Cytoplasmic Polyadenylation Element Binding (CPEB) proteins are translational regulators that can either activate or repress translation depending on the target mRNA and the specific biological context. There are two CPEB subfamilies and most animals have one or more genes from each. Drosophila has a single CPEB gene, orb and orb2, from each subfamily. orb expression is only detected at high levels in the germline and has critical functions in oogenesis but not spermatogenesis. By contrast, orb2 is broadly expressed in the soma; and previous studies have revealed important functions in asymmetric cell division, viability, motor function, learning, and memory. Here we show that orb2 is also expressed in the adult male germline and that it has essential functions in programming the progression of spermatogenesis from meiosis through differentiation. Like the translational regulators boule (bol) and off-schedule (ofs), orb2 is required for meiosis and orb2 mutant spermatocytes undergo a prolonged arrest during the meiotic G2-M transition. However, orb2 differs from boule and off-schedule in that this arrest occurs at a later step in meiotic progression after the synthesis of the meiotic regulator twine. orb2 is also required for the orderly differentiation of the spermatids after meiosis is complete. The differentiation defects in orb2 mutants include abnormal elongation of the spermatid flagellar axonemes, a failure in individualization and improper post-meiotic gene expression. Amongst the orb2 differentiation targets are orb and two other mRNAs, which are transcribed post-meiotically and localized to the tip of the flagellar axonemes. Additionally, analysis of a partial loss of function orb2 mutant suggests that the orb2 differentiation phenotypes are independent of the earlier arrest in meiosis.
Cytoplasmic Polyadenylation Element Binding (CPEB) proteins are translational regulators that can either activate or repress translation depending on the target mRNA and the specific biological context. There are two CPEB subfamilies and most animals have one or more genes from each. Drosophila has a single CPEB gene, orb and orb2, from each subfamily. orb expression is only detected at high levels in the germline and has critical functions in oogenesis but not spermatogenesis. By contrast, orb2 is broadly expressed in the soma; and previous studies have revealed important functions in asymmetric cell division, viability, motor function, learning, and memory. Here we show that orb2 is also expressed in the adult male germline and that it has essential functions in programming the progression of spermatogenesis from meiosis through differentiation. Like the translational regulators boule (bol) and off-schedule (ofs), orb2 is required for meiosis and orb2 mutant spermatocytes undergo a prolonged arrest during the meiotic G2-M transition. However, orb2 differs from boule and off-schedule in that this arrest occurs at a later step in meiotic progression after the synthesis of the meiotic regulator twine. orb2 is also required for the orderly differentiation of the spermatids after meiosis is complete. The differentiation defects in orb2 mutants include abnormal elongation of the spermatid flagellar axonemes, a failure in individualization and improper post-meiotic gene expression. Amongst the orb2 differentiation targets are orb and two other mRNAs, which are transcribed post-meiotically and localized to the tip of the flagellar axonemes. Additionally, analysis of a partial loss of function orb2 mutant suggests that the orb2 differentiation phenotypes are independent of the earlier arrest in meiosis.
Proteins in the Cytoplasmic Polyadenylation Element Binding (CPEB) family were first identified in Drosophila ovaries and Xenopus oocytes [1]–[4]. In both organisms the CPEB proteins function in the localization and translational regulation of mRNAs encoding key developmental and polarity determinants as well as factors controlling the process of egg maturation. Since then CPEB family proteins have been implicated in many other biological contexts. These include translational regulation of embryonic cell division [5], [6], regulation of p53 expression [7], [8], synaptic plasticity in the rat hippocampus [9], long-term memory in Aplysia
[10], [11] and spermatogenesis in the worm [12]. The CPEB proteins bind to CPE elements in the 3′ UTRs of target mRNAs and can both repress and activate translation. Translation activation typically involves the phosphorylation of the CPEB protein and the subsequent recruitment of a cytoplasmic poly A polymerase which extends the poly A tail [13].Most animals have two or more CPEB genes. Completed genome sequences reveal that humans, mice, and C. elegans have four genes, while there are only two CPEBs, orb and orb2, in Drosophila. The homology between the CPEBs is largely restricted to the C-terminal region of the protein, where two RNA-Recognition Motif (RRM) domains are found, while the N-terminal domain is highly divergent even amongst closely related species. Phylogenetic trees indicate that the CPEB genes fall into two different subgroups. One subgroup includes Drosophilaorb, mouseCPEB1 and the canonical XenopusCPEB, while the other subgroup contains the second DrosophilaCPEB gene, orb2, as well as mammalianCPEB 2, 3, and 4 [12], [14].The Drosophilaorb gene has been extensively characterized. Its expression appears to be restricted to the germline as neither mRNA nor protein can be detected in somatic tissues of the embryo, larvae and adult. While a male-specific Orb isoform is expressed in the male germline, its activity is not absolutely essential since the fertility of orb null males is reduced but not eliminated (Agunwamba and Xu, unpublished). In contrast, orb plays a central role in the process of oogenesis. orb expression is first activated during the mitotic divisions that ultimately generate an egg chamber containing 15 nurse cells and an oocyte. At this stage orb activity is required for the proper specification of the oocyte. Subsequently, orb is required for establishing the anterior-posterior and dorsal-ventral axes of the egg and embryo. Amongst the key orb mRNA regulatory targets are the polarity determinants oskar and gurken
[15]–[18].Unlike orb, the second DrosophilaCPEB gene, orb2, is broadly expressed in both the soma and germline. The highest levels of Orb2 are in the embryonic, larval and adult CNS, and in the germ cells of the male testes [19]. There are two Orb2 isoforms, one of 75 kD and the other of 60 kD. The larger isoform is expressed in somatic tissues and the germline of both sexes, while the smaller isoform is found in testes but is not detected elsewhere. The isoforms share a 542 C-terminal amino acid sequence, but have unique N-termini of 162 and 9 amino acids respectively. Included in the common region is the conserved C-terminal CPEB signature RRM type RNA binding and zinc finger domains. The N-terminal half of both isoforms has short conserved sequences rich in serine or histidine interspersed with poorly conserved sequences containing poly-glutamine or poly-glycine repeats [19].As might be expected from its broad expression pattern, orb2 has a number of somatic functions. During embryogenesis it is required for asymmetric cell division of neuroblast and muscle precursor stem cells and appears to function by promoting the localized accumulation of atypical Protein Kinase C (aPKC) [19]. In addition, orb2 mutants have substantially reduced viability, a shortened life span, and defects in behavior and long-term memory [14], [19], [20], [21]. Here we report that orb2 is essential for spermatogenesis, and that it functions in programming the orderly and sequential progression of spermatogenesis from meiosis through differentiation.
Results
Orb2 expression pattern during spermatogenesis
In situ hybridization and antibody staining were used to examine orb2 expression in the testes. While there is little if any orb2 mRNA (Figure 1B, 1B′) or protein (Figure 1C, 1C(I)) in stem cells, low levels are detected in the mitotic cysts. After mitosis is finished and the interconnected spermatocytes begin to grow, there is a substantial upregulation in both mRNA and protein. This period of growth corresponds to the stage when many gene products needed for subsequent steps in spermatogenesis are synthesized [22], [23]. Though Orb2 protein is found throughout the spermatocyte cytoplasm, higher levels of protein are concentrated in a ring around the nucleus (Figure 1C(II), 1D). Orb2 expression peaks as the mature spermatocytes go through meiosis and high levels of Orb2 are found in 32 and 64 cell spermatid cysts (Figure 1C(III)).
Figure 1
Orb2 expression during spermatogenesis.
A) Drawing of the testis. Light blue: stem cell and spermatogonia region, green: spermatocytes, orange: spermatids, red: beginning of spermatids elongation, purple: elongated spermatids (dark blue: spermatid nuclear bundle). Terms used for describing directions of elongation are indicated here. B) Florescent in situ hybridization with orb2 antisense probe of one testis. Image is stitched together from 4 frames with Fiji. B′) Zoom in view of the tip region. Arrow indicates position of the stem cell niche; square bracket outlines the spermatogonia region. C, C′) Testis stained with Orb2 antibody (red) and overlay of Orb2 and DNA (blue). C(I): Testis tip and spermatogonia region containing the 2,4,8-cell cysts. Arrow indicates position of the stem cell niche. C(II): Mature spermatocytes (arrow). C(III): Spermatocytes (arrow) and spermatids (arrowhead). C(IV): elongating spermatids. Arrow marks those with Orb2 expression, and arrowhead marks those without Orb2. D) Orb2 is concentrated around the growing spermatocyte nuclei. Arrowheads mark one nucleus. E) Orb2 localization near the distal (growing) tip of the elongating flagellar axonemes. Arrow, arrowhead and square bracket labels the leading edge of the axonemes, Orb2 concentrated region, and extended Orb2 expressing region respectively. F) Co-labeling of Orb2 in DJ-GFP testes. Orb2 is detected in cysts in which the 64 spermatid nuclei have coalesced into the nuclear bundle (*), but have not yet fully completed chromosome condensation (o). DJ-GFP is only expressed in spermatid cysts that have condensed their chromosomes. Some fully elongated spermatids with fully condensed nuclear bundles have neither Orb2 nor DJ-GFP (x). Insets are enlarged from the main panel. Scale bars are as shown in each panel.
Orb2 expression during spermatogenesis.
A) Drawing of the testis. Light blue: stem cell and spermatogonia region, green: spermatocytes, orange: spermatids, red: beginning of spermatids elongation, purple: elongated spermatids (dark blue: spermatid nuclear bundle). Terms used for describing directions of elongation are indicated here. B) Florescent in situ hybridization with orb2 antisense probe of one testis. Image is stitched together from 4 frames with Fiji. B′) Zoom in view of the tip region. Arrow indicates position of the stem cell niche; square bracket outlines the spermatogonia region. C, C′) Testis stained with Orb2 antibody (red) and overlay of Orb2 and DNA (blue). C(I): Testis tip and spermatogonia region containing the 2,4,8-cell cysts. Arrow indicates position of the stem cell niche. C(II): Mature spermatocytes (arrow). C(III): Spermatocytes (arrow) and spermatids (arrowhead). C(IV): elongating spermatids. Arrow marks those with Orb2 expression, and arrowhead marks those without Orb2. D) Orb2 is concentrated around the growing spermatocyte nuclei. Arrowheads mark one nucleus. E) Orb2 localization near the distal (growing) tip of the elongating flagellar axonemes. Arrow, arrowhead and square bracket labels the leading edge of the axonemes, Orb2 concentrated region, and extended Orb2 expressing region respectively. F) Co-labeling of Orb2 in DJ-GFP testes. Orb2 is detected in cysts in which the 64 spermatid nuclei have coalesced into the nuclear bundle (*), but have not yet fully completed chromosome condensation (o). DJ-GFP is only expressed in spermatid cysts that have condensed their chromosomes. Some fully elongated spermatids with fully condensed nuclear bundles have neither Orb2 nor DJ-GFP (x). Insets are enlarged from the main panel. Scale bars are as shown in each panel.Orb2 persists after the spermatids in the 64 cell cysts start differentiation and begin flagellar axoneme elongation (Figure 1C(IV)). As the axonemes begins to elongate, the 64 spermatid nuclei bundle together and then begin to condense into needle-like structures (Figure 1F, inset, Figure 1A). Though Orb2 is distributed along the entire axoneme bundle, the highest concentrations are found in a prominent band (Figure 1E, arrowhead) close to the distal tip of the growing flagellar axonemes (Figure 1A). The leading edge of the axonemes is just in front of the Orb2 band and this region contains small clumps of Orb2 (Figure 1E, arrow). In the region behind the band, Orb2 is organized into a series of striated lines that extend towards the sperm nuclei at the proximal (basal) tip of the spermatid (Figure 1E, bracket) and presumably correspond to individual flagellar axonemes in the spermatid bundle.While Orb2 is present in elongating spermatids that have not yet completed nuclear condensation (* in Figure 1F), it disappears once elongation and nuclear condensation are completed (o in Figure 1F). To confirm this, we compared the accumulation patterns of Orb2 and Don Juan-GFP (DJ-GFP). While DJ-GFP is highly expressed once the nuclei have condensed and individualization begins, it is not found in spermatids that are still undergoing elongation [24], [25]. As expected, we did not observe spermatids that simultaneously had Orb2 and DJ-GFP. Moreover, since some fully elongated spermatids with condensed nuclear bundles have neither Orb2 nor DJ-GFP (x in Figure 1F), there seems to be a delay between the disappearance of Orb2 and DJ-GFP expression. This suggestion is supported by a comparison of the Orb2 and Orb expression patterns. orb is transcribed post-meiotically and orb mRNAs localize in a band at the distal tip of elongating spermatids [3], [26]; however, the localized mRNAs does not appear to be translated until the end of the elongation phase after Orb2 begins to disappear. Figure 2A–2D show that high levels of Orb are found in the tips of elongated spermatids that have neither Orb2 nor DJ-GFP. On occasion we observed spermatids that have activated Orb translation but still retain some residual Orb2 (Figure 2B, arrowhead).
Figure 2
Orb expression in wild-type and orb2 testes.
A–D) Confocal images showing whole mount staining of testes with Orb (pink) and Orb2 (red) antibodies in DJ-GFP (green) expressing wild type testis. Arrow shows that Orb is expressed at the tip of those spermatids that express neither Orb2 nor DJ-GFP. Orb expression is sometimes seen in spermatids that have residual Orb2 (arrowhead). E, F) In orb2 testes, Orb expression is observed in spermatids that are not fully elongated and its preferential localization near the tip of the elongating flagellar axonemes is lost. Orb: pink; DNA, yellow. Scale bar, 50 µm.
Orb expression in wild-type and orb2 testes.
A–D) Confocal images showing whole mount staining of testes with Orb (pink) and Orb2 (red) antibodies in DJ-GFP (green) expressing wild type testis. Arrow shows that Orb is expressed at the tip of those spermatids that express neither Orb2 nor DJ-GFP. Orb expression is sometimes seen in spermatids that have residual Orb2 (arrowhead). E, F) In orb2 testes, Orb expression is observed in spermatids that are not fully elongated and its preferential localization near the tip of the elongating flagellar axonemes is lost. Orb: pink; DNA, yellow. Scale bar, 50 µm.
Orb2 phosphorylation states are changed in aly and can class mutants
While meiosis and differentiation require different gene products for execution and have their own regulators, there is a class of genes that control both aspects of spermatogenesis. Included in this group are always early (aly), spermatocyte arrest (sa), meiosis I arrest (mia) and cannonball (can) which encode testes specific TAFs (TATA Box Protein associated factors) [22], [27]. Mutations in these testes specific TAFs cause spermatocytes to arrest at the G2-M transition of meiosis I and block the expression of factors needed for differentiation [28]. However, though these genes encode factors essential for Pol II activity, the effects of mutations are not limited to general transcription. For example, twine (twe) mRNA is expressed in tTAF mutants, but is not properly translated [28]. Figure S1 shows that mutations in these four genes have two effects on Orb2 protein expression in the testes. First, Orb2 levels were substantially reduced (Figure S1A). Second, there was a noticeable reduction in the electrophoretic mobility of the larger Orb2 isoform. As illustrated for the sa mutation, treatment of the testes extract with lambda phosphatase removes the Orb2 signal with slow electrophoretic mobility and indicates that phosphorylation is responsible for the reduced mobility of Orb2 in the mutant testes (Figure S1B). As might be expected, these tTAF mutations do not seem to affect Orb2 in somatic tissues such as the head (Figure S1A).
orb2 mutants are male sterile
To better understand how orb2 functions in spermatogenesis, we examined the effects of mutations. Previously we characterized a collection of 5 transposon insertions in the orb2 locus [19]. As shown in Figure 3, two of the transposons, 1556 and 4965 have no effect on Orb2 expression. This is expected as 1556 is inserted upstream of the orb2-1 promoter, while 4965 is located downstream of the Orb2 protein coding sequences. Two of the transposons, 6090 and 1925, are inserted downstream of both the orb2-1 and orb2-2 promoters and interfere with expression of orb2 mRNAs encoding the 75 kD isoform in the testes and head (Figure 3, Figure S2 and [19]). In contrast, the 1793 insertion, which is located farther upstream in between the orb2-1 and orb2-2 promoters, affects 75 kD expression in the testes, but not in the head, suggesting that orb2-1 is more heavily used in the testes, while orb2-2 is more heavily used in the head (Figure S2). As expected from their insertion sites, none of the transposons affect the 60 kD isoform. On the other hand, the reduction in the 75 kD isoform in 6090, 1925 and 1793 is accompanied by a small but reproducible increase in the 60 kD isoform (Figure 3B). This raises the possibility that a negative feedback loop might regulate the levels of the two isoforms.
Figure 3
Orb2 expression in the testes and fertility of different orb2 alleles.
A) orb2 gene structure. orb2 has three promoters (orb2-1, 2, and 3) and encodes multiple transcripts. piggyBac insertions 1556, 1793, 1925, 6090, and 4965 are marked by green arrows. Only 1793, 1925, and 6090 are expected to disrupt orb2 transcripts. Green box marks the poly-Q sequence that is deleted in orb2 allele [14]. See Figure S1 and [19] for further details. B) Orb2 expression in piggyBac alleles (6090, 1925, 1793, 1556, 4965), orb2, piggyBac insertion revertant (6090), and orb2. (oe): over exposed. C) Fertility of piggyBac insertion alleles, revertant, orb2, orb2. Fertility is consistent with Orb2 expression in the testes. DF(3L)4416 (referred to as 4416) is a small deletion allele that removes part of the third chromosome that includes orb2 gene region.
Orb2 expression in the testes and fertility of different orb2 alleles.
A) orb2 gene structure. orb2 has three promoters (orb2-1, 2, and 3) and encodes multiple transcripts. piggyBac insertions 1556, 1793, 1925, 6090, and 4965 are marked by green arrows. Only 1793, 1925, and 6090 are expected to disrupt orb2 transcripts. Green box marks the poly-Q sequence that is deleted in orb2 allele [14]. See Figure S1 and [19] for further details. B) Orb2 expression in piggyBac alleles (6090, 1925, 1793, 1556, 4965), orb2, piggyBac insertion revertant (6090), and orb2. (oe): over exposed. C) Fertility of piggyBac insertion alleles, revertant, orb2, orb2. Fertility is consistent with Orb2 expression in the testes. DF(3L)4416 (referred to as 4416) is a small deletion allele that removes part of the third chromosome that includes orb2 gene region.Consistent with an important role for Orb2 in spermatogenesis, we find that the fertility of homozygous 6090, 1925, and 1793 males is substantially impaired (not shown). When trans to deficiencies that uncover orb2, 1925 is completely sterile, while 6090 and1793 occasionally give fertile males (Figure 3C). In contrast, the two insertions, 1556 and 4965, that have no effect on the expression of the 75 kD isoform, are fully fertile. That sterility is due specifically to the loss of the Orb2 75 kD isoform is supported by the finding that excision of the transposon insertions restores the expression of this isoform and reverts the sterility phenotype (6090, Figure 3).Since the mutants still expressed the 60 kD isoform, along with residual 75 kD isoform, they could retain some orb2 function. For this reason, we generated orb2 nulls using FLP recombination (Figure S2) [29], [30]. Two upstream piggyBac insertions (1556 and 1925) contain correctly oriented FRT sites for deleting the orb2 protein coding sequence when paired with the downstream 4965 insertion. The resulting deletions, orb2 (1925×4965) and orb2 (1556×4965), eliminate orb2 mRNA and protein expression (Figure 3). They have substantially reduced viability (data not shown), while the surviving males are completely sterile (Figure 3). To exclude possible background effects, we combined the two null alleles with three different third chromosome deficiencies that remove small parts of the third chromosome including orb2 (Df(3L)ED4421, Df(3L)ED4415, and Df(3L)ED4416). These trans combinations also have reduced viability and are completely male sterile (Figure 3C; not shown). Similar results were obtained for an independently generated null allele, orb2
[14]. Since all null alleles behave the same in our assays, we used orb2 in the experiments described below.
orb2 mutant spermatocytes fail to complete meiosis
Overall testes morphology and the pre-meiotic stages of spermatogenesis appear normal in orb2 and other orb2 mutants. The spermatogonia undergo the sequential mitotic divisions generating 16 interconnected spermatocytes, and the spermatocytes mature as in wild type. However, subsequent stages of spermatogenesis are abnormal. In wild type, the products of meiosis, the spermatids in the 64 cell cysts, have two characteristic spherical structures when observed by phase contrast microscopy: a light nucleus and a dark mitochondrial Nebenkern (Figure 4A). While pseudo-spermatids are present in orb2, the cells and their nuclei are unusually large and they have a poorly contrasted Neberken, which is abnormally shaped and sometimes fragmented (Figure 4B). As the overall DNA content is also increased (Figure 4C, 4D), it seems likely that the orb2 spermatids have replicated their DNA as in wild type, but failed to complete meiotic divisions. Consistent with this possibility, we never observe products of the first and second meiotic divisions, the 32 and 64 cell cysts respectively, in orb2 testes. By contrast, 32 and 64 cell cysts are seen in wild type.
Figure 4
orb2 spermatocytes fail to undergo the G2-M transition of meiosis I.
A, B) Wild type and orb2 spermatids. orb2 spermatids are larger than wild type, have a much larger nucleus (arrow) and an irregularly shaped Nebenkern (arrowhead). C, D) Wild type and orb2 spermatids stained with Hoechst to visualize nuclear size and DNA content. E, F, G) The process of chromosome condensation in wild type spermatocytes in G2 of meiosis I. E) Mature spermatocyte stage. F) Condensation phase. G) Onset of metaphase I. H) Only partially condensed chromosomes corresponding to the wild type panel F are observed in orb2. I) Diagram of chromosome condensation during meiosis I. Scale bar: 10 µm.
orb2 spermatocytes fail to undergo the G2-M transition of meiosis I.
A, B) Wild type and orb2 spermatids. orb2 spermatids are larger than wild type, have a much larger nucleus (arrow) and an irregularly shaped Nebenkern (arrowhead). C, D) Wild type and orb2 spermatids stained with Hoechst to visualize nuclear size and DNA content. E, F, G) The process of chromosome condensation in wild type spermatocytes in G2 of meiosis I. E) Mature spermatocyte stage. F) Condensation phase. G) Onset of metaphase I. H) Only partially condensed chromosomes corresponding to the wild type panel F are observed in orb2. I) Diagram of chromosome condensation during meiosis I. Scale bar: 10 µm.To further characterize the meiotic defects, we examined chromosome morphology. During the prolonged G2 before the spermatocytes enter meiosis I, the three large chromosomes segregate into 3 domains and start the process of condensation. As illustrated in Figure 4I, the spermatocyte chromosomes initially coalesce into irregular rod-like structures located at vertices of a triangle (Figure 4E). They subsequently condense into 3 sharp dots (Figure 4F) before congressing to the metaphase plate in preparation for the first meiotic division (Figure 4G) [31]. In orb2, the spermatocyte chromosomes segregate into three domains, and start the process of condensation. However, condensation is incomplete and the chromosomes don't congress to the metaphase plate (Figure 4H).
Nuclear Cyclin A accumulates in orb2 spermatocyte cysts
These findings suggest that orb2 spermatocytes arrest meiosis at a step prior to the first meiotic division. To analyze the meiotic arrest further we examined Cyclin A accumulation. In wild type testes, Cyclin A accumulates in the cytoplasm during G2. However, just prior to the meiosis I G2 to M transition, Cyclin A is targeted to the spermatocyte nucleus, and then quickly degraded as meiosis proceeds [31], [32]. Since nuclear localization is only transient, cysts with nuclear Cyclin A are rarely seen in wild type (Figure 5A). However, in orb2 and orb2, most cysts in the middle of the testes have high levels of nuclear Cyclin A (Figure 5B).
Figure 5
orb2 cysts arrest meiosis I at a step after the expression of the Twine phosphatase.
A) Spermatocyte cysts in wild type typically have cytoplasmic CycA. B) orb2 testes have multiple spermatocyte cysts with nuclear CycA, as observed in bol
[34]. C) In wild type spermatocyte cysts, CycB is typically only found in the cytoplasm. D) CycB shows a similar nuclear enrichment as CycA in orb2. Arrow marks wild type and orb2 cysts with cytoplasmic CycB, while arrowhead points to two orb2 cysts with nuclear CycB. In contrast to orb2, cysts with cytoplasmic, but not nuclear CycB were seen in bol mutants (Xu, unpublished results). E, F) Twe-lacZ is over-expressed in orb2. Purple arrows: orb2 cysts have much higher levels of Twe-lacZ than wild type. Orange arrow: orb2 cysts containing immature spermatocytes prematurely express Twe-lacZ. Green arrow: Twe-lacZ persists in elongating orb2 spermatids. G) Orb2 and Bol are found in the same complex in testes extracts. Testes extracts were immunoprecipitated with Bol or control IgG, in the presence or absence of RNase (RN) as indicated, and Westerns of the immunoprecipitated proteins were then probed with Orb2 antibodies. H) Testes extract from wild type (WT), orb2 and bol were probed with antibodies against bulk Cdc2 (top) and phospho-Tyr15 Cdc2 (bottom). Note that bol and orb2 have opposite effects on CDC2 Tyr15-P. The levels of phosphorylated Cdc2 in bol testes are higher than wild type, whereas they are lower than wild type in orb2. Ratio of phosphorylated Tyr15-P to unphosphorylated is as follows: WT = 1.5; orb2 = 0.8; bol = 2.5. I) Semi-quantitative RT-PCR of twine and gapdh mRNA showing that twine mRNA levels in orb2 are equivalent to wild type. Scale bar: 50 µm.
orb2 cysts arrest meiosis I at a step after the expression of the Twine phosphatase.
A) Spermatocyte cysts in wild type typically have cytoplasmic CycA. B) orb2 testes have multiple spermatocyte cysts with nuclear CycA, as observed in bol
[34]. C) In wild type spermatocyte cysts, CycB is typically only found in the cytoplasm. D) CycB shows a similar nuclear enrichment as CycA in orb2. Arrow marks wild type and orb2 cysts with cytoplasmic CycB, while arrowhead points to two orb2 cysts with nuclear CycB. In contrast to orb2, cysts with cytoplasmic, but not nuclear CycB were seen in bol mutants (Xu, unpublished results). E, F) Twe-lacZ is over-expressed in orb2. Purple arrows: orb2 cysts have much higher levels of Twe-lacZ than wild type. Orange arrow: orb2 cysts containing immature spermatocytes prematurely express Twe-lacZ. Green arrow: Twe-lacZ persists in elongating orb2 spermatids. G) Orb2 and Bol are found in the same complex in testes extracts. Testes extracts were immunoprecipitated with Bol or control IgG, in the presence or absence of RNase (RN) as indicated, and Westerns of the immunoprecipitated proteins were then probed with Orb2 antibodies. H) Testes extract from wild type (WT), orb2 and bol were probed with antibodies against bulk Cdc2 (top) and phospho-Tyr15Cdc2 (bottom). Note that bol and orb2 have opposite effects on CDC2Tyr15-P. The levels of phosphorylated Cdc2 in bol testes are higher than wild type, whereas they are lower than wild type in orb2. Ratio of phosphorylated Tyr15-P to unphosphorylated is as follows: WT = 1.5; orb2 = 0.8; bol = 2.5. I) Semi-quantitative RT-PCR of twine and gapdh mRNA showing that twine mRNA levels in orb2 are equivalent to wild type. Scale bar: 50 µm.
Orb2 is in a complex with the translational regulator Boule
These orb2 meiotic phenotypes are similar to the phenotypes reported for mutations in boule (bol) and off-schedule (ofs) [32]–[34]. bol encodes a homolog of mammalian DAZ fertility factor, while ofs encodes a testes eIF4G. Like orb2, bol and ofs mutant spermatocytes arrest meiosis prior to the first meiotic division and the cysts have high levels of nuclear Cyclin A. The fact that all three proteins are needed for meiosis suggested that they might function together. To explore this possibility, we first tested whether Orb2 and Bol associate with each other in testes extracts. As shown in Figure 5G, Orb2 and Bol are in an RNase resistant immunoprecipitable complex.We also examined the pattern of Bol accumulation in orb2 testes. In wild type spermatocytes, Bol localizes in a perinucleolar dot during spermatocyte maturation; however, once meiosis begins, Bol is relocalized to the cytoplasm where it is thought to promote the translation of target mRNAs [35]. Figure S3A, S3A′, S3B, and S3B′ show that both phases of Bol localization are observed in orb2 mutant testes. Also as in wild type, Bol is present in “post-meiotic” (see below) orb2 spermatids even though they haven't undergone meiosis (Figure S3C, S3C′, S3D and S3D′). As for Ofs, we were unable to demonstrate an association with Orb2 in testes extracts (Xu: unpublished data).
twine is misexpressed in orb2 mutant testes
One reason that bol and ofs mutants are blocked in meiosis at the G2/M transition is that both factors are required for translation of twine (twe) mRNA [33], [34], [36]. twe encodes DrosophilaCdc25 phosphatase. In order for meiosis to proceed twe must remove an inhibitory phosphorylation on tyrosine 15 of Cdc2 (Ck1) [37], [38]. In bol testes, twe mRNA is present but it is not translated. In the absence of Twe protein, phosphorylated Cdc2 on Tyr15 accumulates and meiosis arrests at the G2/M transition [38]. Since our results indicate that orb2 also arrests meiosis at the G2/M transition, we anticipated that orb2 activity would be required to translate twe mRNA. To test this hypothesis, we first determined whether twe mRNA levels are normal. The RT-PCR experiment in Figure 5I shows that twe mRNA levels in orb2 testes are similar to wild type. We next used a chimeric twe-lacZ translational reporter to ascertain whether twe mRNA is translated in orb2 mutants. The reporter has sequences encoding β-galactosidase inserted in frame into the twe gene and expresses a chimeric mRNA including the twe 3′ UTR [36]. While we anticipated that the translation of the chimeric twe-lacZ mRNA would be blocked in orb2 testes as in bol (and ofs), this is not the case. Instead, Twe-lacZ expression in orb2 exceeds even wild type.Figure 5E and 5F show that the pattern of Twe-lacZ expression differs in several respects from wild type. First, compared to wild type (E) there are many more cysts in orb2 testes (F) that express Twe-lacZ. Second, the amount of lacZ is typically much higher than in wild type (compare purple arrows in E and F). Third, while residual Twe-lacZ is degraded in wild type once meiosis is complete and the spermatids begin differentiation, it persists in elongating orb spermatids (green arrow in Figure 5F). Finally, we sometimes observe that Twe-lacZ is precociously expressed in immature spermatocytes that normally would not have Twe protein (orange arrows in Figure 5F).Meiosis arrests at the G2-M transition in bol mutants because CDC2 remains phosphorylated on Tyr15 in the absence of Twe [37], [38]. This should not be the case in orb2 because high levels of Twe-lacZ and presumably Twe accumulate. To confirm this prediction we compared CDC2Tyr15-P in wild type, bol and orb2 testes. As expected the ratio of phosphorylated to unphosphorylated CDC2 is elevated in bol mutants compared to wild type, while it is reduced in orb2 (Figure 5H). This finding indicates that CDC2 is activated in orb2 mutants and that meiosis I must be blocked at a subsequent step in the G2-M transition.
Nuclear Cyclin B accumulation in orb2 testes
To further pinpoint the meiosis block we examined the expression of Cyclin B (Cyclin B). In wild type testes Cyclin B is expressed in primary spermatocytes when chromosome condensation starts. It persists during metaphase and is abruptly degraded at the beginning of anaphase [28]. Like Cyclin A, Cyclin B's transient nuclear accumulation is seen only very infrequently. Previous studies have shown that the upregulation of Cyclin B expression during chromosome condensation doesn't occur in ofs mutants. But other than that, Cyclin B expression and degradation seem normal [33], [34]. In bol testes, Cyclin B is found in the cytoplasm (Xu, unpublished data). In orb2 mutant testes, Cyclin B initially accumulates in the cytoplasm as in wild type (Figure 5C, 5D, arrow). However, instead of transiently accumulating in the nuclei and then disappearing, we find many orb2 cysts with high levels of nuclear Cyclin B (Figure 5D, arrowhead). In older orb2 cysts we often observe many small Cyclin B speckles in the cytoplasm. Taken together with the effects on twe expression and CDC2 phosphorylation, these findings place the meiosis arrest in orb2 at a step later than in bol and ofs.
Sperm differentiation is disrupted in orb2 mutants
Even though orb2 spermatocytes fail to undergo meiosis, the spermatids in the older cysts eventually exit the meiotic cycle and begin the process of differentiation. One of the first steps in differentiation is the elongation of the flagellar axonemes. In wild type, the elongating bundle of flagellar axonemes extends towards the apical tip in a roughly straight and smooth line (Figure 6A). In contrast, the elongating flagellar axonemes in orb2 zigzag back and forth and are much shorter than wild type. The individual axonemes also often splay out from each other instead of remaining in a tight bundle (Figure 6B). In addition, rather than having a smooth, regular internal morphology, their internal morphology is rough and irregular. This phenotype likely arises from underlying defects in the assembly or localization of axonemal proteins. One protein that is not properly localized is the meiosis regulator Bol. In wild type, Bol co-localizes with the prominent Orb2 band near the tip of the elongating flagellar axoneme bundle. In the region distal to this band extending towards the spermatid nuclei, there is a lower level of Bol and Orb2 and both are distributed uniformly along the individual axonemes (Figure 6C1–6C3). In orb2 testes, the prominent Bol band at the tip of the axoneme is missing, while in the remainder of the axoneme bundle, Bol is dispersed in an irregular fashion, and unlike wild type, its association with individual axonemes is difficult to discern (Figure 6D1–6D3).
Figure 6
orb2 spermatids have defects in flagellar axoneme elongation.
A, B) Phase contrast images showing wild type (A) and orb2 (B) elongated spermatid bundles. Wild type spermatid flagellar axoneme bundles (arrow) have a smooth morphology and extend in a nearly straight line. orb2 bundles have rough and uneven morphology, are shorter, and zigzag back and forth. Individualized sperm (red arrowheads in A) are observed in wild type but not orb2 testes. C1–C3) Wild type testes double stained with Orb2 (red) and Bol (green) antibodies showing co-localized Bol and Orb2 concentrated in a band near the tip of the elongating flagellar axonemes (arrowhead) and decreased expression level following this band. D1–D3) Bol localization at the tip is lost in orb2 flagellar axonemes (arrow), while there is an uneven distribution along the flagellar axonemes extending behind the tip. E1–E3) Orb2 and Bol co-localization at the tip of the elongating flagellar axonemes in orb2 is as in wild type. Scale bar: 20 µm.
orb2 spermatids have defects in flagellar axoneme elongation.
A, B) Phase contrast images showing wild type (A) and orb2 (B) elongated spermatid bundles. Wild type spermatid flagellar axoneme bundles (arrow) have a smooth morphology and extend in a nearly straight line. orb2 bundles have rough and uneven morphology, are shorter, and zigzag back and forth. Individualized sperm (red arrowheads in A) are observed in wild type but not orb2 testes. C1–C3) Wild type testes double stained with Orb2 (red) and Bol (green) antibodies showing co-localized Bol and Orb2 concentrated in a band near the tip of the elongating flagellar axonemes (arrowhead) and decreased expression level following this band. D1–D3) Bol localization at the tip is lost in orb2 flagellar axonemes (arrow), while there is an uneven distribution along the flagellar axonemes extending behind the tip. E1–E3) Orb2 and Bol co-localization at the tip of the elongating flagellar axonemes in orb2 is as in wild type. Scale bar: 20 µm.At the end of meiosis just as spermatid elongation commences, the 64 spermatid nuclei cluster together and begin the process of condensation, eventually forming a cap-like structure (Figure 7A, arrowhead) [39]. This doesn't happen in orb2, and instead of coalescing into a tight bundle, the spermatid nuclei usually end up spread out along the partially elongated flagella axonemes (Figure 7B). The process of individualization begins once elongation is complete. In wild type testes, individualization is accomplished by a special structure called the Individualization Complex (IC). The IC is comprised of 64 individual actin cones that assemble around each nucleus in the condensed spermatid nuclear bundle (Figure 7C, inset) and then travels down the bundled axonemes, ensheathing each in a plasma membrane and pushing the excess cytoplasm into a waste bag [40], [41]. The IC is never assembled in orb2 testes and individualization never takes place. However, we do observe scattered triangular shaped actin cones (Figure 7D, inset). Based on the observed defects, the steps involved in organizing actin filaments into individual actin cones might be comparatively normal, while the subsequent assembly of the cones into the larger IC ensemble is not. Consistent with this idea, Myosin VI, a component of the Actin cone [39], is present in the orb2 cones (Figure 7E1, 7E2, 7F1, 7F2). As the bundled and condensed spermatid nuclei are believed to provide the scaffolding for assembling the IC [41], the defects in orb2 could be due to the failure in spermatid nuclei bundling and condensation. Alternatively or in addition, orb2 may be regulating genes directly involved in assembling the IC. As might be expected from the failure in IC assembly, Don-Juan GFP is not expressed in orb2 testes (Figure 7C, 7D) and mature sperm are never observed (Figure 6A, 6B).
Figure 7
Spermatid nuclear bundles and Individualization Complex are not properly assembled in orb2.
A, B) Formation and compaction of spermatid nuclear bundles in wild type (WT) and orb2. Arrowhead in A labels a condensed spermatid nuclear bundle. Arrowheads in B mark incompletely assembled spermatid nuclear bundles in orb2. Note that individual needle-shaped spermatid nuclei are larger than wild type, and most of the nuclei are scattered along the partially elongated spermatids. Double arrow indicates direction of spermatid elongation. C, D) Individualization complexes and DJ-GFP are missing from orb2 testes. IC (Actin): red; DJ-GFP: green; DNA, blue. Inset shows complete IC (C) or scattered actin cones (D) in either wild type or orb2 testes. E1, E2, F1, F2) MyosinVI (green) is a component of the Actin cones and is localized before the triangle shaped Actin signal in wild type IC (E1, E2, arrow). MyosinVI is also observed in the scattered actin cones in orb2 testes (F1, F2, arrow). Scale bar in A and B: 20 µm.
Spermatid nuclear bundles and Individualization Complex are not properly assembled in orb2.
A, B) Formation and compaction of spermatid nuclear bundles in wild type (WT) and orb2. Arrowhead in A labels a condensed spermatid nuclear bundle. Arrowheads in B mark incompletely assembled spermatid nuclear bundles in orb2. Note that individual needle-shaped spermatid nuclei are larger than wild type, and most of the nuclei are scattered along the partially elongated spermatids. Double arrow indicates direction of spermatid elongation. C, D) Individualization complexes and DJ-GFP are missing from orb2 testes. IC (Actin): red; DJ-GFP: green; DNA, blue. Inset shows complete IC (C) or scattered actin cones (D) in either wild type or orb2 testes. E1, E2, F1, F2) MyosinVI (green) is a component of the Actin cones and is localized before the triangle shaped Actin signal in wild type IC (E1, E2, arrow). MyosinVI is also observed in the scattered actin cones in orb2 testes (F1, F2, arrow). Scale bar in A and B: 20 µm.
Orb2 represses Orb expression
orb mRNAs are expressed after meiosis is complete and localize to the tip of the elongating axoneme close to the band of Orb2 protein [3], [26]; however, these localized mRNAs don't appear to be translated until Orb2 protein begins to disappear at the end of the elongation phase (Figure 2A–2D). These observations suggested that the localized orb mRNAs might be a target of Orb2 repression. To test this hypothesis, we first probed Western blots of wild type and orb2 testes extracts with Orb antibodies. Figure 8A shows that Orb levels are elevated in orb2 mutants. In addition to this increase in Orb protein, orb mRNA translation appears to be ‘prematurely’ activated in orb2 mutant spermatids. As shown in Figure 2E and 2F, Orb protein is expressed in incompletely elongated orb2 mutant spermatids. Finally, the expression of Orb protein is not properly restricted to the tip of the elongated flagellar axoneme as in wild type. Instead, Orb is found throughout the mutant spermatid axonemes.
Figure 8
orb is an Orb2 regulatory target.
A) Western blots of extracts prepared from wild type, orb2 and orb2 testes were probed as indicated on the left. In this experiment Snf (Sans filles) was used as a loading control. Similar results were obtained using Tubulin as the loading control. B) orb mRNA can be immunoprecipitated with Orb2 antibodies from wild type testes extracts. orb2 testis extract are used as a negative control for immunoprecipitation. After reverse transcription using oligo-dT primers, the orb cDNA was amplified using a primer set from the 3′ end of the male orb mRNA. L: 100 bp DNA ladder.
orb is an Orb2 regulatory target.
A) Western blots of extracts prepared from wild type, orb2 and orb2 testes were probed as indicated on the left. In this experiment Snf (Sans filles) was used as a loading control. Similar results were obtained using Tubulin as the loading control. B) orb mRNA can be immunoprecipitated with Orb2 antibodies from wild type testes extracts. orb2 testis extract are used as a negative control for immunoprecipitation. After reverse transcription using oligo-dT primers, the orb cDNA was amplified using a primer set from the 3′ end of the male orb mRNA. L: 100 bp DNA ladder.The orb mRNAs in the two sexes differ at their 5′ and 3′ ends. The male transcripts begin at an internal promoter and encode a protein that has a different N-terminus from the female Orb. At the 3′ end, the male UTR is only about 200 bases in length, while the female UTR is over a thousand [3]. While the male 3′UTR lacks most of the critical sequences for orb mRNA localization and translational regulation in ovaries, there are two CPE elements. Thus, it seemed possible that orb2 might repress orb mRNA translation by a mechanism that involves an association between Orb2 protein and orb mRNA. To test this idea we reverse transcribed RNA isolated from Orb2 immunoprecipitates of wild type and orb2 testes extracts, and then used primers specific for the orb male 3′ UTR for PCR amplification. Figure 8B shows that orb mRNA is readily detected in the Orb2 immunoprecipitates from wild type but not orb2 testes. In control experiments (not shown), neither boule nor twine mRNA was found in Orb2 immunoprecipitates. Taken together, these findings are consistent with the idea that Orb2 represses orb mRNA translation directly, rather than by regulating some other intermediate.More than twenty other mRNAs are transcribed post-meiotically and localize to the tip of the elongating spermatid flagellar axonemes [26]. In addition to having similar expression and localization patterns to orb several of these mRNAs have CPE-like elements in their 3′ UTRs and could be regulatory targets of orb2. Consistent with this possibility we found that two of the CPE containing mRNAs, scotti and f-cup, can be immunoprecipitated with Orb2 antibody from wild type but not orb2 mutant testes (Figure S4). While the function of f-cup is unknown, Barreau et al.
[26] found that scotti mutant males are sterile. The primary defect appears to be at a late step in spermatogenesis and involves the assembly or maintenance of the IC structure.
Uncoupling orb2 functions in meiosis and differentiation
Although the experiments above show that orb2 is required for spermatid differentiation, it could be argued that the differentiation defects are the indirect consequence of the failure to undergo meiosis rather than because orb2 has special functions in this stage of spermatogenesis. To address this problem, at least in part, we took advantage of the hypomorphic orb2 allele, which has a small deletion that removes an N-terminal poly-Q domain (Figure S2A, Figure 3) [14]. As shown in Figure 3B, both the large isoform and the smaller, testes specific isoform are abundantly expressed in orb2 testes; however, they migrate more rapidly than the corresponding wild type isoforms due to the loss of the poly-Q domain.We examined spermatogenesis in orb2 homozygous flies. In contrast to the mutants that reduce or eliminate expression of the 75 kD isoform, there are no meiosis defects in orb2. Instead, like wild type, 32- and 64-cell cysts are observed, and each of the spermatids in the 64-cell cysts has a normal looking nucleus (Figure 9C) and Nebenkern (not shown). Also unlike orb2, elongating orb2 flagellar axonemes have a seemingly normal morphology and as in wild type the mutant Orb2 protein and Bol accumulate together in a prominent band near the growing tip of the flagellar axoneme (Figure 6E1–6E3). Likewise the assembly of the spermatid nuclei into a bundle and their condensation appear to be normal (not shown).
Figure 9
Orb2 functions in meiosis and differentiation can be uncoupled in orb2 allele.
A) Percentage of scattered ICs is higher in orb2 than wild type. A total of 34 wild type and 46 orb2 testes were counted. B) Percentage of wild type or orb2 testes having 0–3, 4–8, 9–13, 14–18, 19–23, 24–28, 29–33 or 34–38 ICs per testes. orb2 testes have fewer ICs compared to wild type. C) orb2 testes have normal spermatids. Green arrow: mature spermatocytes; yellow arrow: 64-cell spermatids cyst; arrowhead: spermatids at the beginning of elongation. D) Wild type testes stained with Orb2 (red), IC (Phalloidin, green) and DNA (blue). Yellow arrow points to where elongation usually stops in wild type testes. “d” marks the normal diameter of a testis at spermatogonia and early spermatocytes region. E–F) Flagellar axoneme bundles in orb2 testes are over elongated. E) Overgrowth results in the swelling of the testis tip. Diameter of the orb2 spermatogonia part of the testis is larger than that of the wild type (compare d in D and d′ in E), while the diameter of the nuclei side is relatively normal (compare d in D and d′, d″ in E). F) Another example of overly elongated flagellar axoneme bundles in orb2 testis tip. The Orb2 positive axoneme bundle extended to the spermatogonial region and then changed its direction of elongation (arrows) to continue growing in the wrong direction. G, H) IC is not properly assembled in orb2. Phalloidin labeled Actin: green; DNA: blue. Arrow in G points to scattered actin cones of an orb2 IC that remain relatively close together in one elongating spermatid cyst. Arrows in H are examples of widely scattered actin cones. In orb2 testes with scattered IC, we can also observe what appear to be normal looking ICs, as indicated here by arrowhead in H. Scale bar: 50 µm.
Orb2 functions in meiosis and differentiation can be uncoupled in orb2 allele.
A) Percentage of scattered ICs is higher in orb2 than wild type. A total of 34 wild type and 46 orb2 testes were counted. B) Percentage of wild type or orb2 testes having 0–3, 4–8, 9–13, 14–18, 19–23, 24–28, 29–33 or 34–38 ICs per testes. orb2 testes have fewer ICs compared to wild type. C) orb2 testes have normal spermatids. Green arrow: mature spermatocytes; yellow arrow: 64-cell spermatids cyst; arrowhead: spermatids at the beginning of elongation. D) Wild type testes stained with Orb2 (red), IC (Phalloidin, green) and DNA (blue). Yellow arrow points to where elongation usually stops in wild type testes. “d” marks the normal diameter of a testis at spermatogonia and early spermatocytes region. E–F) Flagellar axoneme bundles in orb2 testes are over elongated. E) Overgrowth results in the swelling of the testis tip. Diameter of the orb2 spermatogonia part of the testis is larger than that of the wild type (compare d in D and d′ in E), while the diameter of the nuclei side is relatively normal (compare d in D and d′, d″ in E). F) Another example of overly elongated flagellar axoneme bundles in orb2testis tip. The Orb2 positive axoneme bundle extended to the spermatogonial region and then changed its direction of elongation (arrows) to continue growing in the wrong direction. G, H) IC is not properly assembled in orb2. Phalloidin labeled Actin: green; DNA: blue. Arrow in G points to scattered actin cones of an orb2 IC that remain relatively close together in one elongating spermatid cyst. Arrows in H are examples of widely scattered actin cones. In orb2 testes with scattered IC, we can also observe what appear to be normal looking ICs, as indicated here by arrowhead in H. Scale bar: 50 µm.On the other hand, the process of differentiation is not normal in orb2. In wild type testes, elongation of the flagellar axoneme stops before the tail reaches spermatogonia region (Figure 9D, arrow points to end of elongation). This is not true in orb2. About 70% of the mutant testes have over-elongated flagellar axonemes that extend into the spermatogonia region. Elongation doesn't seem to arrest even at this point. Overgrowth of spermatid axoneme results in the swelling of testes tip region and an over-sized testes tip is often observed in orb2 testes (Figure 9E, compare d in Figure 9E and d′ in Figure 9D). In some cases, the elongating flagellar axonemes push against the testes wall and cause the muscle layer encasing the apical tip of the testes to rupture (not shown). On other occasions, when the flagellar axoneme bundle reaches the spermatogonia region, it changes direction and begins elongating towards the side of the testes or even reverses direction and elongates towards the base of the testes (Figure 9F).Another differentiation defect is in the assembly and functioning of the IC. While fully elongated cysts with scattered actin cones are occasionally observed in wild type testes (∼6%), 35% of the fully elongated cysts in orb2 testes have scattered actin cones (Figure 9A, 9G, 9H). The IC defects range from actin cones that are not fully coalesced into the IC structure (Figure 9G, arrow) to completely dispersed actin cones (Figure 9H, arrows). These IC phenotypes resemble the phenotypes reported for scotti
[26]. In the testes that have IC defects, there is always a mixture of both wild type and defective ICs (Figure 9H arrow and arrowhead), which may explain why orb2 males are still fertile. Also by comparison, all ICs in orb2 testes are defective. There is also a reduction in the number of ICs in orb2 testes. In wild type flies, over 90% of the testes have more than 19 ICs. In contrast, orb2 testes, 44% testes have less than 19 IC (Figure 9B). The fact that meiosis is normal in orb2
ΔQ, but there are clear defects in both spermatid elongation and individualization, would provide further support for the idea that orb2 activity is required not only for meiosis, but also for proper differentiation.
Discussion
Although CPEB family proteins play critical roles in germline development in many species, their germline functions differ between proteins within an organism and also between proteins in different organisms. For example, in C. elegans, Fog-1 and the Orb2-like CPB-1 function in the male germline and are required for sex determination and meiosis respectively. A third, Orb-like CPEB, CPB-3 is required for meiosis in females [42]–[44]. Similar functional specializations are evident for orb and orb2. While orb is essential for oogenesis, it is not absolutely required for spermatogenesis as orb mutant males produce functional sperm and their fertility is reduced but not eliminated. The opposite sex specificity is exhibited by orb2. Though genetic interaction studies (suppression of orbhaploinsufficiency in the gurken dorsal-ventral polarity pathway: see for example [17], [55]) suggest that orb2 may negatively regulate orb in the ovary, orb2 females are fertile and oogenesis appear to be comparatively normal (Nathaniel Hafer, PhD thesis). In contrast, orb2 plays an essential role in the male germline, and is required for programming the orderly progression of spermatogenesis from meiosis through differentiation.How CPEB proteins regulate meiotic progression is best understood in Xenopus oocytes. During oocyte maturation, CPEB1 acts as a repressor, blocking translation of mRNAs containing CPE motifs. However, after progesterone stimulation, CPEB1 is converted into an activator by Aurora kinase phosphorylation, initiating translation by stimulating the Gld-2 dependent polyadenylation of target mRNAs. Amongst the targets are mRNAs encoding Mos and the Cyclins B2 and B5. These cyclins activate Maturation Promoting Factor (MPF) which mediates entry into metaphase I. Although CPEB1 is degraded during metaphase I, it induces expression of CPEB4, which is a member of the second CPEB family. CPEB4 subsequently controls the transition to metaphase II by regulating Cyclins B1 and B4 expression [45]–[49]. Interestingly, though mouseCPEB1 is also essential for meiosis in both sexes, it controls meiosis at an earlier step by regulating mRNAs encoding synaptonemal complex proteins [50].Since there is no recombination in Drosophila males, the function(s) of orb2 in meiosis are necessarily different from those of mouseCPEB1 [48]. Additionally, its role is distinct from that of XenopusCPEB1. While XenopusCPEB1 promotes meiotic progression by activating translation of Cyclin B mRNAs, orb2 pre-meiotic cysts accumulate high levels of Cyclin B. orb2 also differs from the fly translation factors ofs and bol. The meiotic phenotypes of mutations in these two genes suggest that they regulate different targets and likely function at earlier steps in meiotic progression than orb2. Unlike orb2 mutants, Cyclin B levels aren't properly upregulated during G2 in ofs mutants. However, it is not clear whether ofs regulates Cyclin B mRNA translation directly, or whether the defects are an indirect consequence of incomplete spermatocyte maturation [33], [34]. bol seems to function at a step after ofs, controlling the onset of metaphase I by activating twe mRNA translation. In bol mutants Twe is not expressed and meiotic progression is blocked because CDC2 remains phosphorylated and inactive. orb2 mutations have a very different effect on Twe. First, Twe is precociously expressed in cysts containing spermatocytes that have not fully matured. Second, very high levels of Twe accumulate in mature cysts that are arrested prior to metaphase I. Moreover, as would be expected, a substantial fraction of Cdc2 in orb2 testes is dephosphorylated. Finally, Twe persists in differentiating spermatids. These phenotypes, together with the high levels of the A and B Cyclins, argue that orb2 regulates meiotic progression at a step that is likely later than either ofs or bol. Additionally, these findings indicate that meiotic progression in male flies does not depend upon a single critical step or “switch” such as turning on twe or cyclin mRNA translation. Rather, it would appear that multiple steps in meiotic progression are subject to translational regulation, and that these steps are controlled by different translation factors.One simple model for Twe (Twe-LacZ) misexpression is that orb2 represses the translation of twe mRNA, perhaps by antagonizing Bol dependent activation. However, there are complications with this model. For example, the high levels of Twe-LacZ that accumulate in cysts arrested before metaphase I could be the consequence of a prolonged arrest at a point after Bol activation of twe translation rather than a failure to repress twe mRNA translation. While an indirect effect of this type would not explain why Twe-LacZ is precociously expressed in immature orb2 spermatocytes, we were unable to demonstrate an association between Orb2 and twe mRNA. Additionally, twe 3′ UTR doesn't contain any obvious CPE-like recognition sequences. With the caveat that these are negative results, an alternative possibility is that the effects on Twe-LacZ expression are indirect.The onset of spermatid differentiation in wild type normally proceeds only after the completion of meiosis. However, as is seen for twe, ofs and bol, differentiation becomes uncoupled from meiotic progression and the mutant cysts ultimately exit the pre-metaphase I arrest and begin the process of spermatid differentiation [32]–[34]. In all of these mutants the differentiation process is abnormal, with some steps being initiated, but not properly executed, while other steps are not even initiated. One of the key events in spermatid differentiation is the elongation of the flagellar axoneme. Little or no elongation is evident for bol, while twe and ofs spermatids begin elongating but quickly abort [32]–[34]. While the spermatid flagellar axonemes elongate in orb2 mutants, the axonemes don't extend straight back towards the stem cells at the tip of the testes, but instead zigzag irregularly and prematurely halt elongation. They also have an abnormal internal morphology and though they express Bol, they lack the prominent Bol band, which in wild type testes co-localizes with the Orb2 band near the tip of the elongating axonemes. Since Bol is essential for elongation, the absence of the Bol band is likely to be relevant to the elongation defects in orb2. While we didn't detect any association between Orb2 and bol mRNA, RNA independent Orb2-Bol proteins complexes are found in testes extracts. Thus, a plausible idea is that localization of Bol to the axonemal band is mediated by interactions with Orb2.Once elongation is completed in wild type, the spermatid nuclei condense and coalesce into a nuclear bundle and this structure provides a scaffold for assembling the IC. In orb2 the spermatid nuclei don't properly condense and never coalesce into a tight nuclear bundle. Though the process of IC assembly is initiated and actin cones are generated, a complete IC is never formed. The individualization marker Don Juan is also not expressed in orb2 testes. Interestingly, though spermatid differentiation appears to be much less complete in ofs than in orb2, Don Juan is expressed in ofs testes [33].An important question is whether the defects in differentiation evident in orb2 testes reflect functions for orb2 during this stage of spermatogenesis or are the indirect and perhaps non-specific consequence of the earlier meiotic arrest. Arguing against the later possibility is the fact that ofs, bol, and orb2 mutants have quite distinct differentiation phenotypes, yet all three fail to undergo meiosis. In the case of orb2, other lines of evidence point to functions at specific steps in differentiation. First, orb2 appears to be required for repressing the post-meiotic expression of Orb until after spermatid elongation is complete. In wild type, the orb gene is transcribed post-meiotically, but orb mRNA is not translated until after spermatid elongation is nearly complete. Since the timing of orb mRNA translation is correlated with the disappearance of Orb2, a plausible idea is that Orb2 represses orb mRNA translation. Consistent with this hypothesis, the levels of Orb protein are elevated in orb2 mutant testes, and it is expressed prematurely in incompletely elongated spermatids. In addition, instead of being expressed only at the tip of the flagellar axonemes, Orb is distributed all along the axonemes. As orb mRNA contains two CPE elements and can be detected readily in Orb2 immunoprecipitates, it seems possible that Orb2 could directly repress orb mRNA translation. As noted above, a role in repressing orb mRNA translation is also suggested by genetic interaction studies in females (Nathaniel Hafer, PhD thesis). Second, orb mRNA does not seem to be the only post-meiotic orb2 regulatory target. We found that scotti and f-cup, which are also expressed after meiosis and thought to encode proteins involved in differentiation, are found in Orb2 immunoprecipitates of testes extracts. Moreover, there could be additional targets besides these three mRNAs. Several of the other post-meiotically expressed genes have CPE-like elements in their 3′ UTRs [26]. Similarly, the mRNA encoding gld2poly(A) polymerase, which is thought to be an Orb co-factor, also has a CPE-like element in its 3′ UTR and resembles Orb in that Gld2 protein preferentially accumulates near the tip of elongated flagellar axonemes [51]. Third, the hypomorphic poly Q deletion mutant, orb2, makes it possible to separate meiotic arrest from at least some steps in differentiation. Meiosis appears to be completely unaffected by the ΔQ mutation; however, as is seen for orb2 there are defects in both flagellar axoneme elongation and IC assembly. On the other hand, since the differentiation defects in orb2 are much less severe than those in the null, the possibility remains open that the failure in meiosis interferes with some process(es) critical for proper differentiation. For example, the defects in chromosome condensation and spermatid nuclear bundle formation could be due to the fact that the orb2 spermatid nuclei have a large excess of DNA. In turn it could be argued that the failure in IC assembly in orb2 is due to the absence of a coalesced spermatid nuclear bundle. However, the fact that IC assembly is also defective in orb2
ΔQ would argue that orb2 must have IC specific functions that are independent of any IC assembly steps that require completion of meiosis. Consistent with this possibility, mRNAs encoding Scotti, which has also been implicated in IC function, are found in orb2 immunoprecipitates.Finally, our studies provide some insights into the functional properties of the N-terminal region of the Orb2 protein. First, the very modest phenotypes observed not only in the soma [14], [19] but also in the male germline for orb2 suggest that the prion forming poly-Q domain, which is present in both the 75 kD and the 60 kD isoforms [10], [11], is dispensable for most orb2 functions. Second, even though the testes differ from the soma in that there are readily detectable levels of the 60 kD isoform, it is not clear what function if any this isoform has in spermatogenesis. In the insertion mutants that reduce expression of the 75 kD isoform there are even higher levels than normal of the 60 kD isoform, yet these mutants exhibit meiotic and differentiation defects that resemble those seen for the orb2 deletions. Though their phenotypes appear less severe than the deletion mutants, this could be attributed to the fact that all express some residual 75 kD protein. Third, the 162 N-terminal sequence that is unique to the 75 kD isoform is critical for orb2 function in programming the orderly development of the male germline from meiosis through the process of spermatid differentiation. Since there is little if any of the 60 kD isoform in somatic tissues, it isn't certain at this point whether the smaller isoform would be able substitute for the 75 kD in the soma. Additional tools will be required to determine whether the smaller isoform has any role in spermatogenesis and also to further dissect how orb2 functions at different points in meiosis and differentiation.
Materials and Methods
Fly strains
We obtained P-element/Piggybac insertion (f01556, c06090, e01925, d01793, f04965) from the Exelexis collection maintained at Harvard [29]. Deficiency stocks Df(3L)ED4421, Df(3L)ED4415, Df(3L)ED4416 and the dj-GFP stock were obtained from the Drosophila stock center (Bloomington). bol is a kind gift from Steven Wasserman [37]. orb2 and orb2 are provided by Barry Dickson [14]. All twine-lacZ flies, twine, aly, sa, can, and mia mutants are kindly provided by Minx Fuller (Stanford).
Fertility assay
20 individual males were placed with two w females each in food vials for 5 days, after which adults were removed. Presence of larvae, pupae and adults were examined after another 2 weeks. Those with presence of larvae are considered fertile.
Generating orb2 null allele
piggyBack (pBac) transposon insertions with FRT sites near the orb2 gene used to generate orb2 null alleles are: FRT1 (f01556), FRT2 (d01925), FRT3 (f04965) (Figure S2). The FRT sites are used in combination with FLP to create targeted deletions of genomic DNA (method as described in [29], [30]). Deletions were confirmed using PCR primers specific for pBac sequences flanking the deletion site and within the gene region. We recovered and established several independent deletion stocks from each transposon pair and they behave similarly. Experiments described here use deletions from f01556–f04965, which we named orb2. There are also deficiencies in the region that uncover the orb2 locus and have been mapped molecularly (Df(3L)ED4421, Df(3L)ED4415, Df(3L)ED4416). They behave the same when combined with orb2. In the text, Df(3L)ED4416 is used and referred to as 4416.
Western blotting
Western blotting was essentially performed as in [19]. Antibodies used were as follows: mouse anti-Orb2 2D11 (1∶25), mouse anti-Orb2 4G8 (1∶25), mouse anti-Snf 4G3 (1∶2000), rabbit anti CDC2 (PSTAIR) (1∶2000, millipore), rabbit anti CDC2Tyr15 (IMG668) (1∶2000, IMGENEX), mouse anti-Orb 6H4 (1∶60), mouse anti-Orb 4H8 (1∶60) [3], [4], goat anti-mouse conjugated HRP (1∶1000- Jackson Immunoresearch). Blots were then washed 4×10 minutes in TBST and developed with ECL-plus (Amersham).
In situ hybridization
In situ hybridization was performed as described in [52]. Fluorescent antisense probes for orb2 were synthesized by Biosearch Technologies (www.biosearchtech.com). Forty non-overlapping 17 bp probes targeted at orb2 mRNA sequence from cctggacgatcagatgt to atatgttatttaatctcac were synthesized and labeled with Quasar 670 and used at 1∶100 dilution. Detection is done on an inverted Zeiss LSM510 confocal microscope.
Immunocytochemistry
Whole mount staining is performed as in [33]. Antibodies used were as follows: mouse anti-Orb2 2D11 and 4G8 IgG (undiluted), rabbit anti-Bol (1∶1000, a gift from Steven Wasserman), mouse anti-Myosin VI 3C7 1∶25 (a gift from Kathryn Miller), monoclonal anti-β-Tubulin E7 1∶50 (Developmental Studies Hybridoma Bank), monoclonal anti-Orb 6H4 and 4H8 1∶30. DNA was stained with Hoescht (1∶1000). Actin was stained with Alexa488-phalloidin, Alexa546-phalloidin (Invitrogen, Carlsbad, CA). Secondary antibodies used were goat anti-mouse IgG Alexa 488 or 546, goat anti-rabbitAlexa 488 or 546 (Molecular Probes, Inc.) Samples were mounted in Aqua-polymount on slides for an inverted Zeiss LSM510 confocal microscope. Testes live squash and phase contrast was performed as described in [41]. β-galactosidase activity assay was performed as described by [28].
Immunoprecipitation and RT–PCR
Immunoprecipitation was performed essentially as described by [53], except the followings: crude monoclonal anti-Orb2 antibodies 2D11 and 4G8 were affinity purified with Orb2 coupled HiTrap NHS-activated HP column (GE healthcare) before used for immunoprecipitation; purified Orb2 antibodies were mixed with testis extract for 0.5 h–2 h at room temperature before protein-A/G beads (Calbiochem/Millipore) were added in; the mixture was then incubated at 4 C° for 2 h to overnight. Putative Orb2 target mRNAs with CPE binding sites were predicted using software described in [54]. RT-PCR was done according to [19].Primers used were as follows:orb2 common exon among RA,B,C,D:CAACAGTGCCACCAGCAGTGC and GCGCAGACTAACTTCGTCGTT.Cg5741: ATGAGCAAAGCTCCGTTGAAAGCC and TATCCGGATTAACCGTGTTCCGCA.orb :CAAGCCCTTGACTCGCAACTCC and CTCCGCCATATTTCTACGTCGCCTACscotti: AAGAACCTCTCTTGGACCTCGGAA and AATGGGATGCATATCGGCTGGTTGf-cup: AACCAGCTGAGCACTTTGCCCAAT and AGATGAACTGTGGCACATAGCCGA
Phosphorylation assay
Phosphorylation assay was done as in [55]. Testis were squashed in cold PBS and treated with λ protein phosphatase for 1 hour at 30°C followed by Western blots.Orb2 is hyperphosphorylated in tTAFs mutant testes. A) Orb2 migrates slower in testes extract from tTAF mutants, but not the head. B) λ-phosphotase (λPP) treatment removes the slow migrating form of Orb2 in sa mutant testes, indicating hyperphosphorylation.(TIF)Click here for additional data file.orb2 gene structure, orb2 mRNA and protein expression in its mutant alleles. A) orb2 gene structure adapted from Flybase. orb2 has multiple transcripts. RA, RB, RC and RD are CPEB homologs that are transcribed from three different promoters (blue arrow, orb2-1, 2, 3). There is another transcript RH not shown here that shares the same RC sequence with a larger 3′UTR). RE, RF, RG and RI are fusion transcripts of sequences from the 5′ most exons of orb2 and a downstream gene, CG5741. These chimeric RNAs (orb2-CG5741) encode part of the Orb2 N-terminal domain, but do not have the conserved CPEB homology domain. CG5741 has its own promoter, and normal levels of CG5741 transcripts are observed in the various orb2 mutants [19]. In contrast, alterations in the levels of the various orb2-CG5741 chimeric RNAs are observed in different orb2 insertion mutants. piggyBac insertion sites are marked by black arrows. piggyBac 1556, 1925 and 4965 contain properly oriented FRT sites (FRT1, 2, 3) for generating deletion alleles through mitotic recombination (inset shows schemes of generating deletion from two adjacent FRT sites [29], [30]). Red brackets mark the poly-Q sequence that is deleted in orb2 allele [14]. B) 6090 and 1925 insertion disrupts Orb2 expression in the testes and the heads. The 1793 insertion, on the other hand, only affects Orb2 expression in the testes (suggesting that orb2-2 is active in the head, while most but not all of the transcripts in the test are from orb2-1). Snf is used as a loading control. C) Effects of piggyBac insertion on orb2 and orb2-CG5741 transcripts. Notice that 4965 insertion disrupts orb2-CG5741 but has no effect on orb2 transcripts. It also has no effect on the levels of CG5741 RNAs. 4965 has no spermatogenesis defects, indicating that the spermatogenesis phenotype we saw is a result of loss of Orb2 function (see further discussion in [19]). 6090
−1, which precisely removes 6090 piggyBac insertion, fully restores orb2 transcript, protein expression and fertility.(TIF)Click here for additional data file.Bol expression in spermatocytes and spermatids in orb2. A, B, C, D: Bol antibody staining; A′, B′, C′, D′, Bol (green) and DNA (blue) overlay. A, A′) Biphasic subcellular localization of Bol in wild type testes. Bol is seen both in the cytoplasm (arrow) and in a perinucleus dot (arrowhead) in spermatocytes in wild type testes. B, B′) This pattern is also observed in orb2. C, C′, D, D′) Bol cytoplasmic localization in spermatids is observed in wild type spermatids and pseudo spermatids in orb2. Scale bar: 50 µm.(TIF)Click here for additional data file.“comet” and “cup” classes of genes are detected in anti-Orb2 immunoprecipitates. mRNAs isolated from anti-Orb2 immunoprecipitates were reversed transcribed with oligo-dT primers. cDNAs were then PCR amplified using primers derived from the 3′UTRs of scotti and f-cup. Both genes are expressed post-meiotically and encode mRNAs with CPEs in their 3′ UTR. orb2 testes extract is used as a negative control for non-specific immunoprecipitation.(TIF)Click here for additional data file.
Authors: Tomoko Mastushita-Sakai; Erica White-Grindley; Jessica Samuelson; Chris Seidel; Kausik Si Journal: Proc Natl Acad Sci U S A Date: 2010-06-14 Impact factor: 11.205
Authors: Li Chin Wong; Alexandre Costa; Ian McLeod; Ali Sarkeshik; John Yates; Saw Kyin; David Perlman; Paul Schedl Journal: PLoS One Date: 2011-09-19 Impact factor: 3.240
Authors: Barbara Krystyna Stepien; Cornelia Oppitz; Daniel Gerlach; Ugur Dag; Maria Novatchkova; Sebastian Krüttner; Alexander Stark; Krystyna Keleman Journal: Proc Natl Acad Sci U S A Date: 2016-10-24 Impact factor: 11.205
Authors: Liying Li; Consuelo Perez Sanchez; Brian D Slaughter; Yubai Zhao; Mohammed Repon Khan; Jay R Unruh; Boris Rubinstein; Kausik Si Journal: Curr Biol Date: 2016-11-03 Impact factor: 10.834
Authors: Mohammed Repon Khan; Liying Li; Consuelo Pérez-Sánchez; Anita Saraf; Laurence Florens; Brian D Slaughter; Jay R Unruh; Kausik Si Journal: Cell Date: 2015-12-03 Impact factor: 41.582
Authors: Zaur M Kachaev; Lyubov A Lebedeva; Eugene N Kozlov; Ilya Y Toropygin; Paul Schedl; Yulii V Shidlovskii Journal: Cell Cycle Date: 2018-08-01 Impact factor: 4.534
Authors: Rudolf Gilmutdinov; Eugene N Kozlov; Konstantin V Yakovlev; Ludmila V Olenina; Alexei A Kotov; Justinn Barr; Mariya Zhukova; Paul Schedl; Yulii V Shidlovskii Journal: Development Date: 2021-09-09 Impact factor: 6.862