Literature DB >> 23236393

Mechanism analysis of acid tolerance response of bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing.

Junhua Jin1, Bing Zhang, Huiyuan Guo, Jianyun Cui, Lu Jiang, Shuhui Song, Min Sun, Fazheng Ren.   

Abstract

To analyze the mechanism of the acid tolerance response (ATR) in Bifidobacterium longum subsp. longum BBMN68, we optimized the acid-adaptation condition to stimulate ATR effectively and analyzed the change of gene expression profile after acid-adaptation using high-throughput RNA-Seq. After acid-adaptation at pH 4.5 for 2 hours, the survival rate of BBMN68 at lethal pH 3.5 for 120 min was increased by 70 fold and the expression of 293 genes were upregulated by more than 2 fold, and 245 genes were downregulated by more than 2 fold. Gene expression profiling of ATR in BBMN68 suggested that, when the bacteria faced acid stress, the cells strengthened the integrity of cell wall and changed the permeability of membrane to keep the H(+) from entering. Once the H(+) entered the cytoplasm, the cells showed four main responses: First, the F(0)F(1)-ATPase system was initiated to discharge H(+). Second, the ability to produce NH(3) by cysteine-cystathionine-cycle was strengthened to neutralize excess H(+). Third, the cells started NER-UVR and NER-VSR systems to minimize the damage to DNA and upregulated HtpX, IbpA, and γ-glutamylcysteine production to protect proteins against damage. Fourth, the cells initiated global response signals ((p)ppGpp, polyP, and Sec-SRP) to bring the whole cell into a state of response to the stress. The cells also secreted the quorum sensing signal (AI-2) to communicate between intraspecies cells by the cellular signal system, such as two-component systems, to improve the overall survival rate. Besides, the cells varied the pathways of producing energy by shifting to BCAA metabolism and enhanced the ability to utilize sugar to supply sufficient energy for the operation of the mechanism mentioned above. Based on these reults, it was inferred that, during industrial applications, the acid resistance of bifidobacteria could be improved by adding BCAA, γ-glutamylcysteine, cysteine, and cystathionine into the acid-stress environment.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23236393      PMCID: PMC3517610          DOI: 10.1371/journal.pone.0050777

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Several species in the genus Bifidobacterium are considered probiotic, and their presence has been associated with healthy microbiota [1]. This has led to their widespread application in probiotic products. During storage, distribution and delivery, bifidobacteria are exposed to acid stress due to the production of organic acid in fermented foods. In addition, during ingestion, bacteria must survive passage through the low-pH environment of the stomach to reach their ecological niche. Acid stress is a major challenge to bifidobacteria. It can cost them their viability and reduce their probiotic effects [2], [3]. Strengthening acid tolerance is critical to survival of Bifidobacterium and therefor of impact on the quality and functionality of the probiotic product. Pre-exposure to sublethal pH has been shown to increase the viability of several bacteria during subsequent exposure to the lethal pH. The phenomenon is known as the acid tolerance response (ATR). There are many studies of ATR in microorganisms, such as Streptococcus mutans [4], [5], Lactococcus lactis [6], [7], [8], Bifidobacterium longum, and Bifidobacterium animalis [9], [10], [11]. Our previous study suggested that the genes involved in ATR in bifidobacteria differed from those of other bacteria [12]. However, there have been very few studies on the mechanism behind ATR in bifidobacteria. Only Waddington et al. and Sanchez et al. have investigated ATR of Bifidobacterium longum. They did so by comparing the 2D-gel protein profile [13], [14]. They demonstrated that the response of the B. longum to acid stress involved the maintenance of pH homeostasis by H+- ATPase and the production of NH3. However, mechanisms underlying acid tolerance used by Gram-positive bacteria are complex. Several mechanisms of ATR in lactic acid bacteria (LAB) have been proposed, including the maintenance of pH homeostasis [5], [15], protecting DNA and protein [16], [17], [18], neutralizing the excessive H+ [19], [20] as well as signal communication [5], [21], [22]. For advising to improve the acid resistance of bifidobacteria in industrial applications, it is necessary to decipher whether and how these mechanisms involve ATR. In order to determine how bifidobacteria combat acid stress, Bifidobacterium longum subsp. longum BBMN68, a novel isolate of a centenarian, was used as a model strain. Previous studies have indicated that BBMN68 was a potential probiotic strain. B. longum subsp. longum BBMN68 demonstrated to improve intestinal function and enhance immunity in healthy mice [23], [24]. The complete genome sequence of BBMN68 is available at NCBI database (NC_014656.1) [25]. In this study, we investigated the conditions to stimulate the ATR in BBMN68 and its genome-wide gene expression by high-throughput RNA-Seq using the platforms of the Genome Analyzer of Applied Biosystems (SOLiD). Ultimately, this study illustrated the gene expression patterns underlying ATR in B. longum subsp. longum in detail. These results may inspire new strategies toward enhancing the industrial utility of this species.

Materials and Methods

Selection of optimal acid-adaptation conditions

Bifidobacterium longum subsp. longum BBMN68 (CGMCC 2265, China General Microbiological Culture Collection Center) was cultured in modified MRS medium (supplemented with 0.05% L-cysteine) at an initial pH of 6.5 at 37°C, under anaerobic conditions. To select the challenge pH of BBMN68, the impact of pH on survival was tested. A part of the exponential cells (OD600 = 0.6) were collected. The collected cells were resuspended in isovolumetric modified MRS adjusted to pH 5.0, 4.5, 4.2, 4.0, and 3.5 with HCl and then incubated at 37°C for 120 min under anaerobic conditions. The other part of the cells (OD600 = 0.6) served as control cells. The survival cultures were counted by plate count on modified MRS agar medium. The pH at which the survival ratio of the cells decreased to 1% of control cells was defined as challenge pH. To select the adaptation pH, the impact of pre-incubation at different pH on the survival ratio at the challenge pH was tested. A portion of the exponential cells (OD600 = 0.6) served as control cells. The remaining exponential cells were collected and resuspended in isovolumetric modified MRS adjusted to pH 5.0, 4.5, 4.2, and 4.0 and allowed to pre-incubate at 37°C. After 120 min the control and pre-incubated cells were harvested and resuspended in modified MRS adjusted to pH 3.5 for acid challenge. The acid-challenged cells were incubated at 37°C for 30, 60, 90, and 120 min. Serial dilutions of the cells incubated for different periods of time were spread on modified MRS agar medium. The survival rate was calculated by dividing the number of cfu per ml after incubation at pH 3.5 by the number of cfu per ml of the control cells.

RNA sequencing

Total RNA was isolated from the acid-adapted cells (pre-incubated at pH 4.5 for 120 min before challenge at pH 3.5) and the control cells using Trizol. Total RNA was purified using a Ribo-minus Kit (Invitrogen, Cat. no. K1083708, U.S.) to deplete ribosomal RNA. The RNA-Seq library was constructed according to manufacturer's protocol from SOLiD™. Total RNA-Seq Kit, starting from 1 µg rRNA-depleted RNA. Briefly, the following components were added to the mixture on ice, in order: 8 µl RNA (1 µg), 1 µl 10× RNase III buffer, and 1 µl RNase III (Applied Biosystems, Cat. no. AM2290, U.S.). The mixture was incubated at 37°C for 10 min and at 65°C for 20 min. Then RiboMinus™ Concentration Module (Invitrogen, Cat. no. K155005, U.S.) was used to clean the fragmented rRNA and concentrate the rRNA-depleted RNA in the mixture. Selective hybridization of rRNA to the RiboMinus™ Probe and removal of rRNA using RiboMinus™ Magnetic Beads were proceeded following the instructions ot kit. cDNA was synthesized by addition of 19 µl RT Master Mix and incubated at 42°C for 30 min. The cDNA was purified using the MinElute PCR Purification Kit (Qiagen Cat. no. 28006, Germany). 150–200 bp range cDNA was selected with Novex pre-cast gel products (Invitrogen, Cat. no. NP0322BOX, U.S.). The cDNA was amplified with 15 PCR cycles and cleaned up with PureLink PCR Micro Kit (Invitrogen, Cat. no. K310250, U.S.). A cDNA library was sequenced using an AB SOLiD 4.0 sequencer according to the manufacturer's instructions. The details of the methods for alignment of read and quantization of gene expression were represented in Peng Cui's study [26]. All sequenced reads were aligned to the Bifidobacterium longum subsp. longum BBMN68 (NC_014656.1) using AB's SOLiD Corona_lite_v4.2 software available at http://waprna.big.ac.cn. We used a recursive strategy to improve the usable sequenced reads information, that is 50 mers reads were first mapped to the genome with a tolerance of ≤5 mismatches. The reads that failed to be mapped were progressively trimmed off, with five bases at one time from the 3′ end. After this, the reads were mapped to the genome again until a match was found (unless the read had been trimmed by <30 bases). All those uniquely mapped reads were used for calculating the genes RPKM values (reads per kilobase of exon per million mapped sequenced reads), which is used for defining gene expression level. We identified differential expressed genes (DEG) from different samples according to an R package named DEGseq (http://waprna.big.ac.cn/rnaseq/function/degseq.jsp), p<0.001 [27].

Validation of RNA-Seq data by real-time PCR

Validation of RNA-Seq data for 15 different genes was performed by real-time PCR as described by Vandecasteele [28]. The primers of selected genes were designed based on Bifidobacterium longum subsp. longum BBMN68 genome using Primer-blast software in the online NCBI blast database and synthesized by Invitrogen. The primer pairs are summarized in Table 1. The amplification efficiency of each primer set was determined using the standard curve. Each RT-PCR mixture with a total volume of 25 µl contained 9 µl of SYBR Green Real-time PCR Master Mix (Tiangen, Cat. no. FP202-02, China), 0.5 µM of the forward and reverse primers, 2 µl of cDNA template, and nuclease-free water. Real-time PCR was carried out with a Techne Quantica real-time PCR detection system (Techne, U.K.) under the following conditions: one cycle of 10 min at 95°C, 40 cycles of 15 s at 95°C and 30 s at 61°C. Determination of expression ratios was performed in duplicate for all the six biological replicates.
Table 1

Primers used for the verification of selected genes during RT-PCR.

Gene IDPrimer sequence (F/R: 5′-3′)Product size (bp)Amplification efficiency
BBMN68_1079 CGCAATCAGGCCACTGCCCA CGCGTCATCACACGGCCCTT 1851.99
BBMN68_1080 GGGGAGCGCGATGGCAAAGT CTCCCCCGTACGCGACCAGA 2102.00
BBMN68_1264 GCGTTCCTGCCGGAGCTGTT TCAGCACCGCAACGAGGCAG 1901.96
BBMN68_1344 TGTTCCTCGTCAACGCGGGC GATCAGGCGCGTGGGCAACT 1771.87
BBMN68_626 GTCCTACCGCGTCAAGCCCG AGTGGCCTTCAGGGACGGCA 1542.07
BBMN68_1635 CCGACCCCTGGCGTGGACTA AGCTGCACCACGATGGACGC 1761.96
BBMN68_114 CACACCCCGACCGAACACCG GGTGAGGGTTTCGGCCTCGC 1651.96
BBMN68_1694 GCGAGGACGCCGTCATGGAG CGACCACGGGAGCCGACAAC 1751.95
BBMN68_270 GTGCTGTACGCCGTGACCCC GGCGACGCAGGCGATGATGA 1951.95
BBMN68_1728 GAGGTCCTGACCGGAGGCGT GTTGACTCCGGCGCGTTCCA 1951.93
BBMN68_195 GTGCCGCTCGTTGGCCGTAT TGGCCTCGTCGTCCAGCAGA 2351.97
BBMN68_1099 GCACATTGCAACGCGACCCC ATGGCCAGCACGGCCACATC 1601.93
BBMN68_1100 CAAGCAGGCCATCCCCACCG GGCCTTGGCCACTTCCTCGG 1661.95
BBMN68_933 ACTACGTGCGCCTGTTGGGC GCGCCGTACACGAAACCCCA 2262.01
BBMN68_1816 GCCGTGCCACCGACATCGAA CGATGCGGGCACGATCGACA 2221.92

Determination of ATPase activity

To investigate the role of ATPase in ATR in BBMN68, the activity of ATPase in the control cells and the acid-adapated cells was detected. ATPase of the control cells and acid-adapted cells (incubated at pH 4.5 for 120 min) was determined based on the method described by Even et al [29]. A volume of culture corresponding to 20 mg (dry weight) of cells was centrifuged (4°C, 10 min at 6000 g), washed with MgCl2 (1 mM), and resuspended in MgCl2 (1 mM). Cells could be stored at −20°C after this step. After centrifugation (4°C, 10 min at 12,000 g), cells were resuspended in potassium phosphate buffer (73 mM, pH 6.5) containing 0.05% (v/v) Triton X-100 and incubated for 24 h at 20°C. After thawing and centrifugation (20°C, 10 min at 12,000 g), the pellet was resuspended in MgCl2 (1 mM) as ATPase extraction. Determination of ATPase activity was based on ATP hydrolysis to ADP and Pi at 37°C, followed by assay of the Pi formed once the reaction was stopped. One hundred microliters of ATPase extract was added to 1.9 ml of reaction mixture containing Tris buffer (21.5 mM, pH 7.8), EDTA (0.61 mM), MgCl2 (5.4 mM), NaCl (105 mM) and KCl (2.4 mM). The reaction was initiated by the addition of 500 µl of ATP (20 mM, pH 7.8) and stopped by the addition of 1 ml HCl (0.2 M). Pi formed by ATP hydrolysis in the reaction mixture was measured as follows: a sample of 2 ml of the reaction mixture was incubated for 15–30 min at room temperature with 2 ml of solution containing 0.2% (w/v) ascorbic acid, 1% (w/v) ammonium heptamolybdate, and 8% (v/v) perchloric acid 70%. OD was determined at 825 nm.

Effect of chloramphenicol treatment on acid-resistance

To investigate the relationship between the inhibition of protein synthesis and ATR in BBMN68, the acid-resistance of BBMN68 treated by chloramphenicol was assessed. One hundred micrograms per ml chloramphenicol was added into the medium containing exponential cells (OD600 = 0.6). The cells were incubated at 37°C for 30 min under anaerobic conditions. No effect on the survival of the cells was detected in such condition for 180 min. The control cells and the chloramphenicol-treated cells were collected and resuspended in modified MRS adjusted to the challenge pH 3.5. The cells were incubated at 37°C for up to 120 min with periodic sampling every 30 min to assess viability. The survival rate was calculated by dividing the number of cfu per ml after incubation at pH 3.5 by the number of cfu per ml of the control cells.

Results and Discussion

Optimal acid-adaptation conditions

As shown in Figure 1, the viability of the cells treated at pH 4.0–5.0 was the same as that of control cells, while the viability of the cells treated at pH 3.5 decreased to less than 1% of control cells. Hence, pH 3.5 was chosen as the challenge pH to detect the effect of acid-adaptation.
Figure 1

Survival of Bifidobacterium longum subsp. longum BBMN68 after 2 hours at different pH.

Exponential cells were collected and resuspended into fresh MRS with different pH to culture for 2 hours under anaerobic condition. Significant differences among the groups are marked with different letters (P<0.05).

Survival of Bifidobacterium longum subsp. longum BBMN68 after 2 hours at different pH.

Exponential cells were collected and resuspended into fresh MRS with different pH to culture for 2 hours under anaerobic condition. Significant differences among the groups are marked with different letters (P<0.05). To determine optimal acid-adaptation conditions, the survival rate of BBMN68 at challenge pH after pre-incubation at pH 5.0, 4.5, 4.2, and 4.0 lasting 2 hours was detected. As shown in Figure 2, the survival rate of the control cells at pH 3.5 for 120 min was 0.7%. The survival rate of the cells subjected to pre-incubation at pH 4.5 was maintained at 45% after acid challenge at pH 3.5 for 120 min. However, pre-incubation treatments at other pH levels were ineffective at protecting cells against a lethal acid challenge (data not shown). The results indicated that ATR in BBMN68 could be triggered by exposure to pH 4.5 for 120 min and therefor was chosen as the acid-adaptation treatment.
Figure 2

Effects of acid- adaptation on acid resistance of Bifidobacterium longum subsp. longum BBMN68.

Control cells were not treated; acid-adaptation cells were acid-adapted at pH 4.5 for 2 hours; acid resistance shows the survival ratios of the cells at pH 3.5 for 2 hours. * significant difference (P<0.05).

Effects of acid- adaptation on acid resistance of Bifidobacterium longum subsp. longum BBMN68.

Control cells were not treated; acid-adaptation cells were acid-adapted at pH 4.5 for 2 hours; acid resistance shows the survival ratios of the cells at pH 3.5 for 2 hours. * significant difference (P<0.05).

Analysis and verification of RNA-Seq data

To investigate the genes involved in ATR in BBMN68, differential gene expression between the control cells and the acid-adapted cells was identified by the high-throughput RNA-Seq. The Bifidobacterium longum subsp. longum BBMN68 genome contains 1814 predicted protein-coding sequences (CDSs) and 57 tRNAs [25]. We mapped the sequenced reads to the genome. In the control cells and acid-adaptated cells, respectively, 39.3% and 44.9% of the total reads (40 million) from raw RNA-seq data were mapped uniquely to genome, while similar proportions were mapped multiplely to genome (Table S3). Only 6.4% and 3.5% of the total reads were mapped to rRNA sequence (Table S3), respectively. All those uniquely mapped reads were used for calculating the genes RPKM values to normalize the expression level of genes. The DEGseq analysis of the RNA-Seq data revealed the expression of 1480 genes (p<0.001) in both condition. The expression of 538 genes had changed by more than 2 fold after acid-adaptation. Of these, 293 genes were upregulated and 245 genes were downregulated. To validate the RNA-Seq data, RT-PCR of 15 genes was performed. As shown in Figure 3, there was a strong positive correlation (R2 = 0.96) between RNA-Seq data and RT-PCR data.
Figure 3

Correlation of foldchange values from RNA-Seq and RT-PCR.

The R2 value is 0.96.

Correlation of foldchange values from RNA-Seq and RT-PCR.

The R2 value is 0.96. Of the 538 differentially expressed genes, 35 genes encoded tRNA (Figure 4). All of them were downregulated by more than 2 fold after acid-adaptation. Sequence alignment analysis indicated that 351 of 503 genes matched sequences of the cluster of orthologous genes (COGs). They were involved in 16 biological functions (Figure 4). In respect to the genome, the relative number of the DEGs involved in carbohydrate transport/metabolism (2.7%), amino acid transport/metabolism (2.3%), and Transcription (1.7%) was high. The relative number of the genes involved in secondary metabolite biosynthesis, transport, and catabolism (0.2 %), and cell division and chromosome partitioning (0.2 %) was very low. The relative numbers of genes involved in other functions ranged from 0.5 % to 1.1 %. The other 152 genes showed no COGs.
Figure 4

Comparsion of functions to clusters of orthologous genes in Bifidobacterium longum subsp. longum BBMN68.

These genes included those whose expression was upregulated (red block), downregulated (green block), and unchanged (black block) relative to control cells. The numbers above and below the little bar indicate the enrichments of the down-regulated genes and the up-regulated genes in respect to the genome, respectively.

Comparsion of functions to clusters of orthologous genes in Bifidobacterium longum subsp. longum BBMN68.

These genes included those whose expression was upregulated (red block), downregulated (green block), and unchanged (black block) relative to control cells. The numbers above and below the little bar indicate the enrichments of the down-regulated genes and the up-regulated genes in respect to the genome, respectively.

Mechanism analysis of ATR

According to the roles of the genes in the metabolic pathway and the mechanisms of ATR listed in LABs in previous studies, the association between the DEGs and ATR in BBMN68 was mined. The results indicated that these genes involved in blocking H+, discharging H+, neutralizing H+, the protection of proteins (PP), repair of damaged DNA, signal transduction systems, regulation of global response and regulation of the energy supply, participated in ATR in BBMN68. Some detected genes were not reported in the ATR mechanisms in previous studies.

Blocking H+

The cell envelope and membrane (CEM) are probably the first targets of physicochemical stress. They are mainly composed of lipid, peptidoglycan, and exopolysaccharides (EPS) in bifidobacteria. Fatty acid (FA) modifications of cell membrane play an important role in protection from acid stress [30], [31]. As shown in Table 2, BBMN68_1705 encoding cyclopropane fatty acid (CFA) synthase (Cfa) was upregulated by 4.69 folds. Previous study proved that Cfa acted as an important enzyme in the acid tolerance response of bacteria through the methods of constructing cfa-deficient mutans and cfa-overexpression strains [31]. It was inferred that CFA also made important contribution to ATR in BBMN68.
Table 2

Changes in expression of the genes involved in biosynthesis of Cell Envelope and Membrane (CEM).

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_1432 113.37241.352.13* HCOG0846K12410, NAD-dependent deacetylase [EC:3.5.1.-]
BBMN68_949 140.53283.212.02* GCOG1109 manB K03431, phosphoglucosamine mutase [EC:5.4.2.10]
BBMN68_725 77.61174.462.25* MCOG1207 glmU K04042, bifunctional UDP-N-acetylglucosamine pyrophosphorylase/glucosamine-1-phosphate N-acetyltransferase [EC:2.7.7.23 2.3.1.157]
BBMN68_956 127.77346.112.71* EMCOG0329 dapA K01714, dihydrodipicolinate synthase [EC:4.2.1.52]
BBMN68_615 17.6435.362.00* ECOG0624 pePV K01439, succinyl-diaminopimelate desuccinylase [EC:3.5.1.18]
BBMN68_1087 94.27330.693.51* ICOG1211 ispD K00991, 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [EC:2.7.7.60]
BBMN68_317 30.6998.53.21* HCOG0142 ispA K13787, geranylgeranyl diphosphate synthase, type I [EC:2.5.1.1/2.5.1.10/2.5.1.29]
BBMN68_144 119.96321.032.68* MCOG0821 gcpE K03526, (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase [EC:1.17.7.1]
BBMN68_147 50.77126.062.48* ICOG0020 uppS K00806, undecaprenyl diphosphate synthase [EC:2.5.1.31]
BBMN68_143 135.57320.222.36* ICOG0743 dxr K00099, 1-deoxy-D-xylulose-5-phosphate reductoisomerase [EC:1.1.1.267]
BBMN68_747 8.2817.692.14* ICOG0245 ispF K01770, 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase [EC:4.6.1.12]
BBMN68_1487 390.91785.82.01* MCOG1088 rfbB K01710, dTDP-glucose 4,6-dehydratase [EC:4.2.1.46]
BBMN68_1488 284.49635.172.23* MCOG1091 rfbC K00067, dTDP-4-dehydrorhamnose reductase [EC:1.1.1.133]K01790, dTDP-4-dehydrorhamnose 3,5-epimerase [EC:5.1.3.13]
BBMN68_1489 666.12861.341.29MCOG1209 rfbA K00973, glucose-1-phosphate thymidylyltransferase [EC:2.7.7.24]
BBMN68_1495 193.38554.772.87* MGCOG1682 tagG K01992, ABC-2 type transport system permease protein
BBMN68_1496 468.32697.821.49GCOG1134 tagH K01990, ABC-2 type transport system ATP-binding protein
BBMN68_1705 73.35350.754.78* MCOG2230 cfa Cyclopropane fatty acid synthase
BBMN68_1009 113.58407.273.59* MCOG0463Hypothetical protein
BBMN68_1297 25.4755.922.20* MCOG0463Hypothetical protein
BBMN68_1707 58.19118.962.04* MCOG0463Glycosyltransferase for cell wall membrane
BBMN68_1709 90.1204.512.27* MCOG1215Glycosyltransferase for cell wall membrane
BBMN68_1494 81.69173.012.12* MCOG0463 wcaA4 Glycosyltransferase for cell wall membrane
BBMN68_851 60.38123.922.05* MCOG0438 rfaG2 Glycosyltransferase
BBMN68_1010 155.49576.653.71* DCOG0489Etk-like tyrosine kinase involved in EPS biosynthesis

changed by more than 2 fold.

changed by more than 2 fold. In this study, three pieces of evidence indicated that peptidoglycan synthesis had been induced in acid-adapted cells. As shown in Table 2 and Figure 5, first, the genes (BBMN68_1432, BBMN68_949, BBMN68_725, BBMN68_956 and BBMN68_615) involved in the synthesis of the two main precursors of peptidoglycan, UDP-acetyl-glucosamine and meso-2, 6-diaminopimelate, were upregulated by more than 2 fold. Second, poly-undecaprenyl-PP (UND-PP), which is a lipid carrier involved in polysaccharide and peptidogylcan assembly, carried glycogen to pass the membrane [32]. In the biosynthetic pathway of UND-PP, the genes encoding Dxr, IspD, IspE, GcpE, IspA, and UppS were upregulated by more 2 fold (Table 2). Third, several genes encoding glycosyltransferase involved in helping peptidoglycan to form a network by transglycosylation were upregulated by more than 2 fold (Table 2). All these results suggested that the synthesis of peptidoglycan was induced after acid-adaptation to improve the acid resistance of BBMN68.
Figure 5

Metabolic net work of the mechanism involved in ATR in Bifidobacterium longum subsp. longum BBMN68.

CEM: cell envelope and membrane; CCC: cysteine and cystathionine cycle; BCAA: branched-chain amino acids; AAA: aliphatic amino acids; PP: protein protection; 2CS: two-component system (HK: sensor; RR: response regulator); QS: quorum sensing; CFA: cyclopropane fatty acid; EPS: extracellular polysaccharide; SAM: S-adenosylmethionine.

Metabolic net work of the mechanism involved in ATR in Bifidobacterium longum subsp. longum BBMN68.

CEM: cell envelope and membrane; CCC: cysteine and cystathionine cycle; BCAA: branched-chain amino acids; AAA: aliphatic amino acids; PP: protein protection; 2CS: two-component system (HK: sensor; RR: response regulator); QS: quorum sensing; CFA: cyclopropane fatty acid; EPS: extracellular polysaccharide; SAM: S-adenosylmethionine. In addition, in our study, several genes involved in the synthesis of EPS were found to have been upregulated by more than 2 fold after acid-adaptation, as shown in Figure 5 and Table 2. These results indicated that the synthesis of CFA, EPS, and peptidoglycan constituting the cell envelope and membrane were induced in the acid-adapted cells. It was inferred that strengthening the intensity of cell wall and changing the composition of FA to block H+ was a strategy of ATR in BBMN68.

Discharging H+

Generally, when bacteria are exposed to acidic conditions, pH homeostasis is maintained by discharging H+ by H+- ATPase [5], [15]. As shown in Table 3, Genes BBMN68_1117-1124, which together encode the 8 subunits of F0F1-ATPase in BBMN68, were upregulated after acid-adaptation. Of these, four genes were upregulated by more than 2 fold. These results implied that the activity of F0F1-ATPase may increase in ATR. To confirm this, the ATPase activity of acid-adapted BBMN68 was detected (Figure 6). After acid-adaptation at pH 4.5 lasting 2 hours, ATPase activity was found to be 3 times that of the control cells. In this way, F0F1-ATPase played an indispensable role in the ATR of BBMN68.
Table 3

Expression of genes encoding subunits of F0F1-ATPase in BBMN68.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_1117 3937.054499.091.14CCOG0355 atpC K02114, F-type H+-transporting ATPase subunit epsilon [EC:3.6.3.14]
BBMN68_1118 4118.786059.241.47CCOG0055 atpD K02112, F-type H+-transporting ATPase subunit beta [EC:3.6.3.14]
BBMN68_1119 2955.16406.362.17* CCOG0224 atpG K02115, F-type H+-transporting ATPase subunit gamma [EC:3.6.3.14]
BBMN68_1120 3296.975946.071.80CCOG0056 atpA K02111, F-type H+-transporting ATPase subunit alpha [EC:3.6.3.14]
BBMN68_1121 3531.079305.032.64* CCOG0712 atpH K02113, F-type H+-transporting ATPase subunit delta [EC:3.6.3.14]
BBMN68_1122 2110.93318.51.57CCOG0711 atpF K02109, F-type H+-transporting ATPase subunit b [EC:3.6.3.14]
BBMN68_1123 1993.6140122.01* CCOG0636 atpE K02110, F-type H+-transporting ATPase subunit c [EC:3.6.3.14]
BBMN68_1124 599.222135.163.56* CCOG0356 atpB K02108, F-type H+-transporting ATPase subunit a [EC:3.6.3.14]

changed by more than 2 fold.

Figure 6

Activity of ATPase in Bifidobacterium longum subsp. longum BBMN68.

* significant difference (P<0.05).

Activity of ATPase in Bifidobacterium longum subsp. longum BBMN68.

* significant difference (P<0.05). changed by more than 2 fold.

Neutralizing H+

The genes BBMN68_1526 encoding cystathionine beta-lyase (MalY1), BBMN68_917 encoding cystathionine gamma-synthase (MetC3) and BBMN68_918 encoding cystathionine beta-synthase (CysK) involved in cysteine metabolism pathway were upregulated by 9.25, 2.71, and 2.84 fold, respectively (Table 4). The reactions catalyzed by the three enzymes constituted a NH3-producing cycle, here called the cysteine-cystathionine-cycle (CCC). As shown in Figure 5, MalY1 catalyzes the conversion of cystathionine to homocysteine and NH3. Then homocysteine combined with sercine is catalyzed to produce cystathionine by CysK. Second, MalY1 catalyzes the conversion of cysteine to H2S and NH3, then H2S combined with sercine is catalyzed to produce cysteine by CysK. Third, cysteine combined with succinyl-homoserine is catalyzed to produce cystathionine by MetC3. The activity of enzymes involved in this cycle was upregulated, suggesting that the ability to produce NH3 using CCC was promoted by acid-adaptation. Previous studies have demonstrated that NH3 could neutralize H+ to enhance the acid tolerance of bacteria [13], [19], [20]. However, CCC has not been reported as a metabolic pathway to produce NH3 in ATR. In our study, it was found that CCC cycle participated in ATR in bifidobacteria as NH3 producer. This prompted us to try to improve the acid-resistance of bifidobacteria by adding cysteine and cystathionine into the acid-stress medium.
Table 4

Changes in expression of genes associated with amino acid metabolism pathway.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_1526 30.77284.739.25* ECOG1168 malY1 K14155, cystathione beta-lyase [EC:4.4.1.8]
BBMN68_14 297.44845.072.84* HCOG0192 metK K00789, S-adenosylmethionine synthetase [EC:2.5.1.6]
BBMN68_918 265.567442.80* ECOG0031 cysK K01697, cystathionine beta-synthase [EC:4.2.1.22]
BBMN68_917 359.99976.062.71* ECOG0626 metC3 K01739, cystathionine gamma-synthase [EC:2.5.1.48]
BBMN68_1263 2667.4118881.27.08* EHCOG0059 ilvC2 K00053, ketol-acid reductoisomerase [EC:1.1.1.86]
BBMN68_16 99.73224.992.26* EGCOG0129 ilvD K01687, dihydroxy-acid dehydratase [EC:4.2.1.9]
BBMN68_592 395.39861.862.18* EHCOG0115 ilvE K00826, branched-chain amino acid aminotransferase [EC:2.6.1.42]
BBMN68_1222 366.15825.872.26* ECOG0119 leuA K01649, 2-isopropylmalate synthase [EC:2.3.3.13]
BBMN68_984 237.251102.934.65* ECOG0473 leuB K00052, 3-isopropylmalate dehydrogenase [EC:1.1.1.85]
BBMN68_1521 37.07107.492.90* ECOG0065 leuC K01703, 3-isopropylmalate/(R)-2-methylmalate dehydratase large subunit [EC:4.2.1.33 4.2.1.35]
BBMN68_1522 84.05216.492.58* ECOG0066 leuD K01704, 3-isopropylmalate/(R)-2-methylmalate dehydratase small subunit [EC:4.2.1.33 4.2.1.35]
BBMN68_185 187.29448.272.39* ECOG0106 hisA K01814, phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase [EC:5.3.1.16]K01817, phosphoribosylanthranilate isomerase [EC:5.3.1.24]
BBMN68_182 119.3236.831.99* ECOG0131 hisB K01693, imidazoleglycerol-phosphate dehydratase [EC:4.2.1.19]
BBMN68_184 53.571282.39* ECOG0118 hisH K02501, glutamine amidotransferase [EC:2.4.2.-]
BBMN68_274 21.4645.682.13* ECOG0287 pdhA K04517, prephenate dehydrogenase [EC:1.3.1.12]
BBMN68_273 28.2761.792.19* ECOG0077 pheA K14170, chorismate mutase/prephenate dehydratase [EC:5.4.99.5 4.2.1.51]
BBMN68_312 52.76202.973.85* ECOG0547 trpD K00766, anthranilate phosphoribosyltransferase [EC:2.4.2.18]
BBMN68_1136 35.29115.153.26* ECOG1605 tyrA K04092, chorismate mutase [EC:5.4.99.5]
BBMN68_1775 35.391805.09* ECOG0436Aspartate/tyrosine/aromatic aminotransferase
BBMN68_1595 46.59110.622.37* ECOG0436Aspartate/tyrosine/aromatic aminotransferase
BBMN68_88 71167.862.36* ECOG0436Aspartate/tyrosine/aromatic aminotransferase
BBMN68_1544 245572.852.34* ECOG0436Aspartate/tyrosine/aromatic aminotransferase
BBMN68_1747 122.62299.332.44* ECOG0683 livK K01999, branched-chain amino acid transport system substrate-binding protein
BBMN68_1748 194.66173.56−1.12ECOG0559 livH K01997, branched-chain amino acid transport system permease protein
BBMN68_1749 162.21270.741.67ECOG0559 livM K01998, branched-chain amino acid transport system permease protein
BBMN68_1750 161.773021.87ECOG0411 livG K01995, branched-chain amino acid transport system ATP-binding protein
BBMN68_1751 285.24650.62.28* ECOG0410 livF K01996, branched-chain amino acid transport system ATP-binding protein

changed by more than 2 fold.

changed by more than 2 fold.

Protection of proteins

The excess H+ entering the cell can damage the structure of some proteins. The repair of acid-induced protein damage is an important response to acid stress in LABs [5], [8], [17]. DnaK, DnaJ1, DnaJ2, GrpE, Hsp60, and Hsp10 are common general stress response proteins (GSPs) involved in ATR in other bacteria. In the acid-adapted cells, the expression of the genes encoding these GSPs changed by less than 2 fold (Table 5). These results indicated that these GSPs did not make much contribution to ATR in BBMN68. This is consistent with the results of Sanchez's 2D-Gel study, which indicated that DnaJ and GroES were down-regulated in Bifidbacterium under acid-stress conditions [13]. However, the genes BBMN68_1278 and BBMN68_1305 encoding Zn-dependent protease (HtpX) and a small heat shock molecular chaperone (IbpA), were upregulated by 4.11 and 2.83 fold (Table 5). The pH challenge was found to induce denaturation and inactivation of membrane proteins. The resulting accumulation of abnormal membrane proteins was found to disturb membrane structure and function, eventually compromising cellular integrity and viability. Previous studies have indicated that HtpX might participate in quality control of membrane proteins [33]. The significantly upregulated expression of htpX suggested that the quality control system was initiated to monitor protein folding states, eliminates and/or repairs the damaged proteins quickly in the acid- adapted cells. IbpA is a small heat shock protein. It is a widely distributed molecular chaperone that binds to misfolded proteins to prevent irreversible aggregation, and aids in refolding denatured proteins into competent ones [34]. This information was obtained from the studies on heat stress and oxygen stress of E. coli and other bacteria [35]. However, there has been no report stating that htpX and ibpA were involved in ATR in LAB. Our results provide the first evidence that htpX and ibpA may participate in ATR in Bifidobacterium.
Table 5

Expression of genes encoding molecular chaperones in BBMN68.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_410 93.5164.441.76OCOG0484 dnaJ1 K03686, molecular chaperone DnaJ
BBMN68_1250 195.29189.37−1.03OCOG2214 dnaJ2 K03686, molecular chaperone DnaJ
BBMN68_1251 385.11310.71−1.23OCOG0576 grpE K03687, molecular chaperone GrpE
BBMN68_1252 845.41773.5−1.09OCOG0443 dnaK K04043, molecular chaperone DnaK
BBMN68_1278 182.36764.674.19* OCOG0501 htpX K03799, heat shock protein HtpX [EC:3.4.24.-]
BBMN68_1305 520.31506.832.90* OCOG0071 ibpA Heat shock molecular chaperone
BBMN68_1589 439.28700.761.60OCOG0234 groS K04078, chaperonin GroES, HSP10
BBMN68_44 724.671248.641.72OCOG0459 groL K04077, chaperonin GroEL, HSP60
BBMN68_52 474.75659.971.39OCOG0542 clpA1 K03696, ATP-dependent Clp protease ATP-binding subunit ClpC
BBMN68_1510 169.21142.65−1.19OCOG0542 clpA2 K03695, ATP-dependent Clp protease ATP-binding subunit ClpB
BBMN68_691 110.28149.641.36OCOG1219 clpX K03544, ATP-dependent Clp protease ATP-binding subunit ClpX
BBMN68_692 332.15817.732.46* NOCOG0740 clpP1 K01358, ATP-dependent Clp protease, protease subunit [EC:3.4.21.92]
BBMN68_693 524.61949.81.81NOCOG0740 clpP2 K01358, ATP-dependent Clp protease, protease subunit [EC:3.4.21.92]
BBMN68_1790 69.85216.213.10* HCOG3572 gshA K01919, glutamate–cysteine ligase [EC:6.3.2.2]

changed by more than 2 fold.

changed by more than 2 fold. The members of the Clp protease family are involved in heat- and osmotic- tolerance in Bifidobacterium [36], [37]. In this study, it was found that BBMN68_692 encoding protease subunit of Clp family was upregulated by 2.46 fold in ATR (Table 5). Such result suggested that the roles of Clp family in Bifidobacterium in response to the stress enviroments might be further enriched. Low-molecular-mass thiols, such as glutathione (GSH) have been shown to possess the ability to strengthen the acid resistance of the LAB by protecting some proteins from damage. This is because they can form mixed disulfides with protein SH groups [38], [39]. GSH is synthesized from glutamate through two enzymatic processes: First, γ-glutamylcysteine (γ-GC) synthetase (GshA) ligates L-cysteine to L-glutamate at the expense of ATP, forming γ-GC. Second, GSH synthetase (GshB) adds glycine to γ-GC to form the tripeptide GSH. Kim has reported that γ-GC acts as major low-molecular-mass thiols instead of GSH in some LABs in which gshB is not detectable [39]. In this study, no gene homologous to gshB was found in the BBMN68 genome, the BBMN68_1790 encoding GshA was upregulated by 3.1 fold (Table 5). This implied that γ-GC might contribute to the protection of protein. This suggested that the acid resistance of bifidobacteria could be improved by adding γ-GC to the acid-stress medium.

Repair of damaged DNA

The excess H+ entering the cell also threatened the correctness of DNA replication and transcription by depurination and depyrimidination of DNA. To combat the acid stress, DNA repair systems were initiated in the LAB [16], [18]. The SOS and nucleotide excision repair (NER, which includes the NER-UVR and NER-Vsr systems) are the major DNA repair systems in bacteria. The changes in the expression of the genes involved in DNA repair system are shown in Table 6.
Table 6

Expression of genes encoding proteins involved in DNA repair in BBMN68.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_394 131.73185.061.40LCOG0178 uvrA1 K03701, excinuclease ABC subunit A
BBMN68_833 47.4673.241.54LCOG0178 uvrA2 K03701, excinuclease ABC subunit A
BBMN68_740 29.9177.392.59* LCOG0556 uvrB K03702, excinuclease ABC subunit B
BBMN68_395 120.44114.82−1.05LCOG0322 uvrC K03703, excinuclease ABC subunit C
BBMN68_138 17.0241.62.44* LCOG0210 uvrD1 K03657, ATP-dependent DNA helicase II PcrA [EC:3.6.4.12]
BBMN68_630 58.4699.481.70LCOG0210 uvrD2 K03657, ATP-dependent DNA helicase II PcrA [EC:3.6.4.12]
BBMN68_959 59.7796.171.61LCOG0210 uvrD3 K03657, ATP-dependent DNA helicase II PcrA [EC:3.6.4.12]
BBMN68_960 87.5650.69−1.72LCOG0210 uvrD4 Superfamily I DNA and RNA helicase
BBMN68_93 57.7370.271.22LCOG0272 lig K01972, DNA ligase (NAD+) [EC:6.5.1.2]
BBMN68_735 163.86248.391.52LCOG0749 polA K02335, DNA polymerase I [EC:2.7.7.7]
BBMN68_773 150.39153.21.02LKCOG1197 mfd K03723, transcription-repair coupling factor [EC:3.6.4.-]
BBMN68_1773 40.96112.162.74* vsr K07458, DNA mismatch endonuclease, patch repair protein [EC:3.1.-.-]
BBMN68_195 2633.17415.81−6.33* KTCOG1974 lexA1 K01356, SOS-response transcriptional repressor LexA [EC:3.4.21.88]
BBMN68_752 249.42206.3−1.20KTCOG1974 lexA2 SOS-response transcriptional repressor
BBMN68_305 350.71240.03−1.47LCOG0468 recA K03553, recombination protein RecA
BBMN68_1092 93.7971.67−1.32LKCOG1200 recG K03655, ATP-dependent DNA helicase RecG [EC:3.6.4.12]
BBMN68_1369 121141.81.17LCOG1195 recF K03629, DNA replication and repair protein RecF
BBMN68_1232 74.6999.31.33LCOG0353 recR K06187, recombination protein RecR
BBMN68_146 46.7679.71.70LCOG1381 recO K03584, DNA repair protein RecO (recombination protein O)

changed by more than 2 fold.

changed by more than 2 fold. LexA, a member of the SOS system, represses the expression of some response genes including lexA itself. When the SOS system is started, the repressional activity of LexA becomes inactivated, and then the expression of the response genes is induced. In this study, the expression of BBMN68_195 encoding LexA was downregulated by 6.33 fold in ATR (Table 6). This may have been the result of the activity of the LexA repressor, which was not removed in the acid adapted cells. These results implied that SOS was not involved in ATR in BBMN68. In the NER-UVR system, the UVR family proteins repair the damaged DNA cooperating with DNA ligase, and DNA polymerase I. In this study, after acid adapation, the expression of uvrB and uvrD was upregulated by more than 2 fold (Table 6). This shift to upregulation implied that NER system was initiated in ATR in BBMN68. Moreover, BBMN68_1773 encoding short patch repair endonuclease (Vsr) belonging to NER-Vsr system was upregulated by 2.74 folds after acid-adaptation (Table 6). The result offered another evidence that NER was started in the acid-adapted BBMN68. The gene vsr has not been reported to be involved in the ATR in LABs in previous study.

Regulation of signal systems and global response

In this study, RNA-Seq data analysis suggested that the expression of genes involved in global response, such as (p)ppGpp synthesis, polyP synthesis, and protein export, and genes involved in signal communication, such as two-component systems (2CS) and quorum-sensing (QS) changed significantly after acid-adaptation. BBMN68_331 encoding GTP pyrophosphokinase (SpoT) was upregulated by 2.05 folds (Table 7). SpoT is key to (p)ppGpp production. In response to various unfavorable growth conditions, such as a global regulators, (p)ppGpp downregulates the cellular processes needed for growth and upregulates the processes needed for survival, bringing the cells into a slow-growing state [40], [41], [42].
Table 7

Changes in expression of genes involved in signal transduction and global response.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_914 325.82807.552.48* TCOG1854 luxS K07173, S-ribosylhomocysteine lyase [EC:4.4.1.21]
BBMN68_1079 16.349.943.06* TKCOG0745 regX3 K07776, two-component system, OmpR family, response regulator RegX3
BBMN68_1080 17.9462.353.48* TCOG0642 vicK K07768, two-component system, OmpR family, sensor histidine kinase SenX3 [EC:2.7.13.3]
BBMN68_47 263.561086.194.12* TKCOG0745K02483, two-component system, OmpR family, response regulator
BBMN68_48 293.97909.093.09* TCOG0642 baeS1 K02484, two-component system, OmpR family, sensor kinase [EC:2.7.13.3]
BBMN68_1518 305.06816.152.68* PCOG0855 ppk K00937, polyphosphate kinase [EC:2.7.4.1]
BBMN68_331 285.11596.62.09* TKCOG0317 spoT K00951, GTP pyrophosphokinase [EC:2.7.6.5]
BBMN68_1066 97.29209.122.15* NCOG0541 ffh K03106, signal recognition particle subunit SRP54
BBMN68_1545 296.71140.943.85* NCOG0690 secE K03073, preprotein translocase subunit SecE
BBMN68_1285 158.9645.97−3.46* NCOG0805 tatC K03118, sec-independent protein translocase protein TatC
BBMN68_1286 58.8536.32−1.62* NCOG1826 tatB K03117, sec-independent protein translocase protein TatB
BBMN68_1284 665.3194.9−3.41* NCOG1826 tatA K03116, sec-independent protein translocase protein TatA

changed by more than 2 fold.

changed by more than 2 fold. The upregulated expression of spoT showed that acid-adaptation induced the production of (p)ppGpp to strengthen the resistance to acid challenge. Moreover, 35 of 57 genes encoding tRNA were downregulated by more than 2 fold (Table S1). This implied that the synthesis of some proteins was inhibited by the upregulation of (p)ppGpp and by the downregulation of tRNA expression in ATR in BBMN68. To determine the relationship between the inhibition of protein synthesis and acid resistance in BBMN68, the acid resistance of BBMN68 treated by chloramphenicol was assessed. Chloramphenicol was found to inhibit protein synthesis. The survival rate of BBMN68 treated with chloramphenicol remained at 57% after challenge at pH 3.5 lasting 90 min. It then decreased to 14% after challenge lasting 120 min. However, these survival rates were significantly higher than those of control cells (Figure 7). This indicated that the acid resistance of BBMN68 was strengthened when its protein synthesis was inhibited by chloramphenicol. This implied that the inhibition of protein production effected by increased production of (p)ppGpp and by reduced production of tRNA played an important role in ATR in BBMN68.
Figure 7

Survival rate of Bifidobacterium longum subsp. longum BBMN68 at pH 3.5 for different duration.

Control cells were untreated (white block). Other cells were treated with 100 µg/ml chloramphenicol for 30 min (black block). Significant differences among the groups are marked with different letters (P<0.05).

Survival rate of Bifidobacterium longum subsp. longum BBMN68 at pH 3.5 for different duration.

Control cells were untreated (white block). Other cells were treated with 100 µg/ml chloramphenicol for 30 min (black block). Significant differences among the groups are marked with different letters (P<0.05). BBMN68_1518 encoding polyphosphate kinase (PPK1) was upregulated by 2.68 fold after acid-adaptation (Table 7). PPK1 is responsible for the synthesis of Poly P, which has been shown to be essential to growth by responding to the stresses and stringencies in several bacteria. Previous studies have indicated that mutants lacking ppk1 were defective in motility, QS and biofilm formation in E. coli [43], [44]. Qian has reported that oxidative stress induced the expression of ppk and the production of poly P in bifidobacteria, and strengthened the resistance of the cells to acid challenge [45]. For the first time, this study detected that acid-adaptation induced the expression of ppk1 in the absence of oxidative stress. There are two main protein export systems in the BBMN68 genome. One of them is the twin arginine targeting (TAT) system. In the BBMN68 genome, BBMN68_1284, BBMN68_1285, and BBMN68_1286 constituted the TAT system. In the present study, these three genes were all downregulated by more than 2 fold (Table 7). These results suggested that TAT was partially shut down in ATR in BBMN68. Another system is Sec-signal recognition particle (Sec-SRP) system. BBMN68_1545 encoding preprotein translocase subunit (SecE) and BBMN68_1066 encoding signal recognition particle subunit SRP54 (Ffh) belonging to the Sec-SRP were upregulated by 3.85 and 2.15 fold, respectively (Table 7). Previous studies on the acid tolerance of S. mutans have reported that the ffh defective mutans is more acid-sensitive and that Ffh played an important role in several physiology processes, including pH homeostasis, pyruvate dissimilation, and sugar transport [46], [47]. BBMN68_513 encoding signal peptidase I, which played an important role in protein export, was upregulated by more than 2 fold as well. Based on these results and the investigation in S. mutans, it was inferred that the Sec-SRP protein export system also played an unignorable role in ATR in BBMN68. Transcriptional regulators are involved in adapting the cells to the ever-changing outer environment by regulating the gene expression. RNA-Seq detected that 72 genes encoding transcriptional regulators were expressed on the transcriptional level, and the expression of 28 transcriptional regulators were up- or downregulated by more than 2 fold. These results implied that transcriptional regulators participated in ATR by inducing or repressing the expression of the related genes (Table S1 and Table S2). 2CS are often involved in stress adaptation in bacteria. They act as sensors of environmental change [48]. Histidine kinase (HK) is autophosphorylated by signal stimulation. Then the phospho groups are transferred to response regulator (RR). Phosphorylation activates RR and causes it to regulate gene expression, strengthening the acid-resistance of the cell. There were 4 sets of 2CS in the BBMN68 genome, 2 of which were significantly upregulated (Table 7). BBMN68_1079 and BBMN68_1080, encoding SenX3-RegX3, were upregulated by 3.06 and 3.48 fold, respectively. BBMN68_47 and BBMN68_48, encoding RR and HK, were upregulated by 4.12 and 3.09 fold, respectively. Although their specific functions have not yet been determined, our results indicated that some members of the 2CSs were involved in ATR in BBMN68. QS is a tool of interspecies communication in bacteria. Facing stress, the cell itself responds to the environment. The cell communicates with other cells by QS to increase the survival rate within the community. Autoinducer (AI-2) has been proposed as a universal signal in QS [22], [49]. LuxS catalyzes the production of (4S)-4, 5-dihydroxypentan-2, 3-dione (DPD), which is precursor of the signal molecule AI-2. Previous studies have shown that the acid resistance of Streptococcus mutans decreases significantly when the gene luxS is defective [21]. In this study, BBMN68_914 encoding LuxS was upregulated by 2.48 folds (Table 7). From this, it was inferred that QS system might be initiated in ATR to improve the acid resistance of the whole BBMN68 community.

Energy and substrate supply

In ATR, the cells initiated several mechanisms discussed above to improve autologous acid resistance. However, the operation of these mechanisms required energy and substrates. By analyzing the expression levels of the genes in BBMN68, we found that the cells strengthened the ability of transporting and unilizing carbon source, varied the ways of producing energy and started the mode of saving energy to guarantee the operation of those mechanisms. RNA-Seq data suggested that there are three sugar transport systems in BBMN68 under the conditions in this study. The first is the major facilitator superfamily proteins (MFS), which allow glucose to be symported with H+. BBMN68_1664 encoding the D-glucose-H+ symporter (GlcP), one member of the putative permeases of the MFS in BBMN68, was found to have been upregulated by 2.17 fold (Table S2). The second is the ABC-transport system, which was supported by ATP. The transcriptome data indicated that there were 8 sets of working ABC-type sugar transport systems in BBMN68, of which 6 were downregulated by more than 2 fold (Table 8). As indicated by the functional classification of membrane transport proteins in TCDB Blast (TCDB; www.tcdb.org), the substrates of the downregulated ABC transport systems did not include glucose. In this way, the changes in the expression of the genes involved in ABC transport did not affect the absorption of glucose, which is the bacterium's main carbon source. In addition to the MFS and ABC transport system, there were genes (BBMN68_1151, BBMN68_1152, and BBMN68_1665) encoding the three components (EI, HPr, and EII) of the glucose-specific phosphoenolpyruvate-linked phosphotransferase system (PTS) in BBMN68 genome. The expression of the genes encoding the components in PTS showed different changes: EI and HPr were upregulated by more than 2 fold (Table S2), and the expression of glucose-specific-EII was downregulated by 2.5 fold (Table S1). However, the three genes were expressed at very low levels in both the control and acid-adapted cells. For this reason, it was inferred that the PTS might not make a large contribution to glucose intake under the conditions in this study. After acid-adaptation, a sugar transport system consuming no energy was promoted, while the ATP-drived systems were shut down. This alteration caused the cells to initiate an energy-saving transport mode. The saved energy could then be used to support the discharge of H+ by F0F1-ATPase and other energy-consuming mechanisms of ATR in BBMN68.
Table 8

Expression of genes encoding the components of sugar ABC-transporter.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGene description
BBMN68_1168 145.9161.94−2.36* GCOG0395K02026, multiple sugar transport system permease protein
BBMN68_1169 98.6230.32−3.25* GCOG1175K02025, multiple sugar transport system permease protein
BBMN68_1170 2153.69298.91−7.21* GCOG1653K02027, multiple sugar transport system substrate-binding protein
BBMN68_927 50.59.47−5.33* GCOG1653K02027, multiple sugar transport system substrate-binding protein
BBMN68_926 1516.6214.09−7.08* GCOG1653K02027, multiple sugar transport system substrate-binding protein
BBMN68_931 1301.73108.13−12.04* GCOG0395K02026, multiple sugar transport system permease protein
BBMN68_933 1443.3195.75−15.07* GCOG1175K02025, multiple sugar transport system permease protein
BBMN68_1670 15246.021373.46−11.10* GCOG1653K02027, multiple sugar transport system substrate-binding protein
BBMN68_1671 904.42246.04−3.68* GCOG1175K02025, multiple sugar transport system permease protein
BBMN68_1672 493.45228−2.16* GCOG0395K02026, multiple sugar transport system permease protein
BBMN68_1422 307.2183.16−3.69* GCOG1653K10117, multiple sugar transport system substrate-binding protein
BBMN68_1423 340.0496.16−3.54* GCOG1175K10118, multiple sugar transport system permease protein
BBMN68_1424 284.1779.61−3.57* GCOG0395K10119, multiple sugar transport system permease protein
BBMN68_1726 1387.9583.55−16.61* GCOG1879K10546, putative multiple sugar transport system substrate-binding protein
BBMN68_1727 322.4363.43−5.08GCOG1129K10548, putative multiple sugar transport system ATP-binding protein
BBMN68_1728 294.871.37−4.13* GCOG1172K10547, putative multiple sugar transport system permease protein
BBMN68_335 96.3247.34−2.03* GCOG0395Sugar permeases
BBMN68_919 61.4426.66−2.30* RCOG1123ATPase components of various ABC-type transport systems
BBMN68_920 106.9842.14−2.54* RCOG1123ATPase components of various ABC-type transport systems
BBMN68_217 126.7868.48−1.85GCOG1653K02027, multiple sugar transport system substrate-binding protein
BBMN68_218 141.0273.47−1.92GCOG1175K02025, multiple sugar transport system permease protein
BBMN68_219 147.0272.27−2.03* GCOG0395K02026, multiple sugar transport system permease protein
BBMN68_1724 54.21114.462.11* GCOG1129MglA2, K02056, simple sugar transport system ATP-binding protein [EC:3.6.3.17]
BBMN68_74 6627.488679.71.31GCOG1879Rbsb, K02058, simple sugar transport system substrate-binding protein
BBMN68_75 1201.972157.421.79GCOG1129MglA1, K02056, simple sugar transport system ATP-binding protein [EC:3.6.3.17]
BBMN68_76 948.751674.751.77GCOG1172AraH1, K02057, simple sugar transport system permease protein
BBMN68_77 712.671286.491.81GCOG1172AraH2, K02057, simple sugar transport system permease protein
BBMN68_280 567.19734.41.29RCOG1123ATPase components of various ABC-type transport systems

changed by more than 2 fold.

changed by more than 2 fold. The bifidus shunt (black line in energy part in Figure 5) is a classic glycolytic pathway in bifidobacteria. Although not all of the genes involved in the bifidus shunt showed significant changes in gene expression, all were expressed at high-level in acid-adapted cells (Table 9). This suggested that the bifidus shunt continuously provided sufficient substrates and energy for ATR in BBMN68. In addition, BBMN68_1185, BBMN68_1187, and BBMN68_1188, which are responsible for the conversion from glucose-6-phosphate to ribulose-5-phosphate, were upregulated by more than 2 fold after acid-adaptation. This shift enhanced the organism's ability to utilize sugar and improved the efficiency of energy production in BBMN68.
Table 9

Expression of genes encoding the enzymes in bifidus shunt pathway.

Gene IDRPKM-controlRPKM-acid-adaptedFold changeCOGCodeGeneGene description
BBMN68_1185 237.79512.442.16* GCOG0364 zwf K00036, glucose-6-phosphate 1-dehydrogenase [EC:1.1.1.49]
BBMN68_1187 80.61173.562.15* GCOG0363 magB K01057, 6-phosphogluconolactonase [EC:3.1.1.31]
BBMN68_1188 815.251577.331.93GCOG0362 gnd K00033, 6-phosphogluconate dehydrogenase [EC:1.1.1.44]
BBMN68_408 1291.781065.78−1.21GCOG0021 tkTA K00615, transketolase [EC:2.2.1.1]
BBMN68_708 15692.5214640.71−1.07GCOG0021 xfp K01632, fructose-6-phosphate phosphoketolase [EC:4.1.2.22]
BBMN68_728 1635.391684.621.03CCOG0282 ackA K00925, acetate kinase [EC:2.7.2.1]
BBMN68_407 5065.683312.2−1.53GCOG0176 mipB K00616, transaldolase [EC:2.2.1.2]
BBMN68_254 4698.784345.62−1.08GCOG0057 gapA K00134, glyceraldehyde 3-phosphate dehydrogenase [EC:1.2.1.12]
BBMN68_399 1866.212178.881.17GCOG0126 pgk K00927, phosphoglycerate kinase [EC:2.7.2.3]
BBMN68_1687 2517.933284.091.30GCOG0588 gpmA K01834, 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase [EC:5.4.2.1]
BBMN68_771 2216.283869.751.75GCOG0148 eno K01689, enolase [EC:4.2.1.11]
BBMN68_738 2154.492225.711.03GCOG0469 pykF K00873, pyruvate kinase [EC:2.7.1.40]
BBMN68_700 7722.185888.39−1.31CCOG1882 pflD K00656, formate C-acetyltransferase [EC:2.3.1.54]
BBMN68_1333 1556.452074.641.33CCOG2352 ppc K01595, phosphoenolpyruvate carboxylase [EC:4.1.1.31]
BBMN68_193 1305.133774.022.89* CCOG0039 ldh K00016, L-lactate dehydrogenase [EC:1.1.1.27]
BBMN68_1612 215.49789.833.67* CCOG1012/1454 putA2 K04072, acetaldehyde dehydrogenase/alcohol dehydrogenase [EC:1.2.1.10 1.1.1.1]
BBMN68_872 211.48452.912.14* CCOG1012 putA1 K00128, aldehyde dehydrogenase (NAD+) [EC:1.2.1.3]
BBMN68_727 40.17102.162.54* GCOG0406K01834, 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase [EC:5.4.2.1]
BBMN68_624 92.57231.872.50* GCOG0406K15634, probable phosphoglycerate mutase [EC:5.4.2.1]

changed by more than 2 fold.

changed by more than 2 fold. In addition to energy production using carbohydrates, an energy supply pathway by utilizing branched chain amino acid (BCAA) was found in the cells after acid-adaptation. There are nine enzymes that regulate the synthetic pathway of L-leucine, L-isoleucine, and L-valine (Figure 5). The expression of the genes encoding these 9 enzymes showed an upregulated-trend. Seven of these genes were upregulated by more than 2 fold (Table 4). Previous studies have shown acid-stress-mediated metabolic shifts in leucine metabolism to produce ATP in Lactobacillus sanfranciscensis [50]. The shift to the biosynthetic pathway of BCAA could imply that producing ATP through leucine metabolism might meet the energy needs of the organism in BBMN68 under acid stress conditions. The shift to obtaining BCAA from the environment of the cells was also detected. BBMN68_1747 and BBMN68_1751, which encode two components of ABC-type BCAA transport systems were found to have been upregulated by more than 2 fold. This provides further evidence that BCAA is essential to cells under acid stress. This suggests that the acid resistance of bifidobacteria might be improved by the addition of BCAA.

Further discoveries

BBMN68_182, BBMN68_184, and BBMN68_185, encoding enzymes involved in the biosynthesis of histidine (Table 4), were upregulated by more than 2 fold. Histidine biosynthesis has been reported to be part of a stringent response in Gram-negative and Gram-positive bacteria. Broadbent has reported the intracellular accumulation of histidine in acid-adapted Lactobacillus casei, and adding histidine into the medium strengthened the acid tolerance at pH 2.5 [51]. This suggested that intracellular pools of histidine might also contribute to the ATR in BBMN68. Several genes in the biosynthesis pathway of aromatic amino acid (AAA) were upregulated by more than 2 folds (Table 4). BBMN68_1775, BBMN68_1595, BBMN68_88, and BBMN68_1544 encoding PLP-dependent aspartate, tyrosine, and aromatic aminotransferase were differential gene expression showed (Table 4). By analyzing the metabolism pathways, it was known that aspartate metablism provided the precursors to CCC and CEM. Previous studies have shown that aspartate can strengthen acid resistance of Lactobacillus casei [52]. These results might be an implication that the AAA metabolism and aspartate metabolism played a role in ATR in BBMN68. BBMN68_14 encoding MetK was found to be upregulated by 2.84 fold after acid-adaptation. MetK was found to catalyze the synthesis of S-adenosylmethionine (SAM). SAM plays a pivotal role in promoting the stability of macromolecules under stress conditions by participating in various methylation reactions. This supplied methyl for CFA synthesis. Methyl is an essential precursor of AI-2 and other compounds [53], [54]. BBMN68_1007 encoding 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase, which is involved in the biosynthesis of vitamin K2, was found to be upregulated by 2.44 fold (Table S2, COG H).In most anaerobes and all Gram-positive aerobes, vitamin K2 is the sole electron transporter in the respiratory chain is essential to their survival [55]. BBMN68_353 encoding Mg2+ transporter (CorA) was upregulated significantly by more than 2 folds (Table S2, COG P). This result was different from that of the 2010 Parry-Hanson study, which indicated that the acid-adaptation did not affect the expression of corA [56]. BBMN68_1264 encoding MFS was upregulated by 16.86 fold (Table S2, COG GEPR), but the identities of its transport substrates were not clear. However, the possibility that glucose was one of the substrates that supports the organisms' energy needs could not be ignored. Also, several genes encoding transposases or putative transposases were significantly downregulated (Table S1 COG L). This trend was opposite to Broadbent's detection: the expression of the genes encoding transposase was upregulated after ATR in Lactobacillus casei ATCC 334 [51]. The expression of many genes was found to have changed significantly in the acid-adapted cells, however, these changes could not be explained by current theoretical findings. The expression of these genes might be regulated by RRs and by other transcriptional regulators that were stimulated by the low-pH environment. However, these alternations in gene expression reflected the physiological needs for survival of the cells in response to the environment. The mechanism analysis of ATR in BBMN68 was summarized in Figure 5. When the cells were exposed to the low pH environment, the CEM acted as the one of first targets of high-concentration H+. The cell walls needed strengthening and the permeability of the membrane needed changing by alternating the fatty acid composition to keep H+ outside. When the H+ entered the cytoplasm, the cells had four main responses to the threat of H+: First, the F0F1-ATPase system began to discharge H+. Second, the ability of CCC to produce NH3 was strengthened to neutralize excess H+. Third, the cells used NER-UVR and NER-VSR to minimize the damage to DNA and used HtpX, IbpA, and γ-GC to protect proteins from acid stress. Fourth, the cells initiated global response signals ((p)ppGpp, polyP and Sec-SRP) to cause the whole cell to respond to the stress state. Besides, the cells secreted the QS signal (AI-2) to communicate among same-species cells by the cellular signal system, such as 2CS, to improve the overall survival rate. The cells also varied the pathways of producing energy by shifting to BCAA metabolism. Meanwhile, they enhanced their ability to utilize sugar to supply sufficient energy for the operation of the mechanism described above.

Conclusion

This is the first study to analyze the mechanism behind ATR in bifidobacteria using global gene expression profiling. Differential gene expression suggests that the mechanisms of ATR in BBMN68 are involved in blocking H+ with CEM, discharging H+ with F0F1-ATPase, neutralizing H+ by using CCC to produce NH3, protecting proteins with γ-GC, HtpX and IbpA, repairing the damaged DNA with NER-UVR and NER-Vsr, regulating global response with (p)ppGpp, tRNA, ployP, and Sec-SRP, and transmitting signal using the 2CS system and QS system. Physiological testing confirmed that H+-ATPase played an important role in ATR, and that acid resistance could be strengthened by inhibiting protein synthesis in BBMN68. Based on this study, adding BCAA, γ-GC, cysteine, and cystathionine into the acid-stress environment may be new strategies for the improvement of acid-resistance in bifidobacteria. This information can lead to better quality control and functionality of bifidobacterial probiotic products. Downregulated expression genes with no detail comments in text. (DOCX) Click here for additional data file. Upregulated expression genes with no detail comments in text. (DOCX) Click here for additional data file. Summary of RNA-seq data. (DOCX) Click here for additional data file.
  55 in total

1.  Use of gDNA as internal standard for gene expression in staphylococci in vitro and in vivo.

Authors:  S J Vandecasteele; W E Peetermans; R Merckx; M Van Ranst; J Van Eldere
Journal:  Biochem Biophys Res Commun       Date:  2002-03-01       Impact factor: 3.575

2.  Stationary-phase acid and heat treatments for improvement of the viability of probiotic lactobacilli and bifidobacteria.

Authors:  M Saarela; M Rantala; K Hallamaa; L Nohynek; I Virkajärvi; J Mättö
Journal:  J Appl Microbiol       Date:  2004       Impact factor: 3.772

3.  Adaptation by Streptococcus mutans to acid tolerance.

Authors:  I R Hamilton; N D Buckley
Journal:  Oral Microbiol Immunol       Date:  1991-04

4.  H+-ATPase activity in Bifidobacterium with special reference to acid tolerance.

Authors:  Mitsuharu Matsumoto; Hifumi Ohishi; Yoshimi Benno
Journal:  Int J Food Microbiol       Date:  2004-05-15       Impact factor: 5.277

5.  Escherichia coli small heat shock proteins, IbpA and IbpB, protect enzymes from inactivation by heat and oxidants.

Authors:  Masanobu Kitagawa; Mizuho Miyakawa; Yoshinobu Matsumura; Tetsuaki Tsuchido
Journal:  Eur J Biochem       Date:  2002-06

Review 6.  Stress responses in lactic acid bacteria.

Authors:  Maarten van de Guchte; Pascale Serror; Christian Chervaux; Tamara Smokvina; Stanislav D Ehrlich; Emmanuelle Maguin
Journal:  Antonie Van Leeuwenhoek       Date:  2002-08       Impact factor: 2.271

7.  LuxS-mediated signaling in Streptococcus mutans is involved in regulation of acid and oxidative stress tolerance and biofilm formation.

Authors:  Zezhang T Wen; Robert A Burne
Journal:  J Bacteriol       Date:  2004-05       Impact factor: 3.490

8.  Bifidobacterium lactis DSM 10140: identification of the atp (atpBEFHAGDC) operon and analysis of its genetic structure, characteristics, and phylogeny.

Authors:  Marco Ventura; Carlos Canchaya; Douwe van Sinderen; Gerald F Fitzgerald; Ralf Zink
Journal:  Appl Environ Microbiol       Date:  2004-05       Impact factor: 4.792

9.  Guanosine tetraphosphate inhibits protein synthesis in vivo. A possible protective mechanism for starvation stress in Escherichia coli.

Authors:  A L Svitil; M Cashel; J W Zyskind
Journal:  J Biol Chem       Date:  1993-02-05       Impact factor: 5.157

10.  Employment of stressful conditions during culture production to enhance subsequent cold- and acid-tolerance of bifidobacteria.

Authors:  J E Maus; S C Ingham
Journal:  J Appl Microbiol       Date:  2003       Impact factor: 3.772

View more
  11 in total

1.  Physiological and proteomic analysis of Lactobacillus casei in response to acid adaptation.

Authors:  Chongde Wu; Guiqiang He; Juan Zhang
Journal:  J Ind Microbiol Biotechnol       Date:  2014-07-26       Impact factor: 3.346

2.  The pH-dependent expression of the urease operon in Streptococcus salivarius is mediated by CodY.

Authors:  Szu-Chuan Huang; Robert A Burne; Yi-Ywan M Chen
Journal:  Appl Environ Microbiol       Date:  2014-06-20       Impact factor: 4.792

3.  Investigation of Growth Phase-Dependent Acid Tolerance in Bifidobacteria longum BBMN68.

Authors:  Junhua Jin; Jingyi Song; Fazheng Ren; Hongxing Zhang; Yuanhong Xie; Jingsheng Ma; Xue Li
Journal:  Curr Microbiol       Date:  2016-08-02       Impact factor: 2.188

4.  Genome-Wide Assessment of Stress-Associated Genes in Bifidobacteria.

Authors:  Marie Schöpping; Tammi Vesth; Kristian Jensen; Carl Johan Franzén; Ahmad A Zeidan
Journal:  Appl Environ Microbiol       Date:  2022-03-21       Impact factor: 4.792

5.  Starch and starch hydrolysates are favorable carbon sources for bifidobacteria in the human gut.

Authors:  Songling Liu; Fazheng Ren; Liang Zhao; Lu Jiang; Yanling Hao; Junhua Jin; Ming Zhang; Huiyuan Guo; Xingen Lei; Erna Sun; Hongna Liu
Journal:  BMC Microbiol       Date:  2015-03-01       Impact factor: 3.605

6.  Effect of Pre-Stressing on the Acid-Stress Response in Bifidobacterium Revealed Using Proteomic and Physiological Approaches.

Authors:  Junhua Jin; Qian Qin; Huiyuan Guo; Songling Liu; Shaoyang Ge; Hongxing Zhang; Jianyun Cui; Fazheng Ren
Journal:  PLoS One       Date:  2015-02-17       Impact factor: 3.240

Review 7.  Discovering probiotic microorganisms: in vitro, in vivo, genetic and omics approaches.

Authors:  Konstantinos Papadimitriou; Georgia Zoumpopoulou; Benoit Foligné; Voula Alexandraki; Maria Kazou; Bruno Pot; Effie Tsakalidou
Journal:  Front Microbiol       Date:  2015-02-17       Impact factor: 5.640

Review 8.  Biochemical Engineering Approaches for Increasing Viability and Functionality of Probiotic Bacteria.

Authors:  Huu-Thanh Nguyen; Dieu-Hien Truong; Sonagnon Kouhoundé; Sokny Ly; Hary Razafindralambo; Frank Delvigne
Journal:  Int J Mol Sci       Date:  2016-06-02       Impact factor: 5.923

9.  Transcriptomic analysis of Bifidobacterium longum subsp. longum BBMN68 in response to oxidative shock.

Authors:  Fanglei Zuo; Rui Yu; Man Xiao; Gul Bahar Khaskheli; Xiaofei Sun; Huiqin Ma; Fazheng Ren; Bing Zhang; Shangwu Chen
Journal:  Sci Rep       Date:  2018-11-20       Impact factor: 4.379

10.  Linoleic acid induces metabolic stress in the intestinal microorganism Bifidobacterium breve DSM 20213.

Authors:  Alice Senizza; Gabriele Rocchetti; Maria Luisa Callegari; Luigi Lucini; Lorenzo Morelli
Journal:  Sci Rep       Date:  2020-04-07       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.