Literature DB >> 23451086

Lineage divergence and historical gene flow in the Chinese horseshoe bat (Rhinolophus sinicus).

Xiuguang Mao1, Guimei He, Junpeng Zhang, Stephen J Rossiter, Shuyi Zhang.   

Abstract

Closely related taxa living in sympatry provide good opportunities to investigate the origin of barriers to gene flow as well as the extent of reproductive isolation. The only two recognized subspecies of the Chinese rufous horseshoe bat Rhinolophus sinicus are characterized by unusual relative distributions in which R. s. septentrionalis is restricted to a small area within the much wider range of its sister taxon R. s. sinicus. To determine the history of lineage divergence and gene flow between these taxa, we applied phylogenetic, demographic and coalescent analyses to multi-locus datasets. MtDNA gene genealogies and microsatellite-based clustering together revealed three divergent lineages of sinicus, corresponding to Central China, East China and the offshore Hainan Island. However, the central lineage of sinicus showed a closer relationship with septentrionalis than with other lineages of R. s. sinicus, in contrary to morphological data. Paraphyly of sinicus could result from either past asymmetric mtDNA introgression between these two taxa, or could suggest septentrionalis evolved in situ from its more widespread sister subspecies. To test between these hypotheses, we applied coalescent-based phylogenetic reconstruction and Approximate Bayesian Computation (ABC). We found that septentrionalis is likely to be the ancestral taxon and therefore a recent origin of this subspecies can be ruled out. On the other hand, we found a clear signature of asymmetric mtDNA gene flow from septentrionalis into central populations of sinicus yet no nuclear gene flow, thus strongly pointing to historical mtDNA introgression. We suggest that the observed deeply divergent lineages within R. sinicus probably evolved in isolation in separate Pleistocene refugia, although their close phylogeographic correspondence with distinct eco-environmental zones suggests that divergent selection might also have promoted broad patterns of population genetic structure.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23451086      PMCID: PMC3581519          DOI: 10.1371/journal.pone.0056786

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Closely related taxa that have sympatric or parapatric ranges provide good opportunities to investigate the origins of barriers to gene flow and the extent of reproductive isolation. Although gene flow has a powerful homogenizing effect that can hamper the divergence of populations into new taxa [1] by preventing the evolution of strong reproductive isolation [2], several recent studies suggest divergence with gene flow is not uncommon, not only in the process of speciation but also after speciation is complete [3], [4], [5], [6]. Indeed there is good evidence that introgressive hybridization may occur between closely related species on secondary contact after a period of allopatric isolation [7], [8]. By allowing for genetic exchange during divergence, the isolation-with-migration (IM) model has been developed to disentangle the relative importance of complete isolation and divergence with gene flow in the process of taxon divergence [9]. As with many temperate taxa, tropical and subtropical species underwent radical range shifts during Pleistocene glacial-interglacial cycles [10], [11], [12]. Recent studies have shown that Pleistocene climatic fluctuations and associated sea level changes have contributed to intraspecific diversification of many taxa from East Asia [12], [13]. Several refugia have been reported in the east and southwestern plateau of China [13], [14], [15], which appear to have promoted population divergence and speciation [10]. In addition to global climate cycles, the biota of East Asian was further impacted by severe climatic and environmental changes due to the uplift of the Qinghai-Tibetan Plateau (QTP). This process not only dramatically modified the topography of East Asia, leading to the current higher elevations in the west [16], but also gave rise to the East-Asia monsoon, which further enhanced the climatic difference between the east and south-west [16]. The horseshoe bats (family Rhinolophidae) number over 70 species and show highest diversity in the Old World tropics and subtropics [17]. The Chinese rufous horseshoe bat Rhinolophus sinicus is a common species in East Asia with a wide longitudinal range that encompasses the Qinghai-Tibetan Plateau. Its sister species, R. thomasi and R. rouxii, occur further south and west, respectively, and together with a recently described cryptic species of R. rouxii from South India (R. indorouxii sp. nov) [18], these taxa constitute the only members of the so-called rouxii-group [17] (also see Figure 1). Previously, R. sinicus was regarded as a subspecies of R. rouxii based on craniodental features [19], but was later elevated to a distinct species following detailed phenetic, molecular [20] and cytogenetic analyses [21], [22].
Figure 1

Map showing the distributions of the member species of the R. rouxii-group, and the ranges of the focal subspecies of Rhinolophus sinicus.

In spite of its wide distribution, R. sinicus is currently recognized as consisting of just two subspecies (see Figure 1): R. s. sinicus and R. s. septentrionalis, which can be distinguished on the basis of morphological characters; in particular, septentrionalis has a larger body size than sinicus (see [17] and Figure 2a in this study). These two recognized subspecies have unusual relative distributions that raise questions about the origin of septentrionalis. Currently the subspecies sinicus is thought to range from the Himalayas, through northern Vietnam and regions of Sichuan to southeastern China. In contrast, septentrionalis is thought to be highly restricted to Yunnan Province in China [17] and is completely surrounded by its more widespread sister taxon (see Figure 1). Three alternative hypotheses might account for the unusual asymmetric distributions of these two taxa. The first and most simple explanation is that septentrionalis and sinicus are not true sister taxa and thus the current taxonomy is incorrect. Second, they are sister taxa and septentrionalis has evolved in situ via divergence from sinicus, in which case the former will appear to be derived from the latter in phylogenetic analyses, and will harbor a subset of the genetic variation. If this is true we might also expect historical gene flow during divergence. The third hypothesis is that septentrionalis evolved allopatrically, possibly related to Pleistocene glaciation and/or uplift of the Qinghai-Tibetan Plateau. In this scenario, the current sympatric distributions will have arisen from secondary contact.
Figure 2

Morphological and echolocation data for bats with corresponding membership in mtDNA clades and microsatellite clusters.

(a) Forearm (mm) and body mass (g) data measured for 396 individuals. Open and filled triangles correspond to female and male bats, respectively. (b) Boxplots of the echolocation call frequency (kHz) recorded from 130 individuals. (c) Map showing the sample sites of R. sinicus in this study. Forty-one sampling localities were classified into eight regions, depicted by dashed lines. These regions were further divided into four groups coded by colours (East: green; Central: purple; Hainan Island (HND): blue; Yunnan (YN): orange). Populations are presented as pie charts in which individuals are coloured based on the membership of mtDNA clades (I, II, III and IV). The relationships between clades are shown on the left side of the map (see details in Figure 2). (d) Populations are presented as pie charts in which individuals are coloured based on the membership of microsatellite clusters (I, II, III, IV and mixed, see Figure 4).

Morphological and echolocation data for bats with corresponding membership in mtDNA clades and microsatellite clusters.

(a) Forearm (mm) and body mass (g) data measured for 396 individuals. Open and filled triangles correspond to female and male bats, respectively. (b) Boxplots of the echolocation call frequency (kHz) recorded from 130 individuals. (c) Map showing the sample sites of R. sinicus in this study. Forty-one sampling localities were classified into eight regions, depicted by dashed lines. These regions were further divided into four groups coded by colours (East: green; Central: purple; Hainan Island (HND): blue; Yunnan (YN): orange). Populations are presented as pie charts in which individuals are coloured based on the membership of mtDNA clades (I, II, III and IV). The relationships between clades are shown on the left side of the map (see details in Figure 2). (d) Populations are presented as pie charts in which individuals are coloured based on the membership of microsatellite clusters (I, II, III, IV and mixed, see Figure 4).
Figure 4

Statistical parsimony networks for four nuclear markers and species tree.

Networks for Chd1 (a), SWS1 (b), THY (c) and USP9x (d). Each circle in the network represents a single haplotype and the circle size is scaled by the haplotype frequency. Filled black circles represent missing or unsampled haplotypes. The numbers in the network represent mutational steps between haplotypes. (e) Species tree of R. sinicus lineages and outgroups estimated on the basis of four nuclear genes. Node support is indicated with posterior probabilities.

To distinguish between these three broad hypotheses, we sampled individuals of R. sinicus from across China, including both putative subspecies, and generated multilocus datasets consisting of two mitochondrial genes, five nuclear genes and nine microsatellite loci. We then conducted a range of phylogenetic, demographic and coalescent analyses that together provide information on the history of lineage divergence and gene flow among these taxa.

Materials and Methods

Ethics Statement

Our procedure of sampling consisted of taking wing membrane biopsies from animals, and was approved by the National Animal Research Authority, East China Normal University (approval ID 20080209). Bats were captured using mist nets at cave exits, and the bats were measured, sampled and subsequently released in situ.

Bat Capture and Measurement, Sample Collection and DNA Extraction

We collected data from individuals of R. sinicus from 41 localities across the Chinese mainland, including the known range of septentrionalis in Yunnan Province, and the offshore Hainan Island (Figure 2c and Table 1). Bats were captured in mist nets set at cave exits and, for each individual, a wing membrane biopsy was taken and stored in 95% ethanol at −20°C until genomic DNA was extracted using Qiagen kits. Additionally, the forearm of each individual was measured with dial calipers, and the body mass obtained using Pesola spring scales. For a subset of bats, we also recorded the echolocation call resting frequency while in the hand using the Avisoft UltraSoundGate 116Hnb kit (Avisoft, Berlin, Germany) connected to a laptop. Spectrograms were analysed using Avisoft-SASLab Pro software (Avisoft) and the constant frequency of the second harmonic was extracted from a series of three consecutive pulses.
Table 1

Summary of the number and sampling locality of individuals used in the molecular analyses.

NoLocalityCoordinatesCode Cytb ND1 Chd1 SWS1 THY USP9x Microsatellites
1Qingyang, AnhuiN30∶20:511 E117∶50:128AJ1111111
2Jingxian, AnhuiN30∶26:785 E118∶24:783AJ6212116
3Huashanmiku, AnhuiN29∶45:199 E118∶23:331AJ72421111
4Sanling mountain, JiangxiN29∶22:112 E117∶34:324AJ81621112
5Qingfeng cave, JiangxiN29∶22:262 E117∶39:357AJ5111115
6Qinhui cave, JiangxiN29∶22:662 E117∶32:335AJ512116
7Longhu mountain, JiangxiN28∶04:107 E116∶58:227JF5122116
8Lijia country, JiangxiN28∶06:726 E116∶59:282JF81531113
9Wuyishan baohuqu, FujianN27∶44:000 E117∶40:000JF102952226
10Wuyishan tiliqiao, FujianN27∶44:543 E117∶29:953JF111112
11Wuyishan Yanzijiao, FujianN27∶48:511 E117∶42:505JF11112
12Taihe, Jiangxi provinceN26∶36:151 E114∶12:734JF8232116
13Jinggang mountain, JiangxiN26∶31:215 E115∶06:610JF212112
14Xingguo, JiangxiN26∶19:314 E115∶35:229JF3231115
15Taining, FujianN26∶42:236 E117∶29:867JF41541111
16Jiangle, FujianN26∶39:537 E117∶34:387JF4221124
17Mingxi, FujianN26∶21:440 E117∶11:398JF21112
18Yongan, FujianN25∶51:500 E117∶17:000JF111112
19Liancheng, FujianN25∶12:404 E117∶15:066JF4232224
20Shanghang, FujianN25∶15:020 E116∶49:009JF2121114
21Guilin, GuangxiN25∶16:278 E110∶17:009GG82234610
22Ruyuan, GuangdongN24∶59:086 E113∶08:523GG111111
23Luofushan, GuangdongN23∶15:589 E114∶03:656GD5263326
24Zhangjiajie, HunanN29∶21:410 E110∶34:783HG72121210
25Yongshun, HunanN29∶03:720 E109∶38:358HG11224
26Jishou, HunanN28∶18:208 E109∶39:175HG103213312
27Fenghuang, HunanN27∶59:580 E109∶33:786HG1112
28Wuchuan, GuizhouN28∶34:237 E107∶54:058HG211111
29Anlong, GuizhouN25∶16:577 E105∶31:931HG2111111
30Emeishan, SichuanN29∶34:803 E103∶24:708SC3232223
31Huize, YunnanN26∶42:000 E103∶30:000YN71112111
32Jiuxiang, YunnanN25∶07:000 E103∶22:000YN111111
33Fumin, YunnanN25∶11:796 E102∶27:863YN323
34Yongde, YunnanN24∶21:427 E099∶02:161YN106539411
35Yinggeling, HainanN19∶04:982 E109∶33:107HND72893219
36Wuzhishan, HainanN18∶46:309 E109∶31:012HND2133113
37Qiongzhong, HainanN18∶49:589 E110∶00:435HND332213
38Baoqing, HainanN18∶42:237 E109∶41:528HND1111113
39Lingshui, HainanN18∶38:586 E109∶57:636HND3311115
40Jianfengling, HainanN18∶47:275 E108∶57:364HND111111
41Maogan, HainanN18∶36:306 E109∶26:776HND313
Total1655994666156263
The taxonomic status of each individual was initially established on the basis of forearm length following reference [17], and validated retrospectively with molecular data and echolocation call frequencies (see Results). This led to us classifying the bats into four geographical groups, each containing several localities as follows: East (AJ, JF, GG and GD), Central (SC and HG), Hainan Island (HND) and Yunnan (YN), of which the first three were sinicus and the latter was septentrionalis (also Figure 2c).

DNA Sequencing and Phylogenetic Analyses

We amplified and sequenced two mitochondrial genes (Cytb and ND1), three autosomal (Chd1, SWS1 and THY), one X-chromosomal (USP9x) and one Y-chromosomal (Dbx) genes. Information on the samples and primers for these markers are summarized in Table 1 and Table 2, respectively. PCR was performed in 50 µl reaction mixtures containing 10–50 ng DNA, 0.25 mM of each primer and 25µl Premix Taq polymerase (TaKaRa). The thermal profile for each marker has been described previously (see references in Table 2). PCRS were carried out on a PTC-220 thermal cycler (Bio-Rad).
Table 2

Details of primers used in this study.

Molecular markersIDLength(bp)Primers (5′->3′)Reference
Cytochrome b Cytb 491F: TAGAATATCAGCTTTGGGTG [68]
R: AAATCACCGTTGTACTTCAAC
NADH dehydrogenase 1 ND1 957F: CCTCGATGTTGGATCAGG [69]
R: GTATGGGCCCGATAGCTT
Nucleosome remodeling factor Chd1 424F:GATAARTCAGARACAGACCTTAGACG [70]
R: TTTGGCATTCACCTGYACTCC
Short-wavelength-sensitive opsin SWS1 510F: CACAGGCTATGGTGCTGACTT [62]
R: GCCCGTGGGGATGGCTATTGA
Thyrotropin THY 381F: GGGTATGTAGTTCATCTTACTTC [71]
R: GGCATCCTGGTATTTCTACAGTCTTG
Ubiquitin specific protease 9 X USP9x 591F: GGCAGACAGGTTGATGAC TTGGA [70]
R: AGGTCTGCAACTTGC CAAAGG AA
DEAD box RNA helicase Y Dby 234F: GGTCCAGGAGARGCTTTGAA [70]
R: CAGCCAATTCTCTTGTTGGG
For sequencing, we used the forward primer of each mitochondrial gene and both primers of each nuclear gene. The products were analysed on an ABI PRISM 3700 automated sequencer (Applied Biosystems). Heterozygous sites in the nuclear gene sequences were identified by the presence of clear double overlapping peaks in both the forward and reverse sequence chromatograms. Haplotypes were resolved unambiguously if there was only one heterozygous site, and, for sequences with more than one heterozygous site, we resolved haplotypes probabilistically using PHASE version 2.1 [23]. The sequences were aligned using CLUSTAL_X 1.83 [24] and edited by eye with BIOEDIT version 7.0.0 [25]. All sequences obtained in this study were deposited in GenBank (accession numbers: JN650618–JN651091 and JN651094–JN651146). For each region the number of haplotypes, haplotype diversity and nucleotide diversity was calculated using DnaSP 4.0 [26]. Phylogenetic analyses were performed for both Cytb and concatenated mtDNA sequences (Cytb and ND1). To investigate the relationship between the two recognized subspecies of R. sinicus we also incorporated Cytb data from two outgroups: R. thomasi from the rouxii-group, and R. affinis from a different clade (accession numbers FJ85215 and DQ297582 respectively). To establish phylogenetic consensus we implemented maximum parsimony (MP) and neighbor joining (NJ) in PAUP* 4.0b10 [27], Bayesian Inference (BI) in MrBayes 3.1.2 [28] and maximum-likelihood (ML) in PhyML [29]. For MP, we used heuristic searching with tree-bisection-reconnection and branch swapping. Characters were treated as equally weighted and unordered. Node support was estimated based on 1000 bootstraps. We used MODELTEST 3.0 [30] to determine the best-fit substitution models to be HKY+G [G = 0.092] for Cytb and HKY+G [G = 0.102] for concatenated mtDNA. For BI, we performed two simultaneous runs of Metropolis-coupled Markov chain Monte Carlo (MCMC) analysis using the chosen molecular evolution model parameters, each comprising four chains and 10 million generations. Trees and parameters were sampled every 100 generations, and the first 25% of the sampled trees were discarded as a burn-in. For NJ and ML, node supports were estimated based on 1000 bootstraps. The best topology was compared with several alternative candidate hypotheses using PAUP and CONSEL [31]. Log-likelihoods of site-pattern trees estimated with PAUP were used by CONSEL to calculate the P-values for several statistical tests for which only the Approximately Unbiased (AU) test and Shimodaira-Hasagawa (SH) test [32] are presented here. At the intraspecific level, bifurcating trees may not be the most appropriate way to represent genealogical relationships among haplotypes [33], and therefore, we also constructed networks based on Cytb and concatenated mtDNA haplotypes using the maximum parsimony method implemented in TCS version 1.21 [34]. Ambiguous connections were resolved based on the criteria of topology, frequency and geography [35]. To estimate the time to the most recent common ancestor (TMRCA) for each mtDNA (Cytb) clade (see Figure S2), we used a Bayesian MCMC approach implemented in BEAST version 1.4.6 [36]. A HKY+G [G = 0.01] substitution model for Cytb dataset without outgroup estimated by MODELTEST, and a relaxed-clock model with an uncorrelated lognormal distribution for the substitution rate, were applied. We used a substitution rate of 0.02/Myr based on a divergence rate of 4%/Myr for Cytb obtained for Pipistrellus bats [37]. We performed two independent runs of 107 generations, each with a burn-in of 106 generations, and sampled every 1000 steps. These two runs were then combined in TRACER version 1.4 [38], which were also used to examine the effective sample size (ESS) for each parameter. For each nuclear gene, phylogenetic relationships among reconstructed haplotypes were displayed using haplotype networks. To infer the species phylogeny from these multiple nuclear sequences, as well as infer each gene tree, we used the Bayesian approach in BEST 2.0 that takes account the coalescent process [39], [40]. For this analysis, run at the Computational Biology Service Unit at Cornell University, model parameters for each marker were estimated using MODELTEST. The priors for theta were an inverse gamma distribution (3, 0.003) and the priors for gene mutation were a uniform distribution (0.5, 1.5). We performed two runs of Metropolis-coupled MCMC, each comprising four chains and 20 million generations. Trees and parameters were sampled every 100 generations, and the first 25% of the sampled trees were discarded as a burn-in. A consensus tree was constructed from the estimated posterior distribution and used as the estimated species tree [39].

Hypothesis Testing of Lineage Divergence

To test probabilistically among alternative hypotheses for the history of lineage divergence, we used the approximate Bayesian computation procedure (ABC, [41]) in DIY ABC v1.0.4.37 [42]. ABC analyses were applied to sequences of the concatenated mtDNA data as well as three informative nuclear genes (THY was excluded because it contains indels and has less informative sites). We tested the following three competing scenarios: (1) septentrionalis arose recently via divergence from Central sinicus following a more ancient divergence between the common ancestor of these taxa, and lineages of sinicus from the East and Hainan. We also incorporated a bottleneck early in the history of septentrionalis, because of its small population size. This scenario corresponds approximately to our hypothesis 2 in the Introduction. Scenario (2) is the same as (1) but without the bottleneck. In scenario (3) septentrionalis was considered the ancestor of all R. sinicus with a subsequent divergence between Central sinicus and East/Hainan sinicus (see details in Figure S1). In the first scenario, a population size with the prior of 10–104 individuals and with a bottleneck of 1 to 1000 generations was used as the founding population for septentrionalis. A total of 3 million datasets were simulated, of which the 1% closest to the observed data were used to estimate the relative posterior probabilities of each scenario via a logistic regression approach [43]. Equal prior probability was set for each scenario.

Microsatellite Genotyping

Nine primer pairs developed for R. sinicus [44] were used to screen a total of 263 bats. PCRs were undertaken in 15 µl reaction volumes (containing 50–100 ng genomic DNA, 0.25 mM forward primer (labeled with FAM, HEX or TAMRA), 0.25 mM unlabeled reverse primer, 0.2 mM of each dNTP, 0.2 U Hotstar Taq DNA polymerase (Qiagen) and 1.5 mM MgCl2) with the thermal profile: initial denaturation step at 95°C for 15 min, followed by 35 cycles of 30 s at 94°C, 30 s at (55–66°C) and 30 s at 72°C and final extension step at 72°C for 20 min. Sample information for each locality is summarized in Table 1. The products were visualized on an ABI 3730 sequencer and analyzed with GeneMapper v3.7 (ABI). Only individuals genotyped at over seven loci were used in subsequent analyses. Data were checked for possible null alleles and genotyping errors with Micro-checker v2.2.3 [45]. GENEPOP v3.4 [46] was used to test for deviation from Hardy–Weinberg equilibrium (HWE) and linkage equilibrium (LE) among all loci across all populations. To quantify genetic diversity per region, we calculated allelic richness (standardized for n = 3) using FSTAT [47], and we calculated the mean number of alleles per locus, the number of private alleles and expected and observed heterozygosity using GDA [48].

Microsatellite-based Population Genetic Analyses

To assess the relationship among populations, we used STRUCTURE 2.2 [49] to assign individuals to clusters, for cases of 2 to 8 clusters (K) in the data, the upper limit corresponding to the number of regions in the study data [12], [14]. We performed ten replicate runs (106 iterations and with an initial burn-in of 105 iterations per run) and used the admixture model. The most likely number of clusters was inferred based on the method described in [50]. Similar replicate runs were grouped based on the symmetric similarity coefficient of >0.9 using the Greedy algorithm in CLUMPP [51] and visualized using DISTRUCT 1.1 [52]. To complement the results of STRUCTURE, we used GENELAND [53] and TESS [54], which can incorporate the spatial coordinates of individuals when uncovering population structure. For both analysis, we performed ten independent runs from K = 2 to 8, with 106 iterations and a burn-in of 10%. Finally, we repeated ABC analyses for microsatellite data, again using DIY ABC v1.0.4.37 [42]. Details of the scenarios tested are described above and shown in Figure S1. In this analysis, a total of 1.5 million datasets were simulated, of which the 1% closest to the observed data were used to estimate the relative posterior probabilities of each scenario via a logistic regression approach.

Estimates of Gene Flow

To test for gene flow between septentrionalis and adjacent populations of sinicus, we used the isolation with migration (IM) model [9] implemented in the program IM [55]. The IM model assumes that the populations under study are panmictic, and that the markers are selectively neutral and free from recombination. We tested for recombination by calculating the minimum number of recombination events (Rm) based on four-gamete test [56] and we tested for neutrality using the McDonald–Kreitman test [57] and the Hudson–Kreitman–Aguade test [58]. These analyses were conducted in DnaSP. We did not detect deviation from neutral expectations for all markers; however, there was some evidence of recombination for sections of sequence of Cytb, Chd1 and SWS1, and only nonrecombined regions were used in the subsequent IM analyses. IM analyses were performed for four datasets: (i) mtDNA (Cytb), (ii) combined ncDNA (USP9x, Chd1, SWS1 and THY), (iii) combined mtDNA and ncDNA, and (iv) microsatellites. To incorporate differences in the effective population size of the markers, we set inheritance scalars as follows: 0.25 for Cytb, 0.75 for the X-linked locus USP9x and 1 for the three other nuclear genes (Chd1, SWS1 and THY) and also for the microsatellites. Scaled directional migration rates (m =  m1/u and m =  m2/u; u is mutation rate per locus per year) were estimated between septentrionalis and adjacent populations of sinicus. Preliminary runs with large parameter intervals were used to determine the starting values of prior distributions for the subsequent runs. Three final runs were conducted with different random seeds and a single chain with a burn-in of 107 steps for 2×108 iterations. For the sequence datasets, each run included five MCMCs with ten multiple chain-swapping attempts, and a geometric heating scheme with the heating terms h1 set to 0.05. For the microsatellites dataset, each run included eight MCMCs with 25 multiple chain-swapping attempts, and a geometric heating scheme with the heating terms h1 and h2 set to 0.05 and 2.

Results

In total, we captured and measured 396 bats, of which we recorded the echolocation calls of 130 individuals and undertook genetic analyses on 263 individuals.

Morphological Data and Echolocation Call Frequency

Individual bats initially assigned to sinicus showed similar body size and echolocation call frequencies across the study region, with considerable overlap among bats captured from the regions Central, East and Hainan Island. In contrast, bats captured in Yunnan Province around the type locality of septentrionalis were characterized as having larger forearms and lower echolocation call frequencies than bats from neighbouring areas, consistent with the presence of a distinct taxon in this area. For a summary of these findings see Figure 2a and b.

Mitochondrial DNA Sequences

The alignment of Cytb (491 bp) from 165 individuals contained 56 haplotypes with 66 polymorphic sites, and the alignment of ND1 (957 bp) from 59 individuals contained 28 haplotypes with 88 polymorphic sites. No premature stop codons were observed in either of these genes, suggesting they are functional mitochondrial genes rather than nuclear copies. When concatenated, the mtDNA alignment spanned 1448 bp, and data from 59 individuals contained 40 haplotypes with 124 polymorphic sites. Phylogenetic tree and network analyses indicated that R. sinicus is a monophyletic grouping to the exclusion of the closely related congener R. thomasi (see Figure S2), supporting the sister relationship of the two subspecies sinicus and septentrionalis. Within R. sinicus, all tree-building methods recovered similar topologies in which four well-supported clades were resolved, corresponding closely to East, Hainan Island, Central and Yunnan, hereafter referred to as clades I, II, III and IV, respectively (Figures 2 and 3). Two haplotypes from Hainan (clade II) were exceptions to this trend, and were classified with haplotypes from the East (clade I). Surprisingly, sinicus bats from the Central area showed a closer relationship with septentrionalis than with other sinicus lineages. The AU and SH tests both supported the current topology and were able to reject the alternative phylogenetic hypothesis ([(IV,(III,II,I))]; AU test, P<0.001; SH test, P = 0.03). Consistent with the tree results, network analysis for concatenated mtDNA recovered three networks with a 95% connection limit, corresponding to clade I, II and III+IV, respectively (Figure 3).
Figure 3

Maximum parsimony tree and statistical parsimony network based on concatenated mtDNA sequences.

(a) The phylogenetic tree. Node support is indicated with MP, NJ and ML bootstrap values and Bayesian posterior probabilities (given above and below the branch, respectively). (b) The network with a 95% connection limit. Each circle represents a single haplotype and the circle size is scaled by the haplotype frequency. Filled black circles represent missing or unsampled haplotypes. The numbers in the network represent mutational steps between haplotypes.

Maximum parsimony tree and statistical parsimony network based on concatenated mtDNA sequences.

(a) The phylogenetic tree. Node support is indicated with MP, NJ and ML bootstrap values and Bayesian posterior probabilities (given above and below the branch, respectively). (b) The network with a 95% connection limit. Each circle represents a single haplotype and the circle size is scaled by the haplotype frequency. Filled black circles represent missing or unsampled haplotypes. The numbers in the network represent mutational steps between haplotypes. For the Cytb dataset, the samples from Yunnan contained the lowest level of nucleotide diversity followed by those from the Central area (Table 3). In contrast, the samples from Hainan and the East showed very high levels of nucleotide diversity, indicating a long and stable evolutionary history or just a mixture of different evolutionary lineages. The latter scenario is supported by the observation of divergent lineages within the East samples and of several haplotypes seen in Hainan samples also nested within the East clade.
Table 3

Summary of genetic diversity for five gene sequences and eight microsatellite loci in eight regions of R. sinicus.

GenesParameters\regionsAJJFGGGDEastHGSCCentralHNDYN
Cytb N1325595101233261721
n8194432831175
h0.7240.8930.6940.9000.9020.5811.0000.6740.7720.681
π(%)0.2140.6740.3280.8550.6520.3280.4070.4491.4800.376
Chd1 N215382661437177
n2212211122
h0.4950.4830.5710.4800.3820.286
π(%)0.1170.1140.1350.1130.9920.067
SWS1 N39234339527174
n813321852774
h0.9560.9130.8330.6670.9111.0001.0001.0000.7721.000
π(%)0.6430.6210.2950.1310.5842.6300.9842.1100.4022.940
THY N461453288210814
n2221352625
h0.2860.3660.5240.3400.8330.6670.8030.5300.450
π(%)0.0750.0960.1500.0920.6560.1750.5370.1400.128
USP9x N56167231921186
n1261662611
h0.1250.9520.4880.8891.0000.873
π(%)0.0210.3540.1230.2910.3380.283
Mean π(%)0.2280.7330.3840.784
MicrosatellitesN64095116152303334323
A6.49.55.64.811.99.83.512.38.910.0
HE 0.6550.6450.6770.6270.6730.7590.7000.7590.6980.807
HO 0.6530.6250.6930.5830.6360.7130.6250.7050.6800.750
RS 3.153.183.363.243.363.993.633.983.474.06
Private alleles3(0)5(0)2(1)012(1)3(3)5(0)8(3)

N1–N6, sample sizes for genes and microsatellite loci; n, number of haplotypes observed; h, haplotype diversity; π(%), nucleotide diversity; mean π(%), mean nucleotide diversity of four nuclear genes. A, mean number of alleles per locus; HE, expected heterozygosity; HO, observed heterozygosity; Rs, allele richness standardized by three individuals. The numbers of private alleles with >10% frequency are shown in parentheses.

N1–N6, sample sizes for genes and microsatellite loci; n, number of haplotypes observed; h, haplotype diversity; π(%), nucleotide diversity; mean π(%), mean nucleotide diversity of four nuclear genes. A, mean number of alleles per locus; HE, expected heterozygosity; HO, observed heterozygosity; Rs, allele richness standardized by three individuals. The numbers of private alleles with >10% frequency are shown in parentheses. Bayesian estimates of the TMRCA performed in BEAST provided reliable estimates of all parameters with ESS >500. The inferred TMRCA for all Cytb sequences was around 1.5 MYA, corresponding to the early Quaternary. TMRCA estimates obtained for all septentrionalis (clade VI) and for all Central sinicus (clade III) were similar to each other, both estimated to be around 0.3 MYA. This date was more recent than that of the East sinicus (clade I) but older than Hainan (clade II) (see details in Table 4).
Table 4

Mean estimates of TMRCA with 95% credible intervals for each clade or group of clades based on Cytb data.

CladeMean (Myr)95% C.I. (Myr)
clade I0.480.24–0.78
clade II0.180.05–0.37
clade I +II0.990.53–1.57
clade III0.330.16–0.52
clade IV0.320.12–0.53
clade III+IV0.480.23–0.76
clade I+III+IV1.300.72–2.07
clade II+III+IV1.200.64–1.94
clade I+II+III+IV1.510.84–2.42

Nuclear DNA Sequence Analyses

Within R. sinicus all nuclear markers were polymorphic except for Dby which was invariant across the bats screened here and, therefore, discarded prior to genetic analyses. The alignment of Chd1 (424 bp) from 94 individuals included 5 haplotypes based on 4 polymorphic sites and 11 indels. The alignment of SWS1 sequences (510 bp) from 66 individuals included 33 haplotypes based on 32 polymorphic sites and 20 indels. The alignment of THY (381 bp) from 61 individuals included 12 haplotypes based on 6 polymorphic sites and 10 indels. The alignment of USP9x sequences (591 bp) from 56 individuals included 12 haplotypes based on 12 polymorphic sites. Levels of nucleotide diversity were not consistent across four ncDNA markers (see Table 3). Overall, Yunnan and the Central area showed the highest mean levels of nucleotide diversity (π(%), 0.784 and 0.733, respectively). The levels recorded in the East were significantly lower (0.228; t = −4.667, df = 3, P = 0.018), and the Hainan population was also lower than the population from Yunnan, although this was not significant (0.384; t = −1.826, df = 3, P = 0.165). Haplotype networks reconstructed for Chd1 and SWS1 both resolved two sub-networks, broadly corresponding to sinicus and septentrionalis (Figure 4a and b). The exception is that one SWS1 haplotype from Central sinicus showed a closer relationship to septentrionalis haplotypes than to other haplotypes of sinicus. Between the sub-networks there were two transversions in the Chd1 network and over ten mutational steps in the SWS1 network. Within sinicus, haplotypes of Hainan were seen to be very divergent from those from the East and Central; specifically, in the Chd1 network, most individuals from Hainan were separated from those of other sinicus with ten indels, while in the SWS1 network all Hainan haplotypes clustered together. In contrast to Chd1 and SWS1, the network analysis for THY and USP9x did not recover clear subspecies, and instead, individuals of septentrionalis were mixed with Central and Hainan sinicus (Figure 4c and d).

Statistical parsimony networks for four nuclear markers and species tree.

Networks for Chd1 (a), SWS1 (b), THY (c) and USP9x (d). Each circle in the network represents a single haplotype and the circle size is scaled by the haplotype frequency. Filled black circles represent missing or unsampled haplotypes. The numbers in the network represent mutational steps between haplotypes. (e) Species tree of R. sinicus lineages and outgroups estimated on the basis of four nuclear genes. Node support is indicated with posterior probabilities. The species tree estimated from the four nuclear markers in BEST supported the reciprocal monophyly of septentrionalis and sinicus with high node support (Figure 4e). Moreover, East sinicus showed a closer relationship with Hainan sinicus than with Central sinicus, consistent with the mtDNA tree. No evidence for allele dropout and scoring error due to stuttering was detected using Micro-checker except for one locus (SM24) which was deleted in the subsequent analysis. We detected no significant departure from Hardy-Weinberg equilibrium after Bonferroni correction, although significant departure from linkage equilibrium was detected between SF77 and SN30 in several locations of AJ and JF. Genetic diversity decreased broadly from the west (i.e. Yunnan and the Central area) to the east (i.e. East and Hainan) (see Table 3). Private alleles with the frequency over 10% were observed in GG, HG, SC and YN. Among them, one allele with a frequency of 28% in Yunnan was private to septentrionalis, and thus private to this subspecies. Clustering at a range of values of K using STRUCTURE not only revealed substantial phylogeographic structure but also recovered hierarchical relationships among populations. Individuals of East sinicus were firstly separated from others at K = 2 (Figure 5), so conflicted with mtDNA and ncDNA sequence analyses in which Hainan showed a closer relationship with East sinicus than with Central sinicus+septentrionalis (Figures 3 and 4). This subdivision showed the highest value of ΔK (Figure S3). However, further substructuring was observed when increasing the value of K. Specifically, at K = 3, Hainan was separated from Central sinicus+septentrionalis. Further clustering was observed within East at K = 4. At K = 5, septentrionalis and Central sinicus finally became separate clusters. When increasing the value of K, further clusters were only detected in East sinicus but the clustering patterns were generally uninformative. Clustering conducted in GENELAND and TESS revealed similar patterns as STRUCTURE at K = 2 and 3 (data not shown), although septentrionalis was separated from the Central sinicus at K = 4 (Figures S4 and S5). The four clusters detected were generally concordant with the four mtDNA clades and four geographic groups (East, Central, Yunnan and Hainan), respectively (Figures 2c and d, S4 and S5).
Figure 5

Clustering of R. sinicus individuals in STRUCTURE based on microsatellite genotypes.

Clusters are shown for values of K = 2 to 5 inclusive. The mtDNA clade relationships are shown above the four cluster plots.

Clustering of R. sinicus individuals in STRUCTURE based on microsatellite genotypes.

Clusters are shown for values of K = 2 to 5 inclusive. The mtDNA clade relationships are shown above the four cluster plots.

ABC Analysis

ABC analysis provided good support for the scenario of an ancient divergence between septentrionalis and sinicus with later divergence between Central sinicus and East/Hainan sinicus based on both DNA sequences and microsatellites datasets (scenario 3 in Figure S1, DNA sequences data, posterior probability = 1, the type I error rate is 0.25; microsatellite data, posterior probability = 1, the type error rate is 0.64). Three independent IM analyses produced similar posterior distributions with effective sample sizes of >500 for all parameters, suggesting convergence on the true stationary distribution. Posterior probability distributions for migration rate based on four classes of datasets all had clear peaks and bounds within the prior distributions (Figure 6). The posterior mode and 90% credible intervals for migration rates are shown in Table 5. Estimates of gene flow using IM were markedly different among the four classes of markers used. Based on mtDNA, a moderate level of unidirectional gene flow was observed from septentrionalis (Yunnan) to the Central population of sinicus. In contrast, very restricted or no gene flow was detected between Yunnan and Central in either direction when IM analyses incorporated microsatellite data or ncDNA sequences, either alone or with mtDNA (see Table 5 and Figure 6).
Figure 6

The marginal posterior probability distributions of migration rates between Central sinicus and septentrionalis.

The IM analysis was performed for mtDNA, combined nuclear gene sequences, combined mtDNA and nuclear gene sequences and microsatellites, respectively.

Table 5

IM estimates of posterior mode and 90% credible intervals for directional migration rates (m and m).

Migration rate/markersMtDNACombined ncDNACombined mtDNA and ncDNAMicrosatellite
Central vs YN
m1 0.7920.0050.0030.068
90% CI0.298–1.4780.001–1.4970.001–1.6610.008–0.162
m2 0.0020.0050.0020.002
90% CI0.001–0.4140.001–1.6030.001–0.8180.001–0.131

The marginal posterior probability distributions of migration rates between Central sinicus and septentrionalis.

The IM analysis was performed for mtDNA, combined nuclear gene sequences, combined mtDNA and nuclear gene sequences and microsatellites, respectively.

Discussion

The Origin of septentrionalis and its Relationship with sinicus

Morphological, echolocation and nuclear DNA sequence data collected from Rhinolophus sinicus from across China supported the occurrence of the two subspecies septentrionalis and sinicus. Furthermore, phylogenetic results showed that these together form a monophyletic group and are thus true sister taxa although samples from its related taxa (e.g. R.thomasi and R.rouxii) will be needed to confirm this suggestion in the future. Therefore, of our three original hypotheses proposed to account for the origin and restricted range of septentrionalis nested within sinicus, we are able to reject the first scenario that the current taxonomy is incorrect, and so must consider the alternative explanations. MtDNA gene trees and microsatellite-based clustering together revealed three divergent lineages within the subspecies sinicus, corresponding to Central China, East China and the offshore Hainan Island. However, contrary to morphological data, the Central lineage showed an unexpected closer relationship with septentrionalis than with other lineages of sinicus. The paraphyletic arrangement of sinicus with respect to septentrionalis could arise if, as stated in Hypothesis 2, the latter subspecies had recently evolved in situ from a Central lineage of its more widespread sister subspecies. However, phylogenetic discordance can also result from other processes such as incomplete lineage sorting of ancestral polymorphism or past mtDNA introgression [59], [60], which first need to be ruled out before accepting a recent origin of septentrionalis. Several pieces of evidence in our study suggest that incomplete lineage sorting is an unlikely cause of the observed sinicus mtDNA paraphyly. First, the mtDNA haplotypes causing discordance were not distributed randomly across the range of sinicus as would be expected if this had been due to stochastic incomplete lineage sorting [2], but instead appeared in the parapatric regions of these two subspecies. Additionally, if incomplete lineage sorting had led to mtDNA paraphyly in sinicus, then we might expect to see similar patterns in the genealogies of nuclear genes given their larger effective population sizes [61], whereas we observed almost exclusive monophyly of each subspecies based on the markers Chd1 and SWS1 (Figure 4a and b). At the same time, however, such conflicts between mtDNA and ncDNA networks, plus the geographically localized nature of the discordant haplotypes, add considerable weight to the possibility of asymmetrical mtDNA introgression between female septentrionalis in Yunnan and male sinicus in the adjoining Central areas. This scenario also received support from the results of the IM analysis that indicated moderate mtDNA gene flow from septentrionalis to Central sinicus (Table 5). Similar cases of historical and contemporary introgression among related horseshoe bat taxa have been reported previously, and also appear to occur asymmetrically [12], [62]. For more formal tests of the hypotheses of a derived origin of septentrionalis versus introgression with sinicus, we applied coalescent-based phylogenetic reconstruction and Approximate Bayesian computation (ABC). From the former analysis, we found that contrary to expectations, the estimated species tree showed septentrionalis to be ancestral to sinicus (Figure 4e) and, therefore, a recent origin of this former subspecies (hypothesis 2) can be ruled out. It is noteworthy that septentrionalis was also found to show higher nuclear genetic diversity than regional populations of sinicus (Table 3), and was also characterized by a private yet frequent (28%) microsatellite allele. Such findings contradict predictions of a recent origin of septentrionalis but are consistent with a long evolutionary history of septentrionalis. ABC analysis also strongly supported the scenario of septentrionalis as the ancestor of all R. sinicus bats, although the type I error rate was high based on the microsatellite data. On the other hand, IM results offered further evidence of asymmetric mtDNA gene flow from septentrionalis into central populations of sinicus yet no nuclear gene flow, so again strongly pointing to historical mtDNA introgression.

The History and Possible Causes of Lineage Divergence in R. sinicus

Accepting an ancient origin of septentrionalis, with subsequent mtDNA introgressive hybridisation with sinicus, raises questions about the likely forces that have led to the relative distributions of these taxa. Our results from mtDNA and microsatellites both revealed high genetic differentiation and strong phylogeographic structuring within R. sinicus, with four independent lineages resolved, i.e. septentrionalis and three sinicus lineages from Central, East and Hainan (see Figure 2c and d). Similar to the congeneric horseshoe bat R. affinis [12] in which the divergence dates between each mtDNA clade corresponded well to the period of glaciations in Pleistocene, strong phylogeographic differentiation within R. sinicus might result from the effects of Pleistocene climatic fluctuations. Specifically, TMRCA obtained for all R. sinicus Cytb sequences was estimated to be around 1.5 million years BP, while TMCRA estimates for septentrionalis and Central sinicus were similar (95% CI 140,000–500,000 years BP). This latter period coincides with the penultimate glacial period of Pleistocene [63] when numerous species will have undergone range contractions into multiple refugia where isolation could have promoted genetic divergence via drift [10]. Evidence for refugia in the east and southwestern plateaus of China has been reported by previous phylogeographic studies, e.g. in frogs [13] and in bats [14], [15]. In our study, a refugium in the southwest is indicated by high nuclear diversity observed in septentrionalis, and one in the East by both high mtDNA diversity and an ancient TMRCA estimate for bats in this region. Similarly, the Central area harbours high genetic diversity (mtDNA and ncDNA), shows morphological distinctiveness [64], and represents an independent lineage in phylogenetic analyses, so might have originated from yet another refugial area. Given the distribution of R. sinicus, the observed strong genetic differentiation among lineages might have also been caused, at least in part, by geological and ecological differences between regions associated with the dramatic uplift of Qinghai-Tibetan Plateau (QTP) in the Quaternary [16]. This phenomenon had major consequences for latitudinal climatic clines between the east and the west of East Asia [16], and led to the formation of three marked altitudinal steps that also correspond to different ecological zones (see Figure 1 in ref. [15]). Relating this topography to our focal populations, septentrionalis corresponds to the edge of step 1, the Central sinicus population to step 2, and the East sinicus population to step 3. Because each period of uplift of the QTP had different effects on different regions of East Asia [65], divergent selection might have been a main driver of lineage divergence as well as a barrier to gene flow (see also [66]). Further detailed analysis of the environmental variables in different regions will be needed to test the possible occurrence of divergent selection [67], and work is needed to establish whether past distributions and population sizes also fit with these explanations. Graphic representation of the three scenarios for the history of lineage divergence used in the DIY ABC analysis. Graphs show the logistic regression, showing the posterior probabilities of three tested scenarios. N5 corresponds to a bottleneck lasting a time of db generations. (EPS) Click here for additional data file. Maximum parsimony tree and network based on haplotypes including one sequence of . For the tree, node support is indicated with MP, NJ and ML bootstrap values and Bayesian posterior probabilities (given above and below the branch, respectively). For the network, each circle represents a single haplotype and the circle size is scaled by the haplotype frequency. Filled black circles represent missing or unsampled haplotypes. One unfilled circle represents haplotype of R. thomasi. The numbers in the network represent mutational steps between haplotypes. (EPS) Click here for additional data file. The plots of the log-likelihood value L(K) (a) and delta K value (b) based on ten runs for each values of K from 2 to 8. (EPS) Click here for additional data file. Geographic distributions of genetic clusters identified by GENELAND at K = 4. (EPS) Click here for additional data file. Geographic distributions of genetic clusters identified by TESS at K = 4. (EPS) Click here for additional data file.
  46 in total

1.  Inference of population structure using multilocus genotype data.

Authors:  J K Pritchard; M Stephens; P Donnelly
Journal:  Genetics       Date:  2000-06       Impact factor: 4.562

2.  Intraspecific gene genealogies: trees grafting into networks.

Authors: 
Journal:  Trends Ecol Evol       Date:  2001-01-01       Impact factor: 17.712

3.  Predicting nuclear gene coalescence from mitochondrial data: the three-times rule.

Authors:  S R Palumbi; F Cipriano; M P Hare
Journal:  Evolution       Date:  2001-05       Impact factor: 3.694

4.  CONSEL: for assessing the confidence of phylogenetic tree selection.

Authors:  H Shimodaira; M Hasegawa
Journal:  Bioinformatics       Date:  2001-12       Impact factor: 6.937

5.  Hybridization as an invasion of the genome.

Authors:  James Mallet
Journal:  Trends Ecol Evol       Date:  2005-05       Impact factor: 17.712

6.  CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure.

Authors:  Mattias Jakobsson; Noah A Rosenberg
Journal:  Bioinformatics       Date:  2007-05-07       Impact factor: 6.937

7.  BEST: Bayesian estimation of species trees under the coalescent model.

Authors:  Liang Liu
Journal:  Bioinformatics       Date:  2008-09-17       Impact factor: 6.937

8.  Conflict among individual mitochondrial proteins in resolving the phylogeny of eutherian orders.

Authors:  Y Cao; A Janke; P J Waddell; M Westerman; O Takenaka; S Murata; N Okada; S Pääbo; M Hasegawa
Journal:  J Mol Evol       Date:  1998-09       Impact factor: 2.395

9.  Gene flow and the geographic structure of natural populations.

Authors:  M Slatkin
Journal:  Science       Date:  1987-05-15       Impact factor: 47.728

10.  Phylogeography of the greater horseshoe bat, Rhinolophus ferrumequinum: contrasting results from mitochondrial and microsatellite data.

Authors:  Jon Flanders; Gareth Jones; Petr Benda; Christian Dietz; Shuyi Zhang; Gang Li; Mozafar Sharifi; Stephen J Rossiter
Journal:  Mol Ecol       Date:  2009-01       Impact factor: 6.185

View more
  6 in total

1.  Introgression of mitochondrial DNA promoted by natural selection in the Japanese pipistrelle bat (Pipistrellus abramus).

Authors:  Ji Dong; Xiuguang Mao; Haijian Sun; David M Irwin; Shuyi Zhang; Panyu Hua
Journal:  Genetica       Date:  2014-09-30       Impact factor: 1.082

2.  Heteroplasmy and ancient translocation of mitochondrial DNA to the nucleus in the Chinese Horseshoe Bat (Rhinolophus sinicus) complex.

Authors:  Xiuguang Mao; Ji Dong; Panyu Hua; Guimei He; Shuyi Zhang; Stephen J Rossiter
Journal:  PLoS One       Date:  2014-05-19       Impact factor: 3.240

3.  Gut microbial diversity in two insectivorous bats: Insights into the effect of different sampling sources.

Authors:  Haonan Wu; Yutong Xing; Haijian Sun; Xiuguang Mao
Journal:  Microbiologyopen       Date:  2018-07-03       Impact factor: 3.139

4.  Characterization of Novel Rhabdoviruses in Chinese Bats.

Authors:  Dong-Sheng Luo; Bei Li; Xu-Rui Shen; Ren-Di Jiang; Yan Zhu; Jia Wu; Yi Fan; Hervé Bourhy; Ben Hu; Xing-Yi Ge; Zheng-Li Shi; Laurent Dacheux
Journal:  Viruses       Date:  2021-01-05       Impact factor: 5.048

5.  The evolutionary history of ACE2 usage within the coronavirus subgenus Sarbecovirus.

Authors:  H L Wells; M Letko; G Lasso; B Ssebide; J Nziza; D K Byarugaba; I Navarrete-Macias; E Liang; M Cranfield; B A Han; M W Tingley; M Diuk-Wasser; T Goldstein; C K Johnson; J A K Mazet; K Chandran; V J Munster; K Gilardi; S J Anthony
Journal:  Virus Evol       Date:  2021-02-05

6.  Coexistence of two sympatric cryptic bat species in French Guiana: insights from genetic, acoustic and ecological data.

Authors:  Ondine Filippi-Codaccioni; Marie-Pauline Beugin; Damien M de Vienne; Elodie Portanier; David Fouchet; Cecile Kaerle; Lina Muselet; Guillaume Queney; Eric J Petit; Corinne Regis; Jean-Baptiste Pons; Dominique Pontier
Journal:  BMC Evol Biol       Date:  2018-11-20       Impact factor: 3.260

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.