Literature DB >> 23228209

Molecular phylogeny of microhylid frogs (Anura: Microhylidae) with emphasis on relationships among New World genera.

Rafael O de Sá1, Jeffrey W Streicher, Relebohile Sekonyela, Mauricio C Forlani, Simon P Loader, Eli Greenbaum, Stephen Richards, Célio F B Haddad.   

Abstract

BACKGROUND: Over the last ten years we have seen great efforts focused on revising amphibian systematics. Phylogenetic reconstructions derived from DNA sequence data have played a central role in these revisionary studies but have typically under-sampled the diverse frog family Microhylidae. Here, we present a detailed phylogenetic study focused on expanding previous hypotheses of relationships within this cosmopolitan family. Specifically, we placed an emphasis on assessing relationships among New World genera and those taxa with uncertain phylogenetic affinities (i.e., incertae sedis).
RESULTS: One mitochondrial and three nuclear genes (about 2.8 kb) were sequenced to assess phylogenetic relationships. We utilized an unprecedented sampling of 200 microhylid taxa representing 91% of currently recognized subfamilies and 95% of New World genera. Our analyses do not fully resolve relationships among subfamilies supporting previous studies that have suggested a rapid early diversification of this clade. We observed a close relationship between Synapturanus and Otophryne of the subfamily Otophryninae. Within the subfamily Gastrophryninae relationships between genera were well resolved.
CONCLUSION: Otophryninae is distantly related to all other New World microhylids that were recovered as a monophyletic group, Gastrophryninae. Within Gastrophryninae, five genera were recovered as non-monophyletic; we propose taxonomic re-arrangements to render all genera monophyletic. This hypothesis of relationships and updated classification for New World microhylids may serve as a guide to better understand the evolutionary history of this group that is apparently subject to convergent morphological evolution and chromosome reduction. Based on a divergence analysis calibrated with hypotheses from previous studies and fossil data, it appears that microhylid genera inhabiting the New World originated during a period of gradual cooling from the late Oligocene to mid Miocene.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23228209      PMCID: PMC3561245          DOI: 10.1186/1471-2148-12-241

Source DB:  PubMed          Journal:  BMC Evol Biol        ISSN: 1471-2148            Impact factor:   3.260


Background

The family Microhylidae is the fourth largest anuran family (after Hylidae, Strabomantidae, and Bufonidae), consisting of 487 currently recognized species representing 8.2% of extant anuran diversity. A monographic revision of the family Microhylidae was done over 75 years ago [1]. Parker defined the family Microhylidae on the basis of 12 non-synapomorphic morphological characters and grouped the 191 species known at the time into 43 genera and 7 subfamilies: Asterophryinae, Brevicipitinae, Cophylinae, Dyscophinae, Melanobatrachinae, Microhylinae, and Sphenophryninae. Three additional subfamilies were recognized in later publications: Phrynomerinae [2], Scaphiophryninae [3], and Otophryninae [4]. A morphological review of the family analyzed 188 characters in 56 genera and 105 species [5]. All available studies show that microhylids display extensive variation in adult external morphology, osteology, and musculature at inter- and intraspecific levels. Because of this variation, phylogenetic interpretations that use morphological features have been hindered by extensive homoplasy (see review of morphological variation [6]). In many cases, the morphological convergence in microhylids is likely due to specializations associated with a burrowing lifestyle [7]. However, the monophyly of the family is supported by 20 synapomorphies derived from larval anatomy [8]. The first broad-scale attempt to examine phylogenetic relationships of the Amphibia using DNA sequence and morphology [9] used a parsimony criterion to provide support for many higher-level taxonomic rearrangements that better reflect the phylogenetic history of living amphibians and also stimulated much discussion [10]. A more recent analysis [11] expanded the sampling, both in the number of taxa and molecular markers, and using model-based analyses recovered phylogenetic relationships that were largely congruent with the earlier study [9]. Pyron and Wiens recognized 11 nominal microhylid subfamilies and several unassigned genera as incertae sedis within Microhylidae (mostly New World genera). Additionally, the following subfamilies are currently recognized [12]: Hoplophryninae and Phrynomerinae (based on [13]), Kalophryninae [14], and Otophryninae [4]. Thus, as it is currently recognized, Microhylidae is globally distributed (Figure 1) with two subfamilies occurring in the New World (Gastrophryninae and Otophryninae) and nine subfamilies occurring in the Old World (Asterophryinae, Cophylinae, Dyscophinae, Hoplophryninae, Kalophryninae, Melanobatrachinae, Microhylinae, Phrynomerinae, and Scaphiophryninae). The highest levels of diversity occur in tropical regions and three of the Old World subfamilies are endemic to Madagascar (Cophylinae, Dyscophinae, and Scaphiophryninae). Furthermore, two subfamilies possess low levels of species diversity and highly restricted geographic distributions: Hoplophryninae (two species, endemic to Eastern Arc mountains of Tanzania, Africa) and Melanobatrachinae (one species, Western Ghats of Kerala and Tamil Nadu in India).
Figure 1

Maximum likelihood phylogram generated from concatenated nuclear and mitochondrial DNA sequences examined for this study (top) and approximate global distribution of microhylid subfamilies (bottom) based on spatial data from IUCN et al. (2006). See Van Bocxlaer et al. (2006) and Trueb et al. (2011) for hypotheses related to the placement of the monotypic Melanobatrachinae (not sampled in this study).

Maximum likelihood phylogram generated from concatenated nuclear and mitochondrial DNA sequences examined for this study (top) and approximate global distribution of microhylid subfamilies (bottom) based on spatial data from IUCN et al. (2006). See Van Bocxlaer et al. (2006) and Trueb et al. (2011) for hypotheses related to the placement of the monotypic Melanobatrachinae (not sampled in this study). New World microhylids (NWM) were initially included in the subfamily Microhylinae but this was demonstrated to represent a paraphyletic assemblage of both New and Old World taxa. Consequently, the subfamily Gastrophryninae was resurrected for a monophyletic clade consisting of all New World genera except Synapturanus[9]. Subsequent molecular analyses supported a monophyletic Gastrophryninae, though excluding Synapturanus and Otophryne[15,16]. More recently, Synapturanus was placed in the Otophryninae [11]. Currently, there are two subfamilies, 20 genera (nine monotypic), and 72 species of NWM [12]. To summarize, the subfamily Otophryninae includes two genera (Otophryne and Synapturanus) and five species and Gastrophryninae currently consists of 9 genera and 53 species. The two NWM genera occurring in North America were recently reviewed with examinations of phylogeographic variation: Hypopachus[17] and Gastrophryne[18]. The currently recognized species in each genus of NWM, are (with number of species in parentheses): Adelastes (1 sp.), Altigius (1sp.), Arcovomer (1 sp.), Hyophryne (1 sp.), Melanophryne (2 spp.), Myersiella (1 sp.), Relictivomer (1 sp.), Stereocyclops (2 spp.), Synapturanus (3 spp.), Syncope (3 spp.), Otophryne (2 spp.) and those genera in the subfamily Gastrophryninae are: Ctenophryne (2 spp.), Dasypops (1 sp.), Dermatonotus (1 sp.), Elachistocleis (13 spp.), Gastrophryne (4 spp.), Hamptophryne (1 spp.), Hypopachus (4 spp.), Nelsonophryne (2 spp.), and Chiasmocleis (25 spp.). While previous phylogenetic analyses [9,11,15,16] have offered much insight regarding microhylid evolution, these studies have included a low number of genera relative to the described levels of diversity (particularly within the NWM). In this paper we present a phylogenetic analysis of microhylid relationships featuring an unprecedented taxonomic sampling with emphasis on NWM diversity and relationships. In addition, we investigated the putative timing of lineage divergence in two ancient microhylid radiations, Gastrophryninae and Otophryninae.

Methods

Taxonomic sampling

We used the frequently cited amphibian systematics resource, Amphibian Species of the World [12] as a taxonomic reference for the allocation of genera to subfamilies and to identify those taxa with an incertae sedis status within Microhylidae. Focusing on NWM, our sampling within Microhylidae included representatives from 10 of the 11 recognized subfamilies (we did not include the monotypic subfamily Melanobatrachinae; see below for explanation). Microhylid genera included in the analyses were (in parenthesis is the percentage of currently recognized genera that we sampled from each subfamily): Oreophryne, Austrochaperina, Aphantophryne, Callulops, Choerophryne, Copiula, Cophixalus, Genyophryne, Hylophorbus, Liophryne, Metamagnusia, Sphenophryne, and Xenorhina, (59 % of Asterophryinae); Anodontohyla, Platypelis, Plethodontohyla, Rhombophryne, and Stumpfia, (71 % of Cophylinae); Dyscophus (100% of Dyscophinae); Chiasmocleis, Ctenophryne, Dasypops, Dermatonotus, Elachistocleis, Gastrophryne, Hamptophryne, Hypopachus, and Nelsonophryne (100% of Gastrophryninae); Hoplophryne (50% of Hoplophryninae); Kalophrynus (100% of Kalophryninae); Calluella, Chaperina, Glyphoglossus, Kaloula, Metaphrynella, Microhyla, Micryletta, Ramanella, and Uperodon (100% of Microhylinae); Otophryne (100% of Otophryninae); Phrynomantis (100% of Phrynomerinae); and Scaphiophryne (50% of Scaphiophryninae). The following genera currently considered incertae sedis within Microhylidae [12] were also sampled Altigius, Arcovomer, Gastrophrynoides, Hyophryne, Melanophryne, Myersiella, Relictivomer, Stereocyclops, Synapturanus, and Syncope; Phrynella sequences from Genbank were included in the analyses. In total, our sampling of New World microhylids (i.e., combined Gastrophryninae, Otophryninae, and incertae sedis genera), corresponds to 95% of currently recognized genera, missing only Adelastes. We also included 25 other ranoid frogs from families closely related to Microhylidae in our analysis as outgroups. These outgroup taxa were sampled from 8 families and included frogs in the following genera: Breviceps, Callulina, Probreviceps, and Spelaeophryne (Family Breviciptidae), Hemisus (Family Hemisotidae), Afrixalus, Hyperolius, and Kassina (Family Hyperoliidae), Arthroleptis and Leptopelis (Family Arthroleptidae), Gephyromantis (Family Mantellidae), Ptychadena (Family Ptychadenidae), Hylarana and Lithobates (Family Ranidae), Polypedates (Family Rhacophoridae), Strongylopus and Tomopterna (Family Pyxicephalidae). We used three distantly related outgroups to root our phylogenies: Xenopus laevis (Family Pipidae), Alytes obstetricians (Family Discoglossidae), and Scaphiopus holbrooki (Family Scaphiopodidae). Our global sampling included a combination of our own data (159 taxa; 70%) and DNA sequences downloaded from GenBank (68 taxa; 30%). Genbank accession numbers and voucher information for taxa used in our phylogenetic analyses can be found in Additional file 1; sequences from Genbank are listed in Additional file 2.

Molecular methodology

Total DNA was isolated from liver or muscle tissue using the Qiagen DNeasy kit (Valencia, California, USA). We used one mitochondrial (16S) and three nuclear (BDNF, tyrosinase, and 28S rRNA) genes. Gene fragments were amplified using previously published primer sets (Table 1). PCRs were conducted using Green or Red Taq polymerase (Promega) and a combination of previously described standard and touchdown thermal cycling profiles that are used to amplify nuclear and mitochondrial DNA from frogs [19,20]. PCR products were cleaned using Ampure magnetic beads (Agencourt® Bioscience, Beverly, Massachusetts, USA) or USB ExoSap-IT (US78201, Ambersham Biosciences, Piscataway, New Jersey, USA) and sequenced (in both primer directions) by SeqWright Corp. (Houston, Texas, USA; http://www.seqwright.com). Resulting chromatograms were visualized and cleaned using the programs Sequencher 5.0 (Gene Codes Corp., Ann Arbor, Michigan, USA). DNA sequences generated for this study were submitted to GenBank; accession numbers are given in Additional file 1.
Table 1

Primer sets used for the amplification and sequencing of nuclear (nDNA) and mitochondrial (mtDNA) DNA

Locus (Primer)TypeDirectionSequence (5’ to 3’)Reference
16S (16SAR)
mtDNA
F
CGCCTGTTTATCAAAAAC AT
[21]
16S (16SBR)
mtDNA
R
CCGGTCTGAACTCAGATCACGT
[21]
28S (28SV)
nDNA
F
AAGGTAGCCAAATGCCTC ATC
[22]
28S (28SJJ)
nDNA
R
AGTAGGGTAAAACTAACC T
[22]
BDNF (BDNF.Amp.F1)
nDNA
F
ACCATCCTTTTCCTTACTATG G
[16]
BDNF (BDNF.Amp.R1)
nDNA
R
CTATCTTCCCCTTTTAATGGTC
[16]
Tyrosinase (TyrC)
nDNA
F
GGCAGAGGAWCRTGCCAAGATGT
[23]
Tyrosinase (TyrG)nDNARTGCTGGCRTCTCTCCARTCCC A[23]
Primer sets used for the amplification and sequencing of nuclear (nDNA) and mitochondrial (mtDNA) DNA

Phylogenetic analyses

Sequence alignments for each locus were initially produced in Sequencher 5.0 or SATé-II [24] using MAFFT aligner and OPAL merger and further modified by eye. For ribosomal subunit genes (28S and 16S) we excluded regions that likely correspond to hyper variable loop regions that were ambiguously aligned (i.e., we removed any regions possessing multiple gapped sites that did not contain readily identifiable sequence motifs). We used the program MacClade 4.08 [25] to infer reading frames for protein coding regions (BDNF, Tyr) and to concatenate the four loci. Our concatenated alignment was deposited in TreeBase (http://www.treebase.org; Study ID: 13478). We only included individuals in our analyses that possessed two or more of the four loci. This criterion excluded the taxon Melanobatrachus indicus (Melanobatrachinae) since at present there is only a single locus available that overlaps with our genetic sampling (16S). Given the size of our dataset, we used the CIPRES gateway server [26] to run parallel versions of several programs including GARLI 1.0[27], PAUPRat [28], BEAST 1.7.2 [29] and MrBayes 3.1.2 [30]. All of these programs were run using machines on the XSEDE server. We also conducted several analyses locally using the program MEGA 5.05 [31]. Collectively our analyses span three widely used phylogenetic criteria for tree searching (Probabilistic: GARLI 1.0, BEAST 1.7.2, and MrBayes 3.1.2; Parsimony: PAUPRat; and Distance: MEGA 3.1.2). For probabilistic analyses, we employed the GTR+I+G model of nucleotide evolution for all genes and partitions since all other substitution models are incorporated within the GTR model [11,32]. Maximum likelihood (ML) analyses were conducted in GARLI 1.0 using default settings and 1000 bootstrap pseudoreplicates (in the form of 20 runs of 50 pseudoreplicates on the XSEDE server). Each GARLI 1.0 analysis invoked a single GTR+I+G model with four gamma categories applied across the entire concatenated dataset. We conducted additional probabilistic analyses by running Bayesian Markov Chain Monte Carlo (BAYES MCMC) simulations in the program MrBayes 3.1.2. These parallel Bayesian analyses were partitioned into eight segments by gene (28S, 16S) and codon position (BDNF and Tyr) using all GTR+I+G models and run for ten million generations with sampling occurring every 1000 generations. We confirmed that each of our MCMC runs had converged by examining the standard deviation of split frequencies and by checking for topological convergence with the online program AWTY [33]. To employ a maximum parsimony (MP) criterion, we conducted 10 searches of 200 iterations each using PAUPRat. Finally, we performed minimum evolution (ME) analyses using 1000 bootstrap pseudorelicates in MEGA 5.05. When necessary, resulting trees from our searches were summarized using TreeAnnotator 1.7.2 and TreeStat 1.7.2 (as implemented in the BEAST software package) and visualized in FigTree 1.3.1 [34].

Divergence date estimation

To leverage our extensive sampling of NWM (Gastrophryninae + Otophryninae) and to provide a relative temporal framework for patterns recovered during our analyses, we generated a time tree in BEAST 1.7.2. Prior to generating divergence estimates, we pruned the family-scale dataset so that each NWM genus was represented by no more than five nominal member species. Our time tree was calibrated by using three nodal constraints that correspond to: (1—2) the respective origins proposed for Otophryninae and Gastrophryninae [15] and (3) fossil records for Gastrophryne from North America [35]. A previous study [15] used two different relaxed clock methods to estimate dates [36,37]; in their study their estimates (across both methodologies) ranged from 51.7 to 69.1 mya for the origin of Otophryninae and 66.8 to 91.4 mya for the origin of Gastrophryninae. To use these hypotheses of divergence, we took the mean of each estimate (60.4 mya, Otophryninae; 79.1 mya, Gastrophryninae) and by using a normal distribution with 5 standard deviations constrained these nodes to the approximate ranges reported before [15]. A similar strategy was employed to incorporate the ca. 1.7 my old series of Gastrophryne fossils [35,38] by using a normal distribution with 0.5 standard deviations to constrain the node leading to G. carolinensis, G. olivacea, and G. mazatlanensis as having occurred between 0.72 and 2.68 mya. This calibration point was used because several G. carolinensis, G. olivacea, and G. mazatlanensis fossils have been reported from Pleistocene deposits ranging in age from 0.24 to 1.8 mya [38]. We employed a lognormal relaxed clock and a Yule speciation prior [39] to estimate trees and divergence dates in a Bayesian MCMC run featuring a chain length of ten millions with sampling occurring every 1000 generations. We partitioned our dataset by gene and applied unlinked GTR+I+G models with 4 gamma rate categories to each of the 4 partitions. We used Tracer 1.5 [40] to view the BEAST 1.7.2 output and identify that all parameters were adequately sampled (i.e., ESS > 200). A burn-in of 1000 was used prior to summarizing time trees.

Results and discussion

Molecular analysis

Our family level data matrix consisted of 225 taxa, and 2673 base pairs (BDNF [711 bp], Tyr [551 bp], 28S [738 bp], and 16S [673 bp]). This concatenated dataset contained 938 parsimony informative characters, 239 uninformative variable characters, and 1496 constant (invariant) characters. The amount of phylogenetic information was variable across loci (number of parsimony informative sites/total sites): Tyr (313/551, 60%), BDNF (221/711, 31%), 28S (49/738, 6.6%), and 16S (355/673, 52%). The results of our phylogenetic analyses were largely consistent with previous studies. This is particularly encouraging given that our study included fewer nucleotide characters than either of those studies [15,40]. Our ML data matrix consisted of 361,442 unique patterns and resulted in a topology with a log likelihood score of −46681.5016. We recovered almost identical topologies from the ML and Bayesian MCMC searches with most variation confined to the internal composition of tip groups. The examination of topological convergence (AWTY analysis) between our parallel Bayesian searches revealed that while the analyses did not converge, at around five million generations they stabilized at approximately 2 symmetric differences from one another. Subsequent examination of consensus trees from each run revealed few differences, so we derived posterior probabilities from these 10,000 tree sets using a burn-in of 5000 samples. Our tree searches that employed a parsimony ratcheting approach recovered largely concordant patterns with Bayesian and likelihood analyses. We were required to remove 15 taxa from our alignment in order to conduct the distance-based (ME) analyses because pair-wise estimates could not be generated due to missing data. While the resulting ME searches featured topologies with broadly consistent patterns relative to the parsimony and probabilistic analyses, we recovered weak nodal support for most groupings beyond shallow phylogenetic depths and several alternative arrangements of taxa relative to the MP, ML, and BAYES MCMC analyses. We do not, however, interpret these inconsistencies as meaningful given the known effects of missing character information on distance-based criteria and the variable genetic sampling strategy we employed [41,42]. The placement of samples obtained from GenBank, e.g., Copiula sp. [GB] and Cophixalus sp. [GB] suggests that these taxa may have been misidentified in previous studies. Below, we summarize our phylogenetic results based on the ML tree (Figures 2, 3, 4) in relation to (1) incertae sedis genera and (2) microhylid subfamilies. Bootstrap support values of 70% or higher were considered to be relatively strong nodal support [43]; clades that were topologically supported in the parsimony analysis are indicated in Figures 2, 3, 4 with a “P”.
Figure 2

Maximum likelihood phylogram depicting relationships between microhylid taxa sampled for this study. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 3 and 4 .

Figure 3

Maximum likelihood phylogram depicting relationships between microhylid taxa sampled for this study. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 2 and 4 .

Figure 4

Maximum likelihood phylogram depicting relationships within the subfamily Gastrophryninae. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 2 and 3 .

Maximum likelihood phylogram depicting relationships between microhylid taxa sampled for this study. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 3 and 4 . Maximum likelihood phylogram depicting relationships between microhylid taxa sampled for this study. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 2 and 4 . Maximum likelihood phylogram depicting relationships within the subfamily Gastrophryninae. Nodal support values above nodes correspond to ML bootstrapping, BAYES MCMC posterior probabilities, and ME bootstrapping respectively. * = value of 100, P = clade also recovered by MP PAUPRat analysis, GB = DNA sequences from GenBank (Additional file 2); see also Figures 2 and 3 .

Genera currently placed as incertae sedis

With the single exception of Adelastes hylonomos our analyses included all incertae sedis genera currently placed in Microhylidae [12]. Regarding incertae sedis taxa originating from the Old World, we recovered Gastrophrynoides as a basal member of the Asterophryinae and Phrynella nested within Metaphrynella in the subfamily Microhylinae (Figures 2, 3). These findings are in overall agreement with a recent study, except that Phrynella was previously found as the sister taxon to Metaphrynella[44]. Consequently, herein we place Gastrophrynoides in the Asterophryinae and Phrynella in the Microhylinae. All of the incertae sedis genera we sampled from the New World were placed within the Gastrophryninae by our analyses, except Synapturanus that was recovered as the sister taxon to Otophryne (Figure 4). The high-altitude Melanophryne was consistently placed in a clade with Nelsonophryne and Ctenophryne, although the relationships among these genera varied. The clade containing these three genera is the sister group to all other gastrophrynines. The genus Chiasmocleis as currently recognized is polyphyletic consisting of three distinct groups 1) Chiasmocleis panamensis (which is more closely related to Elachistocleis than other Chiasmocleis species), 2) a clade consisting of three species of Chiasmocleis nested in Syncope, and 3) all other species of Chiasmocleis. Relictivomer is nested within Elachistocleis; Dasypops is the sister taxon to Myersiella and these two genera share a sister relationship with Stereocyclops; Hyophryne is nested within Stereocyclops; and Arcovomer is sister to a clade containing Altigius and Hamptophryne.

Relationships among Microhylid subfamilies

The monophyly of Microhylidae is strongly supported on the basis of morphology [8,45] and molecules [9,11], this study). Additionally, the existence and content of 11 major microhylid evolutionary lineages (i.e., subfamilies) is nearing a consensus [9,11,15,16], this study]. The relationship of these subfamilies to one another, however, remains enigmatic with each available dataset recovering a slightly different phylogenetic arrangement at this deep evolutionary tier. The poor resolution of inter familial-relationships is likely to be related to the short amount of evolutionary time that separated the origin of each major group during the late Cretaceous [15]. While our analysis did not recover branch support for inter-familial relationships, below we discuss the similarities and differences between our results and those of the four previous studies that sampled microhylids at this phylogenetic depth [9,11,15,16]. Our analyses produced strong support for the reciprocal monophyly of eight of the ten subfamilies we sampled. Although Microhylinae and Gastrophryninae did not receive nodal support in our bootstrapping analyses, these two subfamilies were monophyletic in the ML tree and received strong support from the Bayesian analyses (see Figures 2, 3, 4). Hoplophryninae and Scaphiophryninae were recovered as the earliest branches on the microhylid tree, followed by two major clades consisting of the remaining subfamilies [branching order in brackets]: (1) Gastrophryninae, Asterophryinae, Cophylinae, Phrynomerinae, Otophryninae, and Kalophryninae {Gastrophryninae [Asterophryinae (Cophylinae (Phrynomerinae (Otophryninae-Kalophryninae)))]} and (2) Microhylinae and Dyscophinae (Figures 1, 2, 3, 4). In contrast to our analyses, other studies recovered the most basal lineages as: Phrynomerinae [11,15,44], Phrynomerinae-Gastrophryninae [16], or Kalophrynus (Synapturanus (PhrynomantisMicryletta))] [9]. The somewhat basal position of Scaphiophryninae in our analyses has not been suggested previously; this taxon was found either closely related to Microhylinae [9] or Cophylinae [16]. The close relationship between Dyscophinae and Microhylinae has been suggested before, but with alternative sister relationships to either Asterophryinae [15,16,44] or to (Kalophryninae-(Melanobatrachinae-Asterophryinae)) [11]. An arrangement in which Microhylinae is closely related to Scaphiophryninae and Dyscophinae to Asterophryinae has also been suggested [9]. The second, and largest, clade recovered consists of the remaining subfamilies: 1) a basal Gastrophryninae, 2) Asterophryinae basal to the remaining subfamilies, and 3) Cophylinae basal to a clade consisting of [Phrynomerinae (Otophryninae-Kalophryninae)]. Previous analyses recovered a Phrynomerinae basal to all microhylids [11,15,16]; Phrynomantis was considered incertae sedis[9]. Kalophryninae or Otophryninae were not sampled [16,44] and Kalophryninae was recovered in a clade with Cophylinae and Melanobatrachinae [15] or in a clade with Melanobatrachinae and Asterophryinae [11]. Gastrophryninae has been reported to have a variety of phylogenetic affinities including: 1) a sister relationship with Cophylinae [9,44], 2) basal to all microhylids excluding Synapturanus, Scaphiophryne, Hoplophryne, and Phrynomantis[15], 3) a sister relationships with Phrynomerinae [16], and 4) within a monophyletic clade containing Hoplophryninae and Cophylinae that is basal to all other subfamilies excluding Phrynomerinae and Otophryninae [11]. Given the amount of instability regarding these sub-familial relationships across different studies, we feel that any tenable phylogenetic hypothesis of their relatedness will await additional genetic sampling. However, it is interesting to note that using an almost independent data set we recovered patterns indicative of rapid and early diversification in microhylids that are consistent with previous studies [15].

Relationships within Old world subfamilies

The content and phylogenetic arrangement of taxa within Hoplophryninae, Scaphiophryninae, Dyscophinae, Phrynomerinae, and Kalophryninae was consistent with previous analyses. Within Microhylinae we recovered three major clades consisting of: 1) the widespread Micryletta inornata complex, 2) Ramanella, Uperodon, Kaloula, Phrynella, and Metaphrynella, and 3) Chaperina, Microhyla, Calluella, and Glyphoglossus. The content of these clades is broadly consistent with previous molecular studies [46]. Within our sampling of this subfamily four genera appear to be paraphyletic: Kaloula, Microhyla, Calluella, and Ramanella. Previous research suggests that levels of diversity within the subfamily Asterophryninae are staggering [47]. We employed a sampling strategy to maximize our taxonomic coverage (i.e., we selected evolutionarily distinct lineages based on previous mtDNA studies). Given the phylogenetic depth and diversity within this group, our strategy resulted in many long branches and weakly supported nodes. While our commentary on relationships within this subfamily is limited, as previously reported [47] it seems likely that the genera Copiula, Callulops, Cophixalus, and Liophryne are paraphyletic taxa. Our analyses were consistent with previous studies in the clustering of some Liophryne species and Sphenophryne, a monophyletic Oreophryne, and a monophyletic Xenorhina. As was observed in the original description [48], our trees placed Metamagnusia as a close relative of Xenorhina. Within the Cophylinae the relationships that we recovered are very similar to those reported in a previous molecular study [49].

Relationships among New world Genera and taxonomic implications

We recovered a close relationship between Otophryne and Synapturanus and therefore we agree with the recent placement of Synapturanus in this subfamily [11]. In light of all available studies that included Otophryne and/or Synapturanus and our analyses that included all other New World genera (except Adelastes), it is likely that Otophryninae is more closely related to other microhylid subfamilies than it is to the sympatric subfamily Gastrophryninae. The distinctiveness of Otophryne from all other NWM was noted earlier based on the following unique combination of morphological characters: omosternum present, clavicles straight, and a well-developed tympanum [50]. Furthermore, this author indicated that elsewhere in the Microhylidae this combination is only found in the genus Kalophrynus (member of the Asian subfamily Kalophryninae). A similar relationship between Kalophrynus and Otophryninae was observed in a family-level morphological analysis [5]. Interestingly, our family-level analysis also recovered Kalophryninae and Otophryninae as sister taxa, although with weak nodal support (Figure 2). Because NWM are not a monophyletic assemblage, previous morphological studies that assessed relationships among NWM and included Otophryne and/or Synapturanus along with Gastrophryninae genera need to be reassessed since morphological and karyological similarities between Otophryninae and Gastrophryninae are either primitive characters present in both lineages or homoplasies resulting from parallel or convergent evolution. Below, we suggest several taxonomic changes within the Gastrophryninae to better reflect the evolutionary history of this subfamily (Figure 4).

Ctenophryne, Melanophryne, and Nelsonophryne

The most recently described genus of NWM, Melanophryne Lehr and Trueb, 2007, forms a monophyletic group with Nelsonophryne Frost, 1987 and Ctenophryne Mocquard, 1904. Our phylogenetic analyses recovered variable patterns of relatedness among these genera (see support values in Figure 4). Our ME analysis recovered a monophyletic Ctenophryne and Melanophryne nested within Nelsonophryne. In the ML analysis, Melanophryne is basal to the entire Ctenophryne-Nelsonophryne clade, whereas in the Parsimony and Bayesian MCMC topologies N. aterrima has a basal position and Melanophryne is closer to a clade consisting of CtenophryneN. aequatorialis. The presence of a maxilla-quadratojugal articulation in Ctenophryne and N. aequatorialis and its absence in N. aterrima was recently reported [6]. Potential morphological differences between Nelsonophryne and Ctenophryne are: Nelsonophryne has neopalatines whereas Ctenophryne lacks them [51,52] and distal carpals 3—5 fuse in Ctenophryne whereas only 4—5 fused in Nelsonophryne[6]. Undoubtedly, this clade needs further study and we suspect that additional species will be discovered and relationships will need further assessment. However, given the shallow phylogenetic depth of the Ctenophryne+Melanophryne+Nelsonophryne clade and to tentatively resolve the paraphyly of Nelsonophryne, we place Nelsonophryne Frost, 1987 and Melanophryne Lehr and Trueb, 2007 in the synonymy of Ctenophryne Mocquard, 1904, which produces the new taxonomic combinations Ctenophryne aequatorialis (Peracca, 1904), Ctenophryne aterrima (Günther, 1901), Ctenophryne barbatula (Lehr and Trueb, 2002), and Ctenophryne carpish (Lehr, Rodríguez, and Córdova, 2007). Described larvae for this clade are: Ctenophryne aterrima[53], C. aequatorialis, C. carpish[54], and C. gaeyi[55].

Chiasmocleis and Syncope

The genus Syncope Walker, 1973 was recovered in a clade with Chiasmocleis bassleri, C. hudsoni, and C. magnova, rendering Chiasmocleis Mehely, 1904 paraphyletic. There are two alternative solutions to resolve this paraphyly: 1) synonymize Syncope with Chiasmocleis or 2) recognize Syncope as a separate evolutionary lineage and transfer some currently recognized species of Chiasmocleis to Syncope. We opted for the second alternative to recognize the separate evolutionary trajectory of this lineage based on shared morphological and life history traits. Zweifel [56]:21] suggested the possibility of a close relationship between Syncope and some Chiasmocleis species based on digital reduction. Syncope currently consists of three species and, in terms of overall body size, it contains the smallest species of gastrophrynine microhylids. Furthermore, Syncope species have lost two vertebrae and have reduced and/or lost fingers I and IV. A similar pattern of small adult body size and digit reduction is present in the species of Chiasmocleis that we found to share phylogenetic affinities with Syncope: Chiasmocleis bassleri, C. hudsoni, and C. magnova. Other Chiasmocleis (apart from C. jimi and C. supercilialbus[57,58]) do not show reduction in adult body size and/or the number of digits. A life history trait that may further unite Syncope with the small Chiasmocleis species is their reproductive mode. Syncope antenori was thought to have direct-development based on large eggs and small clutch sizes [59,60]. However, this taxon was later shown to have free-swimming, endotrophic larvae that develop in water-filled bromeliads [60]. The original description of C. magnova also suggested that the species might be a direct developer [58], based mainly on the presence of large eggs in the oviducts of the holotype. Thus, based on egg size, S. antenori and C. magnova may have similar reproductive modes. Herein, we place the following species of Chiasmocleis in the genus Syncope which produces the new taxonomic combinations S. bassleri (Dunn 1949), S. hudsoni (Parker, 1940) and S. magnova (Moravec and Köhler, 2007) (based on our phylogeny) and S. jimi and S. supercilialbus based on the morphological description of the species (‘…first toe reduced,’ [57]:2]) and (‘…fingers I and IV reduced…’ [58]:60]). This new taxonomic re-arrangement renders Chiasmocleis Mehely, 1904 monophyletic (with exception to C. panamensis; see below) and expands the content of Syncope Walker, 1973. Furthermore, this taxonomic arrangement recognizes the unique morphological patterns (i.e., a trend toward smaller adult body size and reduction and loss of vertebrae and/or digits in the forelimbs)and specialized life history traits in Syncope. It is also consistent with morphological variation in the pectoral girdle where there has been a complete loss of the connection between coracoids and epicoracoid in S. antenori and S. magnova (and a reduced connection in S. jimi and S. hudsoni) whereas the connection is present in Chiasmocleis[61]. Free-swimming larvae have been reported for Chiasmocleis alagoanus[62], C. albopunctata[63], C. anatipes[64], C. carvalhoi[65], C. leucosticta[66], C. mantiqueira[67], C. shudikarensis[68], and C. ventrimaculata[55,69]. Description of Syncope larvae is limited to S. antenori[60] and S. hudsoni[69]. Another problematic species is Chiasmocleis panamensis that was not recovered within Chiasmocleis or Syncope, but rather as the sister taxon of the genus Elachistocleis; a relationship recovered with robust support in all our analyses. Therefore, we place C. panamensis in the genus Elachistocleis that produces the new taxonomic combination Elachistocleis panamensis (Dunn et al., 1948). The phylogenetic placement E. panamensis is not surprising given that 1) the original description of species includes the following statement: “… Dunn was quite dubious as to their identity but thought they might be Elachistocleis, at that time the only microhylid recorded from Panama” [70]:1] and 2) a previous morphological analysis placed this taxon outside of Chiasmocleis, although not closely related to Elachistocleis[61].

Stereocyclops and Hyophryne

The Bahia yellow frog, Hyophryne histrio Carvalho, 1954, was consistently recovered as nested within Stereocyclops (Figure 4). Consequently, we place the monotypic Hyophryne in the synonymy of Stereocyclops Cope 1870. This arrangement produces the new taxonomic combination: Stereocyclops histrio (Carvalho, 1954). Hyophryne was considered morphologically related to Stereocyclops and the two genera were separated based on characteristics of the pectoral girdle, particularly a long clavicle and a reduced procoracoid in Stereocyclops and short clavicle and long procoracoid in Hyophryne[51]. However, a recent study showed the procoracoid to be highly variable in Hyoprhyne[71]. Hyophryne has been included only in two other studies [53,56]. One study [56] found no diagnostic characters to separate Hyophryne from Stereocyclops and the author indicated that “…nonmorphological data on Hyophryne (it is known only from the holotype) should help define its position.” A study that assessed the relationships of Altigius to putative relatives recovered Hyophryne closely related to Hamptophryne[72]. Most recently, a study provided a detailed analysis of Hyophryne that significantly increased our understanding of the morphology and biology of this poorly known genus [71]; the author concluded that Hyophryne was the sister taxon of Stereocyclops. The larva of S. histrio is unknown whereas descriptions are available for S. incrassatus[73,74] and S. parkeri[74].

Arcovomer, Altigius, and Hamptophryne

In our consensus topology, Arcovomer passarellii Carvalho, 1954 is most closely related to Altigius alios Wild, 1995 and Hamptophryne boliviana (Parker, 1927). Currently, all three of these genera are monotypic. However, two new species of Arcovomer from Brazil, one from central-north São Paulo and the other one from Espírito Santo, are being described by one of us (CFBH). Given the close phylogenetic relationship between Altigius and Hamptophryne, we place the genus Altigius in the synonymy of Hamptophryne Carvalho, 1954 which produces the new taxonomic combination Hamptophryne alios (Wild, 1995). A close affinity between Arcovomer and Hamptophryne was previously suggested [51] based on both genera lacking neopalatines and having divided prevomers. The condition of the posterior vomers has been reported to vary in this clade with H. boliviana possessing posterior vomers reduced to small plates and Arcovomer possessing these elements as a fused single element found anterior to the parasphenoid. Osteological information for H. alios is very limited and incomplete but the original description indicates “…posterior vomer and neopalatines not distinguishable” [72]. Descriptions of larvae within this clade are available for H. alios[72] and H. boliviana[64]. The larva of Arcovomer has not been described.

Dasypops and Myersiella

We recovered strong support for a sister relationship between the genera Myersiella Carvalho, 1954, and Dasypops Miranda-Ribeiro, 1924 (Figure 4). While both of these genera are currently monophyletic, at least one new species of Myersiella from Minas Gerais, Brazil, is being described by one of us (CFBH). These genera are similar in having small heads relative to total body size; in Dasypops the snout is broad and truncated whereas it is narrow and pointed in Myersiella[56]. These genera can be differentiated by 1) the fingers and toes which are swollen in Dasypops and slender in Myersiella[75] and 2) presence of clavicle and procoracoid in Dasypops but absent in Myersiella[51]. Herein, we note some additional differences between those two genera: 1) the condition of finger IV which is comprised of two phalanges in Dasypops and three in Myersiella, 2) a broad parasphenoid that extends beyond the choanae in Dasypops and a slender and not reaching the choanae in Myersiella, 3) the advertisement call which is trilled in Dasypops and consists of simple whistles [76] in Myersiella[77], and 4) aquatic and free-swimming larvae in Dasypops[77] and direct-development in Myersiella[78]. The phylogenetic placement of Myersiella deep within the Gastrophryninae may represent a notable instance of convergence given the morphological [56], behavioral, and reproductive [79] characteristics it shares with the otophrynine Synapturanus.

Dermatonotus, Elachistocleis, Relictivomer, Gastrophryne, and Hypopachus

The monotypic Dermatonotus Mehely, 1904 is sister to a clade that includes Elachistocleis, Gastrophryne Fitzinger, 1843 and Hypopachus Keferstein, 1867. Dermatonotus was proposed to be ‘allied’ with Hypopachus and Gastrophryne[51]; furthermore Carvalho suggested that the genus might be “….close to the ancestral stock that gave rise to Nelsonophryne (= Glossostoma; sensu Günter, 1901), Hypopachus, Gastrophryne, Relictivomer, Elachistocleis, Dasypops, Myersiella, and Synapturanus.” Also, a close association among NelsonophryneGlossostoma], Hypopachus, Gastrophryne, and Elachistocleis was suggested previously [76,80]. Our results agree with the previous suggestion that Dermatonotus is basal to several genera: Hypopachus, Gastrophryne, Elachistocleis, and Relictivomer. However, Dasypops, Myersiella, and Ctenophryne (including ‘Glossostoma’) appear to have resulted from earlier branching events in the Gastrophryninae tree than Dermatonotus. The phylogenetic patterns that we recovered for Dermatonotus, Elachistocleis, Gastrophryne, and Hypopachus are generally congruent with previous molecular studies [11,16,17], although Dermatonotus was not included in the latter study. While Dermatonotus is presently considered to be monotypic it is likely to represent a complex of species distributed from the Chaco of Argentina to Bolivia, Paraguay and reaching northeastern Brazil (Maranhão State). Furthermore, a second species is being described from Northeastern Brazil by one of us (CFBH). Our analyses recovered the monotypic genus Relictivomer nested within a well-supported clade of Elachistocleis samples (Figure 4). A close relationship between these genera was previously suspected on the basis of morphology [61]. Relictivomer was differentiated from Elachistocleis[51] based on the presence of reduced posterior vomers in the former and their absence in the latter genus. Based on our phylogeny, we return R. pearsei (Ruthven, 1914) to the genus Elachistocleis Parker, 1927 resurrecting the taxonomic combination Elachistocleis pearsei. Adult Elachistocleis, including E. pearsei, have the following combination of characters: clavicle short and curved, distal end of the clavicle curved not touching the coracoid, procoracoid divided, and the last three vertebrae longer than wide. The condition of the last three vertebrae is a putative synapomorphy for Elachistocleis. While this state in adult E. panamensis awaits confirmation, a juvenile specimen exhibited wider than long vertebrae; the juvenile condition could imply the retention of the ancestral state in this early branching lineage of Elachistocleis or that the last three vertebrae grow postmetamorphically becoming longer than wider in adults. Our analyses also support the recent placement of Gastrophryne usta and G. pictiventris in Hypopachus[18]. However, we recovered a different phylogenetic arrangement among members of the genus Gastrophryne. Previous authors hypothesized that G. elegans and G. olivacea are sister taxa, our analyses exclusively grouped G. carolinensis and G. olivacea (as previously suggested [80]). However, our analyses recovered a paraphyletic G. carolinensis with respect to G. olivacea and G. mazatlanensis. Though it warrants further exploration, this enigmatic result may be related to the regular hybridization that occurs between G. carolinensis and G. olivacea[18] and our molecular sampling strategy that was biased towards nuclear DNA. Free swimming larvae for this clade have been described for: Dermatonotus[81-83], Elachistocleis bicolor[73], E. ovalis[84], E. panamensis[85], E. pearsi[86], E. surinamensis[87], Gastrophryne carolinensis[88,89], G. elegans[90], G. olivacea[89], Hypopachus barberi[91,92], H. pictiventris[53], H. ustum[90], and H. variolosus[89,93]. A summary of proposed taxonomic changes is provided in Table 2.
Table 2

Redefined content of the subfamily Gastrophryninae with proposed taxonomic modifications (bold text), original subfamily designations, and larval description citations by taxon

Old taxonomyNew taxonomyOriginal placementLarval description
Ctenophryne geayi
Ctenophryne geayi
Gastrophryninae
[56]
Ctenophryne minor
Ctenophryne minor
Gastrophryninae
None
Nelsonophryne aequatorialis
Ctenophryne aequatorialis
Gastrophryninae
[54]
Nelsonophryne aterrima
Ctenophryne aterrima
Gastrophryninae
[53]
Melanophryne barbatula
Ctenoprhyne barbatula
incertae sedis
None
Melanophryne carpish
Ctenophryne carpish
incertae sedis
[54]
Syncope antenori
Syncope antenori
incertae sedis
[68]
Syncope carvalhoi
Syncope carvalhoi
incertae sedis
None
Syncope tridactyla
Syncope tridactyla
incertae sedis
None
Chiasmocleis bassleri
Syncope bassleri
Gastrophryninae
None
Chiasmocleis hudsoni
Syncope hudsoni
Gastrophryninae
None
Chiasmocleis jimi
Syncope jimi
Gastrophryninae
None
Chiasmocleis magnova
Syncope magnova
Gastrophryninae
None
Chiasmocleis supercilialbus
Syncope supercilialbus
Gastrophryninae
None
Chiasmocleis alagoanus
Chiasmocleis alagoanus
Gastrophryninae
[62]
Chaismocleis albopunctata
Chaismocleis albopunctata
Gastrophryninae
[71]
Chasimocleis anatipes
Chasimocleis anatipes
Gastrophryninae
[47]
Chiasmocleis atlantica
Chiasmocleis atlantica
Gastrophryninae
None
Chiasmocleis avilapiresae
Chiasmocleis avilapiresae
Gastrophryninae
None
Chiasmocleis capixaba
Chiasmocleis capixaba
Gastrophryninae
None
Chiasmocleis carvalhoi
Chiasmocleis carvalhoi
Gastrophryninae
[72]
Chiasmocleis centralis
Chiasmocleis centralis
Gastrophryninae
None
Chiasmocleis cordeiroi
Chiasmocleis cordeiroi
Gastrophryninae
None
Chiasmocleis crucis
Chiasmocleis crucis
Gastrophryninae
None
Chiasmocleis devriesi
Chiasmocleis devriesi
Gastrophryninae
None
Chiasmocleis gnoma
Chiasmocleis gnoma
Gastrophryninae
None
Chiasmocleis hudsoni
Chiasmocleis hudsoni
Gastrophryninae
[73]
Chiasmocleis leucosticta
Chiasmocleis leucosticta
Gastrophryninae
[74]
Chiasmocleis mantiqueira
Chiasmocleis mantiqueira
Gastrophryninae
[75]
Chiasmocleis mehelyi
Chiasmocleis mehelyi
Gastrophryninae
None
Chiasmocleis sapiranga
Chiasmocleis sapiranga
Gastrophryninae
None
Chiasmocleis schubarti
Chiasmocleis schubarti
Gastrophryninae
None
Chiasmocleis shudikarensis
Chiasmocleis shudikarensis
Gastrophryninae
[76]
Chiasmocleis ventrimaculata
Chiasmocleis ventrimaculata
Gastrophryninae
[56,76]
Hyophryne histrio
Stereocyclops histrio
incertae sedis
None
Stereocyclops incrassatus
Stereocyclops incrassatus
incertae sedis
[49,50]
Stereocyclops parkeri
Stereocyclops parkeri
incertae sedis
[50]
Arcovomer passarellii
Arcovomer passarellii
incertae sedis
None
Altigius alios
Hamptophryne alios
incertae sedis
[46]
Hamptophryne boliviana
Hamptophryne boliviana
Gastrophryninae
[47]
Dasypops schirchi
Dasypops schirchi
Gastrophryninae
[59]
Myersiella microps
Myersiella microps
incertae sedis
[60]
Dermatonotus muelleri
Dermatonotus muelleri
Gastrophryninae
[76,80,81]
Chiasmocleis panamensis
Elachistocleis panamensis
Gastrophryninae
None
Relictivomer pearsei
Elachistocleis pearsei
Gastrophryninae
[64]
Elachistocleis bicolor
Elachistocleis bicolor
Gastrophryninae
[49]
Elachistocleis bumbameuboi
Elachistocleis bumbameuboi
Gastrophryninae
None
Elachistocleis carvalhoi
Elachistocleis carvalhoi
Gastrophryninae
None
Elachistocleis cesarii
Elachistocleis cesarii
Gastrophryninae
None
Elachistocleis erythrogaster
Elachistocleis erythrogaster
Gastrophryninae
None
Elachistocleis helianneae
Elachistocleis helianneae
Gastrophryninae
None
Elachistocleis magnus
Elachistocleis magnus
Gastrophryninae
None
Elachistocleis matogrosso
Elachistocleis matogrosso
Gastrophryninae
None
Elachistocleis ovalis
Elachistocleis ovalis
Gastrophryninae
[62]
Elachistocleis skotogastor
Elachistocleis skotogastor
Gastrophryninae
None
Elachistocleis surinamensis
Elachistocleis surinamensis
Gastrophryninae
[65]
Elachistocleis surumu
Elachistocleis surumu
Gastrophryninae
None
Gastrophryne carolinensis
Gastrophryne carolinensis
Gastrophryninae
[82,83]
Gastrophryne elegans
Gastrophryne elegans
Gastrophryninae
[84]
Gastrophryne olivacea
Gastrophryne olivacea
Gastrophryninae
[83]
Gastorphryne mazatlanensis
Gastorphryne mazatlanensis
Gastrophryninae
None
Hypopachus barberi
Hypopachus barberi
Gastrophryninae
[85,86]
Hypopachus pictiventris
Hypopachus pictiventris
Gastrophryninae
[53]
Hypopachus ustum
Hypopachus ustum
Gastrophryninae
[84]
Hypopachus variolosusHypopachus variolosusGastrophryninae[83,87]

Proposed taxonomic modifications are indicated by bold text.

Redefined content of the subfamily Gastrophryninae with proposed taxonomic modifications (bold text), original subfamily designations, and larval description citations by taxon Proposed taxonomic modifications are indicated by bold text.

Divergence dating implications

After reducing our taxonomic sampling for the divergence analysis, the multilocus alignment contained 37 taxa and 2683 bp. This dataset produced the time tree depicted in Figure 5. For descriptive purposes we defined several Gastrophryninae subclades (see Table 3): (1) Chiasmocleis + Syncope + Dasypops + Myersiella + Stereocylops + Arcovomer + Hamptophryne + Dermatonotus + Elachistocleis + Gastrophryne + Hypopachus, (2) Dasypops + Myersiella + Stereocylops + Arcovomer + Hamptophryne + Dermatonotus + Elachistocleis + Gastrophryne + Hypopachus, and (3) Dermatonotus + Elachistocleis + Gastrophryne + Hypopachus. The distribution and diversification of the Microhylidae has been associated to the breakup and subsequent drifting of Gondwanaland continents [94]. However, a recent work suggested that the diversification of the microhylid clade occurred during the late Cretaceous [15], after the breakup of Gondwanaland. Consequently, these authors suggest the possibility of land bridge connections among the drifting continents that would have allowed for the dispersal of early microhylid lineages. This biogeographic scenario is supported by: 1) an Otophryninae clade that is more closely related to geographically distant microhylids lineages (e.g., Kalophryninae) than to other NWM [this study] and 2) the correlation between patterns of diversification in Late Cretaceous microhylid lineages and other co-distributed anuran lineages [15].
Figure 5

Bayesian time tree generated from partitioned mitochondrial and nuclear dataset. Nodes indicated by solid circles correspond to dates listed in Table 3. Calibration points (C1—C3; see text for more details) are indicated as solid squares.

Table 3

Divergence time estimates in millions of years ago (with 95% highest posterior density [HPD] range) for major nodes (Figure5) associated with the Gastrophyninae and Otophryninae taxa sampled for this study.

Node (Figure5)Age in mya (95% HPD)
1. Origin of Synapturanus
28.80 (10.36—51.08)
2. Origin of Otophryne
28.78 (13.48—47.97)
3. Origin of Melanophryne + Ctenophryne + Nelsonophryne clade
21.85 (11.00—37.36)
4. Origin of Chiasmocleis
22.80 (10.42—38.42)
5. Origin of Chiasmocleis + Syncope clade
37.26 (21.23—54.69)
6. Origin of Syncope
13.98 (5.59—25.18)
7. Origin of Gastrophryninae subclade I
64.88 (48.18—78.21)
8. Origin of Dasypops + Myersiella
22.27 (8.04—37.75)
9. Origin of Dasypops + Stereocyclops + Myersiella
37.83 (23.36—55.53)
10.Origin of Stereocyclops
13.94 (5.09—25.92)
11. Origin of Gastrophryninae subclade II*
49.43 (34.29—64.67)
12. Origin of Arcovomer + Hamptophryne clade
34.50 (21.26—48.89)
13. Origin of Hamptophryne
20.86 (8.69-34.99)
14. Origin of Gastrophryninae subclade III*
41.30 (27.91—59.65)
15. Origin of Elachistocleis
23.24 (13.30—33.79)
16. Origin of Elachistocleis + Dermatonotus + Hypopachus + Gastrophryne clade
33.51 (22.52—46.23)
17. Origin of Elachistocleis + Hypopachus + Gastrophryne clade
30.30 (19.51—41.58)
18. Origin of Hypopachus
17.40 (9.94—26.86)
19. Origin of Hypopachus + Gastrophryne
20.97 (13.09—31.50)
20. Origin of Gastrophryne8.09 (3.49—15.19)

*subclade designations can be found in text.

Bayesian time tree generated from partitioned mitochondrial and nuclear dataset. Nodes indicated by solid circles correspond to dates listed in Table 3. Calibration points (C1—C3; see text for more details) are indicated as solid squares. Divergence time estimates in millions of years ago (with 95% highest posterior density [HPD] range) for major nodes (Figure5) associated with the Gastrophyninae and Otophryninae taxa sampled for this study. *subclade designations can be found in text. Our divergence estimates resulted in a tree possessing a mean root height of 82.17 mya (Figure 5). A summary of major node ages (and their respective 95% highest posterior densities [error margins]) is provided in Table 3. Based on the hypothesis that Otophryninae and Gastrophryninae both originated in association with a South American-Antarctica vicariance event in the late Cretaceous [15] and that several Gastrophryne species appeared in North America sometime in the Plio-Pleistocene [35], we find that most diversification among gastrophrynine genera occurred during a 30 my period starting in the Eocene and extending into the late to middle Miocene. Interestingly, under the relaxed-clock model, Otophryne and Synapturanus species appear to have diversified in parallel suggesting that a shared biogeographic event may be responsible for their contemporary diversification during the Oligocene. Our estimates for the origin of Gastrophryne and Hypopachus at about 21 mya (13.1—31.5 HPD) overlap with previous estimates that estimated the divergence of Hypopachus and Gastrophryne to be about 17 mya [16]. The inclusion of Chiasmocleis panamensis and Relictivomer pearsei in Elachistocleis restricts the range of Chiasmocleis to South America and the northern range of Elachistocleis is represented by three species in Panama (Elachistocleis sp., E. panamensis, and E. pearsi). Since the monotypic Adelastes, the only NWM genus not sampled in our analyses, is unlikely to be related to Dermatonotus, Elachistocleis, Gastrophryne, or Hypopachus, it seems plausible that the North American microhylid radiation is derived from the expansion of a Dermatonotus/Elachistocleis ancestor. According to our divergence estimates, the node uniting all extant Central and North American microhylids (Elachistocleis + Gastrophryne + Hypopachus) originated in the early Oligocene at about 35 mya. This ancestor could have dispersed from Northern South America during the late Oligocene facilitated by a Central American archipelago connecting these landmasses. A similar pattern of dispersal from the South American Choco region to Central America has been proposed for some dendrobatid lineages during the late Miocene [95]. The presence of a Central American archipelago in the late Miocene [96,97] could explain a much earlier faunal exchange than would be allowed by Plio-Pleistocene land bridges [95]. Although our divergence estimates are broadly consistent with previous hypotheses [44,98], the confidence intervals associated with most estimates are wide (Table 3) and not always consistent with other studies [e.g., 16]. Additionally, given our calibration scheme (two deep secondary, one shallow fossil) and mixed mitochondrial and nuclear sampling it is possible that our divergence estimates may be over [99] or underestimated [100]. As such, we propose this preliminary framework as a hypothesis for gastrophrynine diversification that future investigators will test with a more robust taxonomic and genomic sampling as well as alternative calibration schemes.

Morphological diversity: Gastrophrynines as a study system for developmental plasticity

Using our revised understanding of phylogenetic relationships and divergence estimates within the Gastrophryninae, we see several striking examples of how morphologically variable certain characters have remained over the last ca. 40 my. In particular, two anterior ventral investment bones (i.e., vomers and neopalatines) are recognized as some of the most variable osteological elements in anuran lineages, e. g., either present or absent [1,6,101]. However, except in microhylids, these two elements are not intraspecifically variable in Anura. Gastrophrynine frogs exhibit unusual intraspecific variation in these two elements, e.g., present, absent, reduced, fused, independent. This morphological variation could arise from retained ancestral developmental plasticity in given traits, i.e., plasticity of developmental pathways, to accommodate morphological and ecological constraints of the adult integrated phenotype [102,103]. Environmentally induced variation in development (ontogenetic plasticity) is known to occur in anurans [104-107]. Plasticity in developmental pathways could arise from existing relaxed genetic constraints or ancestral allelic variation in the population [106,108]. Based on recent studies [6,9,11] this study, intraspecific plasticity could have historically misled the diagnoses of anuran systematists who normally treat osteological elements as separate character states when inferring species level relationships when it may be the result of intraspecific plasticity of a given trait. One notable case of this is the Hamptophryne-Arcovomer clade where these bones have been reported as: 1) neopalatines: absent in both genera [51,56], reduced in Hamptophryne[109], present in Hamptophryne[56], polymorphic (present/absent) in Hamptophryne[61], present as independent elements in both genera [6] and 2) posterior vomers: reduced in Hamptophryne and fused in Arcovomer[6,51], reduced in Hamptophryne[109], and present in Arcovomer and polymorphic (present/absent) in Hamptophryne[56,61]. Similar instances of overlapping morphological variation have been reported between Gastrophryne and Hypopachus see review in [18]. Given this putative plasticity, it seems likely that similar (e.g., level of reduction of a given bony element) or identical character states (e.g. independent loss of a bone or parts of it) in adult morphology have often been interpreted as synapomorphies or autapomorphies when they are actually homoplasies. Thus, future microhylid phylogenetic analyses that aim to incorporate adult morphology should explore and understand the ontogenies of those characters prior to conducting interspecific comparisons and phylogenetic analyses. Understanding the variability of these characters requires detailed developmental studies for which at present there are only three available for Gastrophryninae [6,109,110]. In contrast to the apparent levels of homoplasy in adult morphology, a recent study [111] concluded that Microhyloidea had noticeably lower levels of larval homoplasy than the other major lineages of Neobatrachia. Thus, gastrophrynines may be unique in having low levels of larval homoplasy yet high levels of adult homoplasy. There have been few studies [112] that focus on understanding how the interaction between larval ontogenies and the anuran Bauplan relate to the ecological requirements of the adult. The striking similarity of putative autapomorphic or synapomorphic skeletal traits in phylogenetically divergent lineages within the Gastrophyninae (particularly in the 22 chromosome clade) suggests that these characters may be more appropriately interpreted as homoplastic. While the recurrent nature of this homoplasy could be misdiagnosed or exaggerated by non-standardized documentation, it could also be explained by underlying evolutionary processes like ancestral developmental plasticity. We suspect the latter to be the case given that 1) morphological homoplasy related to ecological specialization has been documented in anurans [7], and references therein, and [2]) characters treated as independent in microhylid systematics studies are often grouped within functional complexes (e.g., cranium, pectoral girdle, pelvic girdle, etc.) that evolve in concert [113,114] and are also likely to be developmentally correlated ([115]; see review of phenotypic integration [103]). Developmental plasticity is thought to underlie phenotypic plasticity and a populations’ ability to adapt to unstable or changing environments [104-106]. Developmental plasticity of morphological traits, in conjunction with environmental selection, can result in the evolution of new traits [107,108] that trigger speciation or rapid adaptive radiations [116] under variable environmental conditions [107,108,117-120]. A systematist would consider these new traits as potential autapomorphies or synapomorphies to diagnose species and/or to recognize above-species taxonomic categories. In relation to these concepts, the putative instances of morphological homoplasy in closely related gastrophrynines are of particular note, since many lineages have likely diversified not in changing environments but within stable fossorial environments [121]. This scenario has implications for how developmental and phenotypic plasticity of a lineage interact in the absence of ecological variability; an underlined prerequisite to studies of phenotypic plasticity [122,123]. In particular, the patterns of diversification we observe in functional complexes, e.g., the anuran palate, may be related to an ancestral developmental plasticity that accommodates the interaction between historical constraints [124] and functional adaptation as lineages diversify within relative stable environmental conditions, e.g. fossoriality. Under the latter scenario, we would expect that lineage diversification would result in evolutionarily independent instances of specialization that produce similar morphological traits, i.e. homoplastic instead of apomorphic traits. Furthermore, this system is of interest since, relative to other vertebrates, anurans have a highly conserved body plan [124], a characteristic that may facilitate a more reliable identification of morphological traits subject to convergence, independent parallelism, or ancestral developmental plasticity. By discussing the interaction between underlying processes and resulting patterns in groups like microhylids, that evolutionary morphologists can make relevant contributions to a research discipline (evo-devo) dominated by studies of developmental and population genetics [102,125].

Genomic variation in the Gastrophryninae

Genome structure in microhylids seems to have arisen from a diploid ancestor with 26 chromosomes. This is presumed because the 2N=26 state is present in all of the microhylid subfamilies that have been examined karyologically (Dyscophinae and Cophylinae [126], Otophryninae [127], Gastrophryninae [128], Asterophryinae [129]). There are, however, known deviations from this karyological formula with several subfamilies ranging in chromosome number from 28–22 [128]. One of these instances occurs in the Gastrophryninae where chromosome number ranges from 26–22. By mapping known karyotypes on our Gastrophryninae molecular phylogeny (Figures 2, 3, 4), a putative pattern of chromosome reduction emerges (Figure 6). The earliest detectable branching event in the Gastrophryninae leads to Ctenophryne which contains members (C. aequatorialis and C. aterrima) possessing a 2N=26 karyotype [127]. The next major branching event leads to Syncope and Chiasmocleis which contains members (C. albopunctata and C. schubarti) possessing a 2N=24 karyotype. One instance of tetraploidy has been reported for Chiasmocleis (C. leucosticta), but the 48 chromosomes identified in this species suggest a 24 chromosome ancestral template [130]. The most derived major clade of Gastrophryninae appears to have developed a reduced 22 chromosomes karyotype early in its evolution since Arcovomer, Elachistocleis, Gastrophryne, Hypopachus, Hamptophryne, Stereocyclops, and Dermatonotus all possess this condition. The reduction of chromosome number as it relates to morphological character reduction/loss should be explored further.
Figure 6

Chromosome reduction in New World microhylids of the subfamily Gastrophryninae. Mapping karyotypes on a consensus molecular phylogeny (Figures 2, 3, 4) reveals at least two fusion events may have occurred during the evolution of these frogs. A question mark indicated those genera for which karyotypes are currently unavailable.

Chromosome reduction in New World microhylids of the subfamily Gastrophryninae. Mapping karyotypes on a consensus molecular phylogeny (Figures 2, 3, 4) reveals at least two fusion events may have occurred during the evolution of these frogs. A question mark indicated those genera for which karyotypes are currently unavailable.

Conclusions

Accumulated evidence supports the monophyly of Microhylidae and its major evolutionary lineages. However, relationships among these subfamily lineages remain uncertain. New World microhylids consist of two separate evolutionary lineages, Otophryninae and Gastrophryninae. Otophryninae (2 genera, 5 species) is probably more closely related to old world subfamilies than to Gastrophryninae. Gastrophryninae consists of 12 genera and 66 species (summary in Table 2). Given the levels of phylogenetic diversity observed in our study, it is likely that additional species will be described in the genera Chiasmocleis, Ctenophryne, Dermatonotus, Elachistocleis, and Syncope. We transfer some species of Chiasmocleis to the genera Syncope and Elachistocleis to render Chiasmocleis monophyletic. To better reflect shared evolutionary histories at generic levels, we synonymize Altigius with Hamptophryne, Hyophryne with Stereocyclops, and Nelsonophryne and Melanophryne with Ctenophryne. Resolved branches in the Gastrophryninae part of our phylogeny suggest the reduction and loss of morphological and karyological traits. Morphological shifts are mostly related to the reduction or loss of individual elements in functional complexes of the skeleton that may be related to the repeated evolution of a fossorial ecology. Gastrophryninae exhibits a karyological trend towards reduced diploid numbers in the more derived lineages. While most genera have aquatic larvae, there are several reproductive modes that occur in Gastrophryninae including terrestrial development (Myersiella) and non-feeding aquatic larvae (Syncope). One of the few temperate microhylid radiations (the North American genera Gastrophryne and Hypopachus) appears to be derived from ancestral stock shared with the South American genus Elachistocleis. Our divergence estimates indicate that if Otophryninae and Gastrophryninae originated in the Late Cretaceous, most genus-level diversification occurred during a period spanning the late Oligocene to the Miocene.

Competing interest

The authors declare that they have no competing interests.

Authors’ contributions

RdS designed the research; JWS and RdS performed the analyses. RdS, JWS, RS, EG, and SPL collected sequence data. RdS, SR, CFBH did field work to obtain necessary sampling. RdS and JWS wrote the paper with input from RS, EG, MCF, SR, SPL, and CFBH. All authors read and approved the final manuscript.

Additional file 1

Appendix 1. Click here for file

Additional file 2

Appendix 2. Click here for file
  40 in total

1.  Amphibians as indicators of early tertiary "out-of-India" dispersal of vertebrates.

Authors:  F Bossuyt; M C Milinkovitch
Journal:  Science       Date:  2001-04-06       Impact factor: 47.728

2.  Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach.

Authors:  Michael J Sanderson
Journal:  Mol Biol Evol       Date:  2002-01       Impact factor: 16.240

3.  Divergence time and evolutionary rate estimation with multilocus data.

Authors:  Jeffrey L Thorne; Hirohisa Kishino
Journal:  Syst Biol       Date:  2002-10       Impact factor: 15.683

4.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

Review 5.  Developmental plasticity and the origin of species differences.

Authors:  Mary Jane West-Eberhard
Journal:  Proc Natl Acad Sci U S A       Date:  2005-04-25       Impact factor: 11.205

6.  Recurrent ecological adaptations revealed through a molecular analysis of the secretive cophyline frogs of Madagascar.

Authors:  Franco Andreone; Miguel Vences; David R Vieites; Frank Glaw; Axel Meyer
Journal:  Mol Phylogenet Evol       Date:  2004-12-09       Impact factor: 4.286

7.  Time dependency of molecular rate estimates and systematic overestimation of recent divergence times.

Authors:  Simon Y W Ho; Matthew J Phillips; Alan Cooper; Alexei J Drummond
Journal:  Mol Biol Evol       Date:  2005-04-06       Impact factor: 16.240

8.  Developmental plasticity mirrors differences among taxa in spadefoot toads linking plasticity and diversity.

Authors:  Ivan Gomez-Mestre; Daniel R Buchholz
Journal:  Proc Natl Acad Sci U S A       Date:  2006-11-29       Impact factor: 11.205

9.  How fluctuating competition and phenotypic plasticity mediate species divergence.

Authors:  David W Pfennig; Peter J Murphy
Journal:  Evolution       Date:  2002-06       Impact factor: 3.694

10.  Late Cretaceous vicariance in Gondwanan amphibians.

Authors:  Ines Van Bocxlaer; Kim Roelants; S D Biju; J Nagaraju; Franky Bossuyt
Journal:  PLoS One       Date:  2006-12-20       Impact factor: 3.240

View more
  15 in total

1.  Phylogenomics reveals rapid, simultaneous diversification of three major clades of Gondwanan frogs at the Cretaceous-Paleogene boundary.

Authors:  Yan-Jie Feng; David C Blackburn; Dan Liang; David M Hillis; David B Wake; David C Cannatella; Peng Zhang
Journal:  Proc Natl Acad Sci U S A       Date:  2017-07-03       Impact factor: 11.205

2.  A new species of Chiasmocleis (Microhylidae, Gastrophryninae) from the Atlantic Forest of Espírito Santo State, Brazil.

Authors:  João F R Tonini; Maurício C Forlani; Rafael O de Sá
Journal:  Zookeys       Date:  2014-07-24       Impact factor: 1.546

3.  The first endemic West African vertebrate family - a new anuran family highlighting the uniqueness of the Upper Guinean biodiversity hotspot.

Authors:  Michael F Barej; Andreas Schmitz; Rainer Günther; Simon P Loader; Kristin Mahlow; Mark-Oliver Rödel
Journal:  Front Zool       Date:  2014-02-03       Impact factor: 3.172

4.  Amphibian beta diversity in the Brazilian Atlantic Forest: contrasting the roles of historical events and contemporary conditions at different spatial scales.

Authors:  Fernando Rodrigues da Silva; Mário Almeida-Neto; Mariana Victorino Nicolosi Arena
Journal:  PLoS One       Date:  2014-10-08       Impact factor: 3.240

5.  A striking new genus and species of cave-dwelling frog (Amphibia: Anura: Microhylidae: Asterophryinae) from Thailand.

Authors:  Montri Sumontha; Nikolay A Poyarkov; Chatmongkon Suwannapoom; Jitthep Tunprasert; Thiti Ruangsuwan; Parinya Pawangkhanant; Dmitriy V Korost
Journal:  PeerJ       Date:  2018-02-23       Impact factor: 2.984

6.  The 100th: An appealing new species of Dendropsophus (Amphibia: Anura: Hylidae) from northeastern Brazil.

Authors:  Iuri Ribeiro Dias; Célio Fernando Baptista Haddad; Antônio Jorge Suzart Argôlo; Victor Goyannes Dill Orrico
Journal:  PLoS One       Date:  2017-03-08       Impact factor: 3.240

7.  Molecular and morphological data reveal three new cryptic species of Chiasmocleis (Mehely 1904) (Anura, Microhylidae) endemic to the Atlantic Forest, Brazil.

Authors:  Mauricio C Forlani; João F R Tonini; Carlos A G Cruz; Hussam Zaher; Rafael O de Sá
Journal:  PeerJ       Date:  2017-02-21       Impact factor: 2.984

8.  A new genus and three new species of miniaturized microhylid frogs from Indochina (Amphibia: Anura: Microhylidae: Asterophryinae).

Authors:  Nikolay A Poyarkov; Chatmongkon Suwannapoom; Parinya Pawangkhanant; Akrachai Aksornneam; Tang Van Duong; Dmitriy V Korost; Jing Che
Journal:  Zool Res       Date:  2018-04-20

9.  High levels of diversity uncovered in a widespread nominal taxon: continental phylogeography of the neotropical tree frog Dendropsophus minutus.

Authors:  Marcelo Gehara; Andrew J Crawford; Victor G D Orrico; Ariel Rodríguez; Stefan Lötters; Antoine Fouquet; Lucas S Barrientos; Francisco Brusquetti; Ignacio De la Riva; Raffael Ernst; Giuseppe Gagliardi Urrutia; Frank Glaw; Juan M Guayasamin; Monique Hölting; Martin Jansen; Philippe J R Kok; Axel Kwet; Rodrigo Lingnau; Mariana Lyra; Jiří Moravec; José P Pombal; Fernando J M Rojas-Runjaic; Arne Schulze; J Celsa Señaris; Mirco Solé; Miguel Trefaut Rodrigues; Evan Twomey; Celio F B Haddad; Miguel Vences; Jörn Köhler
Journal:  PLoS One       Date:  2014-09-10       Impact factor: 3.240

10.  The Gondwana Breakup and the History of the Atlantic and Indian Oceans Unveils Two New Clades for Early Neobatrachian Diversification.

Authors:  Annelise Frazão; Hélio Ricardo da Silva; Claudia Augusta de Moraes Russo
Journal:  PLoS One       Date:  2015-11-30       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.