosphere.

Growth of Dictyostelium on bacteria

Procedures to test growth of Dictyostelium on bacteria have been described previously [42]. Briefly, bacteria were grown overnight in 5-ml LB, harvested (2500× g, 20 min, 24°C), washed once with PBS and a suspension containing approximately 1×109 cfu/ml was prepared in 10 mM PBS (pH 6.5). 300 µl from this suspension was spread onto standard medium (SM)-agar plates (10 g/l glucose, 10 g/l peptone, 1 g/l yeast extract, 1 g/l MgSO4:7H2O, 1.9 g/l KH2PO4, 0.6 g/l K2HPO4, 20 g/l agar; pH 6.3) or dilution series of HL5-agar plates. The plates were dried in a laminar hood for 30 min. Variable numbers of Dictyostelium amoebae (10 000, 1000, 100, 10) were deposited on the bacterial lawn, and allowed to grow at 21°C for 4–5 days, i.e. until Dictyostelium growth became visible.

Phagocytosis and killing of bacteria by Dictyostelium

Experiments were performed as previously described [44]. Briefly, bacteria were grown in 5-ml LB, harvested in the exponential phase (2500x g, 20 min, 24°C), washed once with PBS and a suspension containing approximately 1×109 cfu/ml was prepared in 10 mM PBS (pH 6.5). To test the ability of Dictyostelium to ingest and kill live bacteria, 104 cfu from the indicated suspension were mixed with 106 Dictyostelium in 500 µl of KK2 buffer (16.5 mM KH2PO4, 3.9 mM K2HPO4; pH 6.3) and incubated at 21°C with shaking. After 90 or 180 min of incubation, a 10 µl aliquot of the suspension was collected and diluted in 40 µl of ice-cold sucrose (400 g/l). 200 µl of 0.5% saponin in KK2 were added, before plating on a LB agar plate and incubating at 37°C. Control experiments showed that this procedure does not affect bacterial viability (this work and [44]). When indicated, the number of viable bacteria associated with Dictyostelium cells (intracellular fraction) was determined by washing the cells twice with ice-cold HL5 medium before diluting in sucrose [44]. Results are expressed as percentage of the colony count of bacteria not exposed to D. discoideum. All experiments were done with triplicate samples on at least four independent occasions. Immunofluorescence analysis was performed as described previously [45] by infecting AX2/RPF, a D. discoideum strain constitutively expressing the red fluorescent protein [46]. 2.5×107 cells were seeded on 12 mm circular coverslips in 24-well tissue culture plates and, after 2 h, infected with GFP-expressing K. pneumoniae at a ratio of 100 bacteria per 1 cell in a final volume of 500 µl of HL5. To synchronize infection, plates were centrifuged at 200× g during 5 min. Plates were incubated at 21°C for 30 min. Cells were washed two times with KK2 buffer and fixed with 3.7% paraformaldehyde in PBS pH 7.4 for 20 min at room temperature. Coverslips were washed two times in KK2 buffer before mounting onto glass slides using Aqua poly/Mount (Polysciences). Confocal microscopy was carried out with a Leica TCS SP5 confocal microscope. Experiments were carried out by duplicate in three independent occasions. The number of infected cells and the number of intracellular bacteria per cell was quantified within 300 cells.

Killing of Dictyostelium by bacteria

Bacteria were grown in 5-ml LB, harvested in the exponential phase (2500× g, 20 min, 24°C), washed once with PBS and a suspension containing approximately 1×109 cfu/ml was prepared in 10 mM PBS (pH 6.5). To test the ability of Klebsiella to kill Dictyostelium, 104 cfu were mixed with 106 Dictyostelium cells in 500 µl of KK2 buffer and incubated at 21°C with shaking (180 rpm). After 3 h, serial dilutions of the mixture were plated on a K. aerogenes lawn on SM agar plates, which were incubated at 21°C for 4–5 days, i.e. until individual colonies of Dictyostelium became visible. All experiments were done with triplicate samples on three independent occasions.

Phagocytosis of bacteria by alveolar macrophages

MH-S cells were seeded in 24-well tissue culture plates at a density of 7×105 cells per well 15 h before the experiment. Bacteria were grown in 5-ml LB, harvested in the exponential phase (2500× g, 20 min, 24°C), washed once with PBS and a suspension containing approximately 1×109 cfu/ml was prepared in 10 mM PBS (pH 6.5). Cells were infected with 35 µl of this suspension to get a multiplicity of infection of 50∶1 in a final volume of 500 µl RPMI 1640 tissue culture medium supplemented with 10% heat-inactivated FCS and 10 mM Hepes. To synchronize infection, plates were centrifuged at 200× g during 5 min. Plates were incubated at 37°C in an humidified 5% CO2 atmosphere. After 30 min of contact, cells were washed twice with PBS and incubated for additional 90 min with 500 µl RPMI 1640 containing 10% FCS, 10 mM Hepes, gentamicin (300 µg/ml) and polymyxin B (15 µg/ml) to eliminate extracellular bacteria. This treatment did not induce any cytotoxic effect which was verified measuring the release of lactate dehydrogenase (LDH) and by immunofluorescence microscopy (data not shown). Cells were then washed three times with PBS and lysed with 300 µl of 0.5% saponin in PBS for 10 min at room temperature. Serial dilutions were plated on LB to quantify the number of intracellular bacteria. Phagocytosis data are represented as cfu per well. All experiments were done with triplicate samples on at least three independent occasions. Immunofluorescence was performed as previously described [47]. Cells were seeded on 12 mm circular coverslips in 24-well tissue culture plates. Infections were carried out as described before with K. pneumoniae strains harbouring pFPV25.1Cm. After 90 min, cells were washed three times with PBS, and fixed with 3.7% paraformaldehyde in PBS pH 7.4. The actin cytoskeleton was stained with Rhodamine-Phalloidin (Invitrogen) diluted 1∶100, DNA was stained with Hoescht 33342 (Invitrogen) diluted 1∶2500. Staining was carried out in 10% horse serum, 0.1% saponin in PBS. Coverslips were washed twice in PBS containing 0.1% saponin, once in PBS, and incubated for 30 minutes with primary antibodies. Coverslips were then washed twice in 0.1% saponin in PBS and once in PBS and incubated for 30 minutes with secondary antibodies. Finally, coverslips were washed twice in 0.1% saponin in PBS, once in PBS and once in H2O, mounted on Aqua Poly/Mount (Polysciences) and analysed with a Leica TCS SP5 confocal microscope. The number of infected cells and the number of intracellular bacteria per cell was quantified within 300 cells. Experiments were carried out by triplicate in three independent occasions.

Intranasal infection model

Five- to 7-week-old female C57BL/6JOlaHsd mice (Harlan) were anesthetized by intraperitoneal injection with a mixture containing ketamine (50 mg/kg) and xylazine (5 mg/kg). Overnight bacterial cultures were centrifuged (2500× g, 20 min, 24°C), resuspended in PBS and adjusted to 5×104 cfu/ml. 20 µl of the bacterial suspension were inoculated intranasally in four 5 µl aliquots. To facilitate consistent inoculations, mice were held vertically during inoculation and placed on a 45° incline while recovering from anaesthesia. At indicated times after infection, mice were euthanized by cervical dislocation and lungs were rapidly dissected for bacterial loads determination. Dissected lungs were homogenized in 500 µl of PBS using an Ultra-Turrax TIO basic (IKA) on ice. Serially diluted bacteria from the homogenates were recovered in LB agar plates containing Rif for wild-type strain or Cm for ompK36 mutant. Results are reported as log cfu per gram of tissue.

Statistical analysis

Statistical analyses were performed using the two-tailed t test or, when the requirements were not met, by the Mann-Whitney U test. P<0.05 was considered statistically significant. The analyses were performed using Prism4 for PC (GraphPad Software).

Results

Role of K. pneumoniae CPS on phagocytosis resistance

We evaluated the resistance of the highly virulent clinical isolate K. pneumoniae strain 52145 (hereafter Kp52145) to predation by D. discoideum in comparison to the previously analyzed K. aerogenes susceptible strain, by using SM medium. Further confirming previous results [42], amoebae feed only upon K. aerogenes, creating phagocytic plaques (Figure 1A). Since CPS reduces phagocytosis, the lack of growth of Dyctiostelium on Kp52145 may simply reflect that these bacteria are not ingested by the amoebae. Unexpectedly, the isogenic cps mutant, strain 52145-Δwca K2, was also not permissive for Dictyostelium growth (Figure 1A). This might be due to the fact that the CPS of this Klebsiella strain, of the K2 serotype, is not required for phagocytosis resistance. However, there are studies showing that indeed CPSs of the K2 serotype mediate resistance to phagocytosis [18], [48], [49]. Another possibility could be that the assay conditions were too favourable for Kp52145. In fact, a similar scenario was reported when the virulence of Aeromonas spp was analyzed using D. discoideum model [50], i.e. Dictyostelium was incapable of growing on wild-type bacteria or on any of the nonvirulent mutants of Aeromonas tested when the assays were performed on SM medium. Since the richness of the growth medium affects the threshold at which a bacteria is permissive for Dictyostelium [42], we tested a range of dilutions of HL5 to determine the medium where only Kp52145 remains nonpermissive (Figure 1B). We observed that 52145-Δwca K2, but not Kp52145, was susceptible to predation even by 10 amoebae at 5% HL5 (Figure 1C). Kp52145 and 52145-Δwca K2 exhibited similar growth rates in 5% HL5 (data not shown). Control experiments indicated that Kp52145 was not cytotoxic for Dictyostelium because the number of amoebae after incubation with Kp52145 was similar to that after incubation with K. aerogenes (1.6±0.5×105, versus 1.7±0.6×105; respectively, P>0.05).
Figure 1

Virulence of K. pneumoniae against D. discoideum can be modulated.

(A) The ability of Dictyostelium to grow on a bacterial lawn was assessed by depositing amoebae (from 10 to 10,000) on a lawn of bacteria grown on SM agar medium. A phagocytosis plaque was observed 5 days later when bacteria were permissive. Bacteria tested were: K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2; Δwca K2), or control strain (K. aerogenes). (B) The ability of wild-type K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2), or control strain (K. aerogenes) to resist predation by D. discoideum was tested on HL5-agar, pure or diluted. 1,000 amoebae were deposited on the bacterial lawns and plaques were recorded 5 days later. (C) The ability of Dictyostelium to grow on a bacterial lawn was assessed by depositing amoebae (from 10 to 10,000) on a lawn of bacteria grown on HL5–5% agar medium. A phagocytosis plaque was observed 5 days later when bacteria were permissive (K. aerogenes and 52145-Δwca K2; Δwca K2).

Virulence of K. pneumoniae against D. discoideum can be modulated.

(A) The ability of Dictyostelium to grow on a bacterial lawn was assessed by depositing amoebae (from 10 to 10,000) on a lawn of bacteria grown on SM agar medium. A phagocytosis plaque was observed 5 days later when bacteria were permissive. Bacteria tested were: K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2; Δwca K2), or control strain (K. aerogenes). (B) The ability of wild-type K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2), or control strain (K. aerogenes) to resist predation by D. discoideum was tested on HL5-agar, pure or diluted. 1,000 amoebae were deposited on the bacterial lawns and plaques were recorded 5 days later. (C) The ability of Dictyostelium to grow on a bacterial lawn was assessed by depositing amoebae (from 10 to 10,000) on a lawn of bacteria grown on HL5–5% agar medium. A phagocytosis plaque was observed 5 days later when bacteria were permissive (K. aerogenes and 52145-Δwca K2; Δwca K2). Survival experiments were carried out to determine the total number of remaining bacteria, as well as the number of live cell-associated bacteria. Dictyostelium ingested and killed 52145-Δwca K2 as fast as the K. aerogenes control strain (Figure 2A). The number of intracellular 52145-Δwca K2 was higher than that of intracellular Kp52145 after co-culture of bacteria and Dictyostelium with an average of 2 bacteria per infected amoeba (Figure 2B). The percentage of infected Dyctiostelium with Kp52145 was 7±3% whereas it reached 65±9% when the challenging strain was 52145-Δwca K2. Altogether, these findings indicate that 52145-Δwca K2 is more easily engulfed by Dictyostelium than Kp52145. Intracellular killing was so fast that viable intracellular bacteria were hardly detectable already at 60 min post infection (Figure 2C), suggesting that under these experimental conditions the limiting factor for killing was the rate of phagocytosis.
Figure 2

Role of K. pneumoniae CPS on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella and the number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (B) Dictyostelium AX2/RFP cells were incubated in the presence of Klebsiella strains, K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2; Δwca K2), containing plasmid pFPV25.1Cm for 30 min, and then fixed. Images are representative of three independent experiments. (C) Dictyostelium cells were incubated with Klebsiella and the number of intracellular bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Each point represents the mean and standard deviation of twelve samples from four independent experiments. (D) Klebsiella phagocytois by MH-S mouse alveolar macrophages. Intracellular bacteria were determined by the gentamicin protection assay. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (E) Immunofluorescence confocal microscopy of MH-S mouse alveolar macrophages infected with Klebsiella strains Kp52145 or 52145-Δwca K2 (Δwca K2), containing plasmid pFPV25.1Cm. Actin cytoskeleton was stained with Phalloidin-RRX (red) and host cell nuclei were stained with Hoechst (blue). Images are representative of five independent experiments.

Role of K. pneumoniae CPS on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella and the number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (B) Dictyostelium AX2/RFP cells were incubated in the presence of Klebsiella strains, K. pneumoniae (Kp52145), cps mutant (52145-Δwca K2; Δwca K2), containing plasmid pFPV25.1Cm for 30 min, and then fixed. Images are representative of three independent experiments. (C) Dictyostelium cells were incubated with Klebsiella and the number of intracellular bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Each point represents the mean and standard deviation of twelve samples from four independent experiments. (D) Klebsiella phagocytois by MH-S mouse alveolar macrophages. Intracellular bacteria were determined by the gentamicin protection assay. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (E) Immunofluorescence confocal microscopy of MH-S mouse alveolar macrophages infected with Klebsiella strains Kp52145 or 52145-Δwca K2 (Δwca K2), containing plasmid pFPV25.1Cm. Actin cytoskeleton was stained with Phalloidin-RRX (red) and host cell nuclei were stained with Hoechst (blue). Images are representative of five independent experiments. Gentamicin protection assays showed that 52145-Δwca K2 was ingested by MH-S alveolar macrophages in higher numbers than the wild-type strain (Figure 2D). This correlated with the microscopic observation of higher numbers of intracellular 52145-Δwca K2 than Kp52145 after co-culture with alveolar macrophages with an average of 4 bacteria per infected macrophage (Figure 2E). The percentage of macrophages infected with 52145-Δwca K2 was significantly higher than that of macrophages infected with Kp52145 (43±9% and 9±3%, respectively; P<0.05). Collectively, these results highlight the role of K. pneumoniae CPS of K2 serotype in resistance to phagocytosis by D. discoideum and alveolar macrophages.

Role of K. pneumoniae LPS polysaccharide section on phagocytosis resistance

We sought to determine whether the LPS OPS and core sections contribute to phagocytosis resistance by D. discoideum and alveolar macrophages. Strains 52O21 and 52145-ΔwaaL are mutants in the OPS transporter and the OPS ligase that attaches the OPS to the LPS core, respectively [13], [34]. Both mutants do not express the OPS and they express similar levels of CPS than the wild type [13], [34]. After 90 min of co-culture with amoebae, no significant differences in survival were found between the OPS mutants, strains 52O21 and 52145-ΔwaaL, and the wild type (Figure 3B). However, a 50% decreased in survival of the two mutants was observed after 180 min of incubation (Figure 3B). We investigated whether the absence of the LPS OPS also increases the phagocytosis of 52145-Δwca K2 by D. discoideium. Indeed, this was the case (Figure 3B). The survival of the double mutant lacking cps and OPS, strain 52145-Δwca K2-ΔwaaL, was significantly lower than that of the cps mutant, 52145-Δwca K2 already after 90 min of co-culture with the amoebae (Figure 3B).
Figure 3

Role of K. pneumoniae LPS polysaccharide section on phagocytosis resistance.

(A) K. pneumoniae 52145 (Kp52145) oligosaccharide structure based on a published study [35]. Lines denote the truncation level for the different core biosynthetic gene mutations. Residues J and K could be hydrogen (H) or GalA. (B) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], LPS OPS mutants [52O21] and 52145-ΔwaaL [ΔwaaL], CPS mutant 52145-Δwca K2 [Δwca K2], or strain lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL [Δwca K2-ΔwaaL]) and the number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). (C) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], LPS OPS mutant 52145-ΔwaaL [ΔwaaL], and LPS core mutants 52145-ΔwaaQ [ΔwaaQ], 52145-ΔwaaL-ΔwaaQ [ΔwaaL-ΔwaaQ], 52145-ΔwabG [ΔwabG] 52145-ΔwabM [ΔwabM], 52145-ΔwabH [ΔwabH], and 52145-ΔwabK [ΔwabK]) and the number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for the waaL mutant [52145-ΔwaaL]; two tailed t test). (D) Dictyostelium cells were incubated with Klebsiella mutant lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL (Δwca K2-ΔwaaL), or the OPS and the first, second or third sugar of the core (strains 52145-Δwca K2-ΔwabM [Δwca K2-ΔwabM], 52145-Δwca K2-ΔwabH [Δwca K2-ΔwabH], and 52145-Δwca K2-ΔwabK [Δwca K2-ΔwabK] respectively). The number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔwaaL; two tailed t test). (E) Phagocytosis of LPS polysaccharide mutants by MH-S mouse alveolar macrophages. Intracellular bacteria were determined by the gentamicin protection assay. Kp52145 (wild type); OPS mutants 52O21 and ΔwaaL (52145-ΔwaaL); LPS core mutants ΔwaaQ (52145-ΔwaaQ), ΔwaaL-ΔwaaQ (52145-ΔwaaL-ΔwaaQ), ΔwabG (52145-ΔwabG), ΔwabM (52145-ΔwabM), ΔwabH (52145-ΔwabH), and ΔwabK (52145-ΔwabK). Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (F) MH-S cells engulfment of Klebsiella cps mutant, strain 52145-Δwca K2 (Δwca K2), or strains lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL (Δwca K2-ΔwaaL), or the OPS and the first, second or third sugar of the core (strains 52145-Δwca K2-ΔwabM [Δwca K2-ΔwabM], 52145-Δwca K2-ΔwabH [Δwca K2-ΔwabH], and 52145-Δwca K2-ΔwabK [-Δwca K2-ΔwabK] respectively). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test).

Role of K. pneumoniae LPS polysaccharide section on phagocytosis resistance.

(A) K. pneumoniae 52145 (Kp52145) oligosaccharide structure based on a published study [35]. Lines denote the truncation level for the different core biosynthetic gene mutations. Residues J and K could be hydrogen (H) or GalA. (B) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], LPS OPS mutants [52O21] and 52145-ΔwaaL [ΔwaaL], CPS mutant 52145-Δwca K2 [Δwca K2], or strain lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL [Δwca K2-ΔwaaL]) and the number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). (C) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], LPS OPS mutant 52145-ΔwaaL [ΔwaaL], and LPS core mutants 52145-ΔwaaQ [ΔwaaQ], 52145-ΔwaaL-ΔwaaQ [ΔwaaL-ΔwaaQ], 52145-ΔwabG [ΔwabG] 52145-ΔwabM [ΔwabM], 52145-ΔwabH [ΔwabH], and 52145-ΔwabK [ΔwabK]) and the number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for the waaL mutant [52145-ΔwaaL]; two tailed t test). (D) Dictyostelium cells were incubated with Klebsiella mutant lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL (Δwca K2-ΔwaaL), or the OPS and the first, second or third sugar of the core (strains 52145-Δwca K2-ΔwabM [Δwca K2-ΔwabM], 52145-Δwca K2-ΔwabH [Δwca K2-ΔwabH], and 52145-Δwca K2-ΔwabK [Δwca K2-ΔwabK] respectively). The number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔwaaL; two tailed t test). (E) Phagocytosis of LPS polysaccharide mutants by MH-S mouse alveolar macrophages. Intracellular bacteria were determined by the gentamicin protection assay. Kp52145 (wild type); OPS mutants 52O21 and ΔwaaL (52145-ΔwaaL); LPS core mutants ΔwaaQ (52145-ΔwaaQ), ΔwaaL-ΔwaaQ (52145-ΔwaaL-ΔwaaQ), ΔwabG (52145-ΔwabG), ΔwabM (52145-ΔwabM), ΔwabH (52145-ΔwabH), and ΔwabK (52145-ΔwabK). Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (F) MH-S cells engulfment of Klebsiella cps mutant, strain 52145-Δwca K2 (Δwca K2), or strains lacking the CPS and the OPS 52145-Δwca K2-ΔwaaL (Δwca K2-ΔwaaL), or the OPS and the first, second or third sugar of the core (strains 52145-Δwca K2-ΔwabM [Δwca K2-ΔwabM], 52145-Δwca K2-ΔwabH [Δwca K2-ΔwabH], and 52145-Δwca K2-ΔwabK [-Δwca K2-ΔwabK] respectively). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). To delineate the possible contribution of the LPS core to phagocytosis resistance, we first analyzed strains 52145-ΔwaaQ, lacking one heptose and its attached variable residue, and 52145-ΔwabG, lacking the first four sugars of the LPS core (Figure 3A). Whereas 52145-ΔwaaQ expresses OPS and similar levels of CPS than the wild-type strain [51], [52], 52145-ΔwabG is devoid of cell-surface attached CPS and OPS [51]. Results shown in Figure 3C revealed that 52145-ΔwabG was more susceptible to predation by D. discoideum than 52145-ΔwaaQ, which, in turn, was as susceptible as the OPS mutants. We did not observe significant differences between 52145-ΔwaaQ and 52145-ΔwaaL-ΔwaaQ (Figure 3C). Since 52145-ΔwabG lacks the cell-surface attached CPS, the OPS and the sugars of the outer core region we analyzed other core mutants expressing CPS and a less truncated core. 52145-ΔwabM, 52145-ΔwabK and 52145-ΔwabH, lack, in addition to the OPS, the first, second and third sugar of the LPS core, respectively (Figure 3A), but expressed similar levels of CPS than the wild-type strain [35]. Results shown in Figure 3C revealed that 52145-ΔwabM; 52145-ΔwabK and 52145-ΔwabH were susceptible to predation by D. discoideum already after 90 min of co-culture with amoebae (Figure 3C). No significant differences were observed between these mutants and 52145-ΔwabG (Figure 3C). In the genetic background of the cps mutant, the three core mutants were more susceptible to predation by the amoebae than the LPS OPS mutant but only after 90 min of co-culture (Figure 3D). Next, we analyzed the susceptibility of this set of mutant strains to phagocytosis by alveolar macrophages. No differences were found between the phagocytosis of the LPS OPS mutants, 52O21 and 52145-ΔwaaL, and that of the wild-type strain (Figure 3E). In contrast, all the LPS core mutants tested were ingested in higher numbers than the LPS OPS mutants and the wild-type strain (Figure 3E). In the genetic background of the cps mutant, only wabK and wabH mutants were internalized in higher numbers than the LPS OPS mutant by the alveolar macrophages (Figure 3F). In summary, our findings indicate that, in addition to the CPS, K. pneumoniae LPS OPS and the core sugars participate in the resistance to predation by D. discoideum. In the case of alveolar macrophages, the LPS core plays a more prominent role than the LPS OPS in K. pneumoniae avoidance of phagocytosis.

Role of K. pneumoniae LPS lipid A decorations on phagocytosis resistance

52145-ΔpmrF, 52145-ΔpagPGB and 52145-ΔpmrF-ΔpagPGB are mutant strains lacking lipid A species containing aminoarabinose, palmitate or both [26]. These mutants express the same levels of CPS than the wild type [26]. LPS analysis showed that these mutants expressed OPS (Figure S2). We asked whether these modifications contribute to phagocytosis resistance by D. discoideum. After 90 min of co-culture, pagP mutant was more susceptible to predation by the amoebae than the wild type and the pmrF mutant whereas the pagP-pmrF double mutant was the most susceptible strain (Figure 4A). After 180 min, the three lipid A mutants were more susceptible to predation than the wild type and no significant differences between the mutant strains were observed (Figure 4A). In the background of the cps mutant, after 90 min of co-culture, the pagP and pmrF single mutants were more susceptible to predation than 52145-Δwca K2 whereas 52145-Δwca K2-ΔpmrF-ΔpagPGB triple mutant was the most susceptible strain (Figure 4B). After 180 min, the three lipid mutants were more susceptible than 52145-Δwca K2 (Figure 4B).
Figure 4

Role of K. pneumoniae lipid A decorations on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], pagP mutant (ΔpagP, 52145-ΔpagPGB), pmrF mutant (ΔpmrF, 52145-ΔpmrF), or pagP-pmrF double mutant (ΔpagP-ΔpmrF, 52145-ΔpagPGB-ΔpmrF). The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-ΔpagPGB; two tailed t test). (B) Dictyostelium cells were incubated with Klebsiella lipid A mutants constructed in the background of the cps mutant (52145-Δwca K2 [Δwca K2]). The number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔpagPGB; two tailed t test). (C) Phagocytosis of lipid A mutants by MH-S cells. Wild type [Kp52145], pagP mutant (ΔpagP, 52145-ΔpagPGB), pmrF mutant (ΔpmrF, 52145-ΔpmrF), or double pagP-pmrF mutant (ΔpagP-ΔpmrF, 52145-ΔpagPGB-ΔpmrF). Bars represent mean ± s.e.m (n = 4) *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-ΔpagPGB; two tailed t test). (D) Phagocytosis of lipid A mutants constructed in the background of the cps mutant (52145-Δwca K2 [Δwca K2]) by MH-S cells. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔpagPGB; two tailed t test).

Role of K. pneumoniae lipid A decorations on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], pagP mutant (ΔpagP, 52145-ΔpagPGB), pmrF mutant (ΔpmrF, 52145-ΔpmrF), or pagP-pmrF double mutant (ΔpagP-ΔpmrF, 52145-ΔpagPGB-ΔpmrF). The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-ΔpagPGB; two tailed t test). (B) Dictyostelium cells were incubated with Klebsiella lipid A mutants constructed in the background of the cps mutant (52145-Δwca K2 [Δwca K2]). The number of surviving bacteria was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔpagPGB; two tailed t test). (C) Phagocytosis of lipid A mutants by MH-S cells. Wild type [Kp52145], pagP mutant (ΔpagP, 52145-ΔpagPGB), pmrF mutant (ΔpmrF, 52145-ΔpmrF), or double pagP-pmrF mutant (ΔpagP-ΔpmrF, 52145-ΔpagPGB-ΔpmrF). Bars represent mean ± s.e.m (n = 4) *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-ΔpagPGB; two tailed t test). (D) Phagocytosis of lipid A mutants constructed in the background of the cps mutant (52145-Δwca K2 [Δwca K2]) by MH-S cells. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). ▵; P<0.05 (results are significantly different from the results for 52145-Δwca K2-ΔpagPGB; two tailed t test). Next, we assessed the contribution of lipid A decorations to phagocytosis resistance by alveolar macrophages. The pagP mutants, strains 52145-ΔpagPGB, 52145-ΔpmrF-ΔpagPGB, 52145-Δwca K2-ΔpagPGB, and 52145-Δwca K2-ΔpmrF-ΔpagPGB, were internalized in higher numbers by alveolar macrophages than Kp52145 and 52145-Δwca K2, being the numbers of 52145-Δwca K2-ΔpmrF-ΔpagPGB the highest (Figure 4C-D). Altogether, these data support the notion that the PagP-dependent lipid A modification with palmitate plays a more important role to reduce K. pneumoniae phagocytosis by D. discoideum and alveolar macrophages than the lipid A modification with aminoarabinose. The impact of the latter is more evident in the pagP mutant background.

Role of K. pneumoniae OMPs on phagocytosis resistance

Previously, we have shown that ompA and ompK36 mutants express similar levels of CPS than Kp52145 [30], [31]. We aimed to establish whether OmpA and OmpK36 are involved in the resistance to phagocytosis by D. discoideum and alveolar macrophages. Results displayed in Figure 5A indicate that ompA and ompK36 mutants were susceptible to predation by amoebae. The contribution of both OMPs to resist predation by D. discoideum was also observed in the cps mutant background (Figure 5B). Likewise, OMPs mutants were phagocytosed by alveolar macrophages in higher numbers than Kp52145 and 52145-Δwca K2 (Figure 5C–D). OMPs mutants could be complemented (Figure 5).
Figure 5

Role of K. pneumoniae OMPs on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], ompA mutant (ΔompA, 52OmpA2), ompK36 mutant (ΔompK36, 52OmpK36), and the corresponding complemented strains. The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (B) Dictyostelium cells were incubated with Klebsiella OMPs mutants constructed in the background of the cps mutant (52145-Δwca K2, [Δwca K2]). The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). (C) Phagocytosis of OMPs mutants by MH-S cells. Wild type [Kp52145], ompA mutant (ΔompA, 52OmpA2), ompK36 mutant (ΔompK36, 52OmpK36), and the corresponding complemented strains. Bars represent mean ± s.e.m (n = 4) *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (D) Phagocytosis of OMPs mutants constructed in the background of the cps mutant (52145-Δwca K2) by MH-S cells. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test).

Role of K. pneumoniae OMPs on phagocytosis resistance.

(A) Dictyostelium cells were incubated with Klebsiella strains (wild type [Kp52145], ompA mutant (ΔompA, 52OmpA2), ompK36 mutant (ΔompK36, 52OmpK36), and the corresponding complemented strains. The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (B) Dictyostelium cells were incubated with Klebsiella OMPs mutants constructed in the background of the cps mutant (52145-Δwca K2, [Δwca K2]). The number of surviving bacteria (total or cell-associated) was determined at different times by killing the Dictyostelium and plating the bacteria on LB plates. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test). (C) Phagocytosis of OMPs mutants by MH-S cells. Wild type [Kp52145], ompA mutant (ΔompA, 52OmpA2), ompK36 mutant (ΔompK36, 52OmpK36), and the corresponding complemented strains. Bars represent mean ± s.e.m (n = 4) *; P<0.05 (results are significantly different from the results for the wild-type strain [Kp52145]; two tailed t test). (D) Phagocytosis of OMPs mutants constructed in the background of the cps mutant (52145-Δwca K2) by MH-S cells. Bars represent mean ± s.e.m (n = 4). *; P<0.05 (results are significantly different from the results for the cps mutant [52145-Δwca K2]; two tailed t test).

Virulence of K. pneumoniae ompK36 mutant

We and others have assessed the contribution of CPS, LPS polysaccharides, lipid A decorations and ompA to K. pneumoniae virulence [13], [18], [26], [31], [34], [35], [53]. Notably, there is a strong correlation between resistance to phagocytosis (this work) and attenuation in vivo. Therefore, the fact that OmpK36 contributed to phagocytosis resistance prompted us to determine the ability of the ompK36 mutant to cause pneumonia. C57BL/6JOlaHsd mice were infected intranasally and bacterial loads in trachea and lung homogenates were determined at 24 and 72 h post-infection (Figure 6). Kp52145 and ompK36 mutant colonized trachea although bacterial loads of the mutant were lower than those of the wild type at 24 and 72 h post-infection (Figure 6A). ompK36 mutant also colonized the lungs and at 72 h post infection bacterial loads of the mutant were lower than those of the wild type (Figure 6B).
Figure 6

Virulence of K. pneumoniae ompK36 mutant.

Bacterial counts in mouse organs at 24 h post infection or 72 h post infection. Mice were infected intranasally with a bacterial mixture containing 5×104 bacteria of wild type (Kp52145, •) or ompK36 mutant (ΔompK36, ○) Results were reported as log CFU per gram of tissue (Log CFU/g). *, results are significantly different (P<0.05; two-tailed t test) from the results for Kp52145. (A) Trachea; (B) Lung; (C) Spleen, (D) Liver.

Virulence of K. pneumoniae ompK36 mutant.

Bacterial counts in mouse organs at 24 h post infection or 72 h post infection. Mice were infected intranasally with a bacterial mixture containing 5×104 bacteria of wild type (Kp52145, •) or ompK36 mutant (ΔompK36, ○) Results were reported as log CFU per gram of tissue (Log CFU/g). *, results are significantly different (P<0.05; two-tailed t test) from the results for Kp52145. (A) Trachea; (B) Lung; (C) Spleen, (D) Liver. To evaluate the ability of the mutant to disseminate to other organs, bacterial loads in spleen and liver were determined. ompK36 mutant reached both organs (Figure 6C–D) and at 72 h post-infection the bacterial loads in spleen and liver were significantly lower than those of the wild type (Figure 6C–D).

Discussion

Phagocytosis is one of the key processes of the immune system. Although most bacteria are successfully internalized and eliminated by phagocytes, several pathogens have developed survival strategies that interfere with the internalization and/or maturation processes. K. pneumoniae is a well known example of one pathogen displaying resistance to phagocytosis. Prevention and management of the infections caused by such pathogens would obviously benefit from understanding the manner in which they circumvent and often co-opt the immune response. The fact that K. pneumoniae is ubiquitous in nature and, therefore, should avoid predation by protozoa, including amoebae, poses the question whether K. pneumoniae employs similar means to counteract predation by amoebae and engulfment by mammalian phagocytes. In this study, we provide evidence for this notion. Furthermore, our data reveal novel information about the implication of K. pneumoniae LPS polysaccharide and lipid A sections, and of the OMPs OmpA and OmpK36 to K. pneumoniae avoidance of phagocytosis. In this study, we found a correlation between the findings obtained testing alveolar macrophages, key cells responsible for lung defence against infections, and those found challenging D. discoideum. Therefore, our results add further evidence to the notion that D. discoideum model is useful for investigating phagocytosis. Our data further support the idea that the limiting factor for killing Klebsiella by the amoebae is the rate of phagocytosis [17], [44] since bacterial survival was not affected in those strains not engulfed by D. discoideum. Nevertheless, our results also highlight the importance of adjusting the assay conditions in order to set the threshold of the assay for supposedly permissive bacteria, in our case the cps mutant [17]–[19]. This was so even for a bacterial species previously tested, K. pneumoniae, thereby suggesting that the interplay between D. discoideum and bacterial pathogens is strain specific. Likewise, not all strains of Vibrio cholerae are able to avoid predation by D. discoideum [54]. The assay established and used in this study allowed a comprehensive analysis of Klebsiella surface determinants mediating resistance to phagocytosis with a high degree of reproducibility. While this work was in progress, Pan and co-workers [19] reported the results of a screening to identify K. pneumonia NHTU-K2044 determinants preventing predation by D. discoideum. Seventy two of the mutants permissive for D. discoideum growth had transposon insertions in the cps operon [19], which is in good agreement with our findings showing the importance of CPS to resist phagocytosis. Of note, Kp52145 and NHTU-K2044 express CPS of different K serotypes, K2 and K1 respectively, thereby suggesting that the CPS serotype may not be the determinant factor mediating CPS-dependent reduction of phagocytosis. In fact, evidence points out that the critical factor is the amount of CPS expressed [19], [55]. Like most clinical isolates associated to severe infections, Kp52145 and NHTU-K2044 are heavily capsulated strains. Twenty one of the NHTU-K2044 mutants supporting the growth of the amoebae had transposon insertions affecting the biosynthesis of the LPS OPS [19]. However, those mutants were less capsulated than the wild type [19] making difficult to delineate the relative contribution of the OPS and CPS to resist predation by D. discoideum. The OPS mutants tested in this work express wild-type levels of CPS hence allowing us to study the role of OPS on resistance to phagocytosis by D. discoideum. Indeed, our data highlight that the OPS limits predation by D. discoideum. Unexpectedly, the OPS mutants were phagocytosized by alveolar macrophages in similar numbers than the wild-type strain. Likewise, it has been reported no role for Klebsiella OPS on the resistance to phagocytosis by human dendritic cells [56]. In contrast, it has been shown that the OPS does play a role in the interaction with mouse and human neutrophils [19], [57]. Therefore, it is tempting to postulate that the contribution of Klebsiella OPS to prevent phagocytosis is not uniform to all professional phagocytes. The contribution of LPS core to virulence is poorly characterized in most Gram negative pathogens and it has been only conclusively established for Yersinia enterocolitica and Kp52145 [35], [58]. To the best of our knowledge, our study is the first one highlighting the contribution of LPS core residues to phagocytosis resistance. Our findings showed that the heptose branch linked to the core by WaaQ is implicated in resistance to phagocytosis by D. discoideum and alveolar macrophages even in the presence of OPS. To investigate the contribution of other core residues in an OPS-bearing strain, we have used defined mutants that lack the OPS in addition to core residues which, in turn, suggest that the core residues are never exposed in a wild-type strain. However, it should be noted that epidemiological data indicate that nearly 10% of Klebsiella clinical isolates do not express the LPS OPS [59] and, therefore, core residues will not be masked by the OPS. Our results revealed that the first glucose residue of the LPS core is necessary to avoid engulfment by D. discoideum and alveolar macrophages since the relative survival of wabM mutant, lacking also OPS, was lower than those of the OPS mutants. Elimination of additional core residues did not further decrease the observed phagocytosis resistance. Perusal of the literature clearly shows the importance of lipid A decorations with aminoarabinose and palmitate to counteract the microbial action of antimicrobial peptides. However, the role of these lipid A decorations, if any, to resist phagocytosis was unknown. Our data indicated that PagP-dependent lipid A palmitoylation plays an important role to reduce Klebsiella engulfment by D. discoideum and alveolar macrophages. Intriguing, a pagP-like gene also confers Legionella pneumophila resistance to antimicrobial peptides and contributes to the intracellular life of the pathogen in Hartmannella vermiformis amoebae and human macrophages [60]. It is tempting to formulate that PagP-dependent lipid A modification is a major bacterial determinant against the soluble and the cellular arms of the innate immune system. As a consequence, pagP mutants should be attenuated as indeed it has been indeed shown for K. pneumoniae and Legionella [26], [60]. Studies in other bacterial models are required to further validate our hypothesis. Finally, we showed that Klebsiella OMPs also contribute to phagocytosis resistance in K. pneumoniae. Mounting evidence indicates that an essential attribute of K. pneumoniae OmpA is to thwart the innate immune system [30], [31]. The findings reported in this work further corroborate this notion and add new features to the previously described panoply of OmpA-dependent anti-immune strategies. In turn, the possible role of OmpK36 on K. pneumoniae evasion of innate immunity is poorly characterized. Our results revealed that OmpK36 also contributes to phagocytosis resistance by Klebsiella. However, and in contrast to OmpA, OmpK36 does not play any role in the resistance to antimicrobial peptides [30] and therefore it seems that both OMPs are not functionally redundant in terms of immune evasion. We are currently assessing whether OmpK36 modulates the cellular responses upon Klebsiella infection. Previous reports suggested that alveolar macrophages play a major role in host defence against K. pneumoniae since the depletion of these cells results in reduced killing of the pathogen in vivo [10], [11]. Conversely, this suggests that Klebsiella countermeasures against phagocytosis could be important virulence factors. Data reported in this work give experimental support to this hypothesis since we have found a nearly perfect correlation between virulence using the pneumonia mouse model and resistance to phagocytosis by D. discoideum and alveolar macrophages. Thus, cps, pagP, LPS core, ompA and ompK36 mutants are attenuated in vivo (this work and [13], [18], [26], [31], [34], [35], [53]) and in this study we have demonstrated that these loci mediate phagocytosis resistance. A tantalizing observation is that Dictyostelium amoebae might be useful as host model to measure K. pneumoniae virulence and not only phagocytosis. Given the relatively simplicity and low cost to create banks of D. discoideum mutants in comparison to mouse or human macrophages, it can be envisaged a more systematic analysis of the complex interactions between Klebsiella and the host, aiming to identify host resistance genes. First attempts challenging a non-saturating D. discoideum library of mutants with a laboratory adapted K. pneumoniae strain led to the identification of a type V P-ATPAase as an essential element for killing of Klebsiella [44]. Interestingly, this P-ATPAase was dispensable for the elimination of other bacteria [44] hence suggesting that Klebsiella may mobilize a specific set of host gene products only necessary for resistance to K. pneumoniae infection. Analysis of OMPs from strains. SDS-PAGE (the acrylamide concentration was 4% in the stacking gel and 12% in the separation one) followed by Coomasie brilliant blue staining of OMPs from (A) Kp52145, 52OmpK36 and 52OmpK36Com; and (B) 52145-Δwca K2, 52145-Δwca K2-ompK36 and 52145-Δwca K2-ompK36Com. MW, molecular weight marker. (TIF) Click here for additional data file. Analysis of LPSs from strains. SDS-PAGE (the acrylamide concentration was 4% in the stacking gel and 12% in the separation one) followed by staining using Pro-Q Emerald 300 Lipopolysaccharide Gel Stain Kit (Invitrogen) of LPSs from Kp52145, 52145-ΔpmrF (ΔpmrF), 52145-ΔpagPGB (ΔpagP) and 52145-ΔpagPGB-ΔpmrF (ΔpagP-ΔpmrF). (TIF) Click here for additional data file.
  63 in total

1.  Role of magnesium and a phagosomal P-type ATPase in intracellular bacterial killing.

Authors:  Emmanuelle Lelong; Anna Marchetti; Aurélie Guého; Wanessa C Lima; Natascha Sattler; Maëlle Molmeret; Monica Hagedorn; Thierry Soldati; Pierre Cosson
Journal:  Cell Microbiol       Date:  2010-11-02       Impact factor: 3.715

2.  Klebsiella pneumoniae OmpA confers resistance to antimicrobial peptides.

Authors:  Enrique Llobet; Catalina March; Paloma Giménez; José A Bengoechea
Journal:  Antimicrob Agents Chemother       Date:  2008-11-17       Impact factor: 5.191

3.  Identification of Legionella pneumophila rcp, a pagP-like gene that confers resistance to cationic antimicrobial peptides and promotes intracellular infection.

Authors:  M Robey; W O'Connell; N P Cianciotto
Journal:  Infect Immun       Date:  2001-07       Impact factor: 3.441

4.  Use of a Dictyostelium model for isolation of genetic loci associated with phagocytosis and virulence in Klebsiella pneumoniae.

Authors:  Yi-Jiun Pan; Tzu-Lung Lin; Chun-Ru Hsu; Jin-Town Wang
Journal:  Infect Immun       Date:  2010-12-20       Impact factor: 3.441

5.  Cultivation of Dictyostelium discoideum in axenic medium.

Authors:  R Sussman; M Sussman
Journal:  Biochem Biophys Res Commun       Date:  1967-10-11       Impact factor: 3.575

6.  Klebsiella pneumoniae capsule polysaccharide impedes the expression of beta-defensins by airway epithelial cells.

Authors:  David Moranta; Verónica Regueiro; Catalina March; Enrique Llobet; Javier Margareto; Eider Larrarte; Eider Larrate; Junkal Garmendia; José A Bengoechea
Journal:  Infect Immun       Date:  2009-12-14       Impact factor: 3.441

7.  Bacterial genetics by flow cytometry: rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction.

Authors:  R H Valdivia; S Falkow
Journal:  Mol Microbiol       Date:  1996-10       Impact factor: 3.501

8.  The role of the O-antigen lipopolysaccharide and capsule on an experimental Klebsiella pneumoniae infection of the rat urinary tract.

Authors:  S Camprubí; S Merino; V J Benedí; J M Tomás
Journal:  FEMS Microbiol Lett       Date:  1993-07-15       Impact factor: 2.742

Review 9.  Lipid A modification systems in gram-negative bacteria.

Authors:  Christian R H Raetz; C Michael Reynolds; M Stephen Trent; Russell E Bishop
Journal:  Annu Rev Biochem       Date:  2007       Impact factor: 23.643

10.  Mucoid phenotype of Klebsiella pneumoniae is a plasmid-encoded virulence factor.

Authors:  X Nassif; J M Fournier; J Arondel; P J Sansonetti
Journal:  Infect Immun       Date:  1989-02       Impact factor: 3.441

View more
  52 in total

Review 1.  Innate Immune Signaling Activated by MDR Bacteria in the Airway.

Authors:  Dane Parker; Danielle Ahn; Taylor Cohen; Alice Prince
Journal:  Physiol Rev       Date:  2016-01       Impact factor: 37.312

2.  Porin Loss Impacts the Host Inflammatory Response to Outer Membrane Vesicles of Klebsiella pneumoniae.

Authors:  Kelli L Turner; Bethaney K Cahill; Sarah K Dilello; Dedra Gutel; Debra N Brunson; Sebastián Albertí; Terri N Ellis
Journal:  Antimicrob Agents Chemother       Date:  2015-12-14       Impact factor: 5.191

Review 3.  Hypervirulent Klebsiella pneumoniae.

Authors:  Thomas A Russo; Candace M Marr
Journal:  Clin Microbiol Rev       Date:  2019-05-15       Impact factor: 26.132

4.  Carbapenem-resistant Klebsiella pneumoniae exhibit variability in capsular polysaccharide and capsule associated virulence traits.

Authors:  Elizabeth Diago-Navarro; Liang Chen; Virginie Passet; Seth Burack; Amaia Ulacia-Hernando; Rosy Priya Kodiyanplakkal; Michael H Levi; Sylvain Brisse; Barry N Kreiswirth; Bettina C Fries
Journal:  J Infect Dis       Date:  2014-03-14       Impact factor: 5.226

5.  BamB and outer membrane biogenesis - The Achilles' heel for targeting Klebsiella infections?

Authors:  Anne Marie Krachler
Journal:  Virulence       Date:  2016-04-29       Impact factor: 5.882

6.  Klebsiella sweet deadly kiss.

Authors:  José A Bengoechea
Journal:  Virulence       Date:  2016-06-22       Impact factor: 5.882

7.  Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella.

Authors:  José Luis Insua; Enrique Llobet; David Moranta; Camino Pérez-Gutiérrez; Anna Tomás; Junkal Garmendia; José A Bengoechea
Journal:  Infect Immun       Date:  2013-07-08       Impact factor: 3.441

Review 8.  Correlation between antimicrobial resistance and virulence in Klebsiella pneumoniae.

Authors:  C Hennequin; F Robin
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2015-12-30       Impact factor: 3.267

Review 9.  Klebsiella pneumoniae: Going on the Offense with a Strong Defense.

Authors:  Michelle K Paczosa; Joan Mecsas
Journal:  Microbiol Mol Biol Rev       Date:  2016-06-15       Impact factor: 11.056

10.  Identification and Characterization of Two Klebsiella pneumoniae lpxL Lipid A Late Acyltransferases and Their Role in Virulence.

Authors:  Grant Mills; Amy Dumigan; Timothy Kidd; Laura Hobley; José A Bengoechea
Journal:  Infect Immun       Date:  2017-08-18       Impact factor: 3.441

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.