Literature DB >> 23166775

Identification of microRNAs from Eugenia uniflora by high-throughput sequencing and bioinformatics analysis.

Frank Guzman1, Mauricio P Almerão, Ana P Körbes, Guilherme Loss-Morais, Rogerio Margis.   

Abstract

BACKGROUND: microRNAs or miRNAs are small non-coding regulatory RNAs that play important functions in the regulation of gene expression at the post-transcriptional level by targeting mRNAs for degradation or inhibiting protein translation. Eugenia uniflora is a plant native to tropical America with pharmacological and ecological importance, and there have been no previous studies concerning its gene expression and regulation. To date, no miRNAs have been reported in Myrtaceae species.
RESULTS: Small RNA and RNA-seq libraries were constructed to identify miRNAs and pre-miRNAs in Eugenia uniflora. Solexa technology was used to perform high throughput sequencing of the library, and the data obtained were analyzed using bioinformatics tools. From 14,489,131 small RNA clean reads, we obtained 1,852,722 mature miRNA sequences representing 45 conserved families that have been identified in other plant species. Further analysis using contigs assembled from RNA-seq allowed the prediction of secondary structures of 25 known and 17 novel pre-miRNAs. The expression of twenty-seven identified miRNAs was also validated using RT-PCR assays. Potential targets were predicted for the most abundant mature miRNAs in the identified pre-miRNAs based on sequence homology.
CONCLUSIONS: This study is the first large scale identification of miRNAs and their potential targets from a species of the Myrtaceae family without genomic sequence resources. Our study provides more information about the evolutionary conservation of the regulatory network of miRNAs in plants and highlights species-specific miRNAs.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23166775      PMCID: PMC3499529          DOI: 10.1371/journal.pone.0049811

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Eugenia uniflora is a tropical fruit tree native to South America. The shrubby tree produces edible cherry-like fruits, which are locally known as pitanga or the Brazilian cherry. This species belongs to the Myrtaceae family, which is characterized by the presence of tannins, flavonoids, monoterpenes and sesquiterpenes whose presence and concentration varies between specimens from different geographical locations [1]–[3]. Extracts from pitanga leaves contain interesting biological properties that have been reported in several studies, and pitanga juice is used in folk medicine as a diuretic, antirheumatic, antipyretic, antidiarrhetic and antidiabetic [4]–[9]. E. uniflora is also an important ecological model to study because it grows in areas of medium and large levels of rainfall and can also be found in different vegetation types and ecosystems [10]. The variation in the metabolite concentration and the adaptability to different environments observed in E. uniflora indicating that these are the result of the transcriptional regulation of many genes involved in metabolic and signaling pathways. MicroRNAs (miRNAs) are small non-coding regulatory RNAs widely found in unicellular and multicellular organisms that act as regulators of gene expression at the post-transcriptional level on genes containing miRNA target sites [11]. Mature miRNAs are single-stranded RNA molecules of approximately 21 nucleotides (nt) in length processed from a precursor molecule (pre-miRNA) [12]. To regulate protein-coding genes, the mature miRNA binds with perfect or imperfect complementarity to sites in the 5′ or 3′ untranslated regions (UTR) or coding sequences (CDS) of genes, which leads to mRNA degradation or translation inhibition [13]–[14]. In plants, miRNAs have diverse biological functions and are involved in the regulation of optimal growth and development as well as other physiological processes, including abiotic and biotic stress responses [15]. Several studies showed that many miRNAs are conserved across different plant families [16]–[17]. However, family- and species-specific miRNAs that are expressed in lower levels and probably have evolved more recently have been reported [18]. In the present study, in order to evaluate the importance of miRNAs in the regulation of gene expression and metabolic pathways in E. uniflora, we constructed small RNA (sRNA) and polyA RNA-seq libraries from leaves and sequenced the libraries with high throughput Solexa technology. The sequencing data were analyzed to identify conserved and novel miRNAs and their respective targets. This work represents the first report of miRNAs identified in Myrtaceae.

Methods

Plant Material and RNA Isolation

Total RNA was isolated from E. uniflora leaves using the CTAB method [19]. RNA quality was evaluated by electrophoresis on a 1% agarose gel, and quantification was determined using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Deep Sequencing

Total RNA (>10 µg) was sent to Fasteris SA (Plan-les-Ouates, Switzerland) for processing. One sRNA library was constructed and sequenced using the Illumina HiSeq2000 platform. Briefly, the construction of the sRNA library consisted of the following successive steps: acrylamide gel purification of the RNA bands corresponding to a size range of 20–30 nt; ligation of the 3p and 5p adapters to the RNA in two separate subsequent steps, each followed by acrylamide gel purification; cDNA synthesis followed by acrylamide gel purification; and a final step of PCR amplification to generate a cDNA colony template library for Illumina sequencing. The polyadenylated transcript sequencing (RNA-seq) was performed using the following successive steps: poly-A purification; cDNA synthesis using a poly-T primer shotgun method to generate inserts of 500 nt, 3p and 5p adapter ligations; pre-amplification; colony generation; and sequencing. The Illumina output data included sequence tags of 100 bases.

Accession Numbers

Sequencing data are available at the NCBI Gene Expression Omnibus (GEO) ([http://www.ncbi.nlm.nih.gov/geo]). The accession number GSE38212 contains the sequence data from the RNA-seq and sRNA libraries derived from E. uniflora leaves.

Data Analysis

The overall procedure for analyzing Illumina small libraries is shown in Figure S1. All low quality reads with FASTq values below 13 were removed, and 5′ and 3′ adapter sequences were trimmed using the Genome Analyzer Pipeline (Illumina) at Fasteris SA. The remaining low quality reads with ‘n’ were removed with PrinSeq script [20]. Sequences shorter than 18 nt and larger than 25 nt were excluded from further analysis. Small RNAs derived from Viridiplantae rRNAs, tRNAs, snRNAs and snoRNAs deposited at the tRNAdb [21], SILVA rRNA [22], and NONCODE v3.0 [23] databases and from Rosales mtDNA and cpDNA sequences deposited at the NCBI GenBank database [(http://ftp.ncbi.nlm.nih.gov)] were identified by mapping with Bowtie [24]. After cleaning the data (low quality reads, adapter sequences), the RNA-seq data were assembled into contigs using the CLC Genome Workbench version 4.0.2 (CLCbio, Aarhus, Denmark) algorithm for de novo sequence assembly using the default parameters (similarity = 0.8, length fraction = 0.5, insertion/deletion cost = 3, mismatch cost = 3). In total, 170,568 contigs were assembled and used as a reference for the discovery of pre-miRNA and target sequences.

Identification of Conserved and Novel miRNAs

In order to determine conserved plant miRNAs, small RNA sequences were aligned with known non-redundant Magnoliophyta miRNAs deposited at miRBase (Release 18, November 2011) using Bowtie. Complete alignment of the sequences was required, and no mismatches were allowed. To search for novel miRNAs, small RNA sequences were matched against contigs obtained through de novo assembly of transcripts from mRNA sequences of E. uniflora leaves using SOAP2 [25]. The SOAP2 output was filtered with an in-house filter tool (FilterPrecursor) to identify candidate sequences as miRNA precursors using an anchoring pattern of one or two blocks of aligned small RNAs with perfect matches. The selected candidate precursors were manually inspected using the software Tablet [26] to visualize the presence of the anchoring pattern. As miRNA precursors have a characteristic hairpin structure, the next step to select candidate sequences included secondary structure analysis by RNAfold with the annotation algorithm from the UEA sRNA toolkit [27]. In addition, perfect stem-loop structures should have the miRNA sequence at one arm of the stem and a respective anti-sense sequence at the opposite arm. In the present study miRNAs were named in two different ways: (i) miR000, when corresponding to a family with two or more miRNA loci and (ii) MIR000, to design a single locus. Finally, precursor candidate sequences were checked using the BLAST algorithm from miRBase (www.mirbase.org).

Validation of miRNA by RT-PCR

In order to validate predicted miRNAs, a series of RT-PCR were performed in RNA isolated from leaves of three individuals of E. uniflora occurring in the Grumari native protected area in Rio de Janeiro, Brazil. Among the analyzed miRNAs seventeen corresponded to conserved miRNAs (eun-MIR156, eun-MIR159, eun-MIR160, eun-MIR166, eun-MIR167-1, eun-MIR167-2, eun-MIR167-3, eun-MIR167-4, eun-MIR395, eun-MIR396-1, eun-MIR396-2, eun-MIR397-1, eun-MIR397-2, eun-MIR482-1, eun-MIR482-2, eun-MIR530, eun-MIR827) and ten were novel miRNAs (eun-MIR001-1, eun-MIR001-2, eun-MIR004-2, eun-MIR005, eun-MIR006, eun-MIR008, eun-MIR009, eun-MIR012, eun-MIR013, eun-MIR014). The stem-loop primer, used for miRNA cDNA synthesis, was designed according to Cheng et al. [28]. The forward miRNAs primers were designed based on the full mature miRNA sequences and the reverse primer was the universal reverse primer for miRNA. The RT-PCR was performed according the conditions used by Kulcheski et al. [29]. Briefly, reactions were completed in a volume of 20 µL containing 10 µL of diluted cDNA (1∶100), 0.025 mM dNTP, 1X PCR Buffer, 3 mM MgCl2, 0.25 U Hot Start Taq DNA Polymerase (Promega) and 200 nM of each reverse and forward primer. Samples were analyzed in biological triplicate in a 96-well plate, and a no-template control was included. The PCR conditions were performed in an ABI 7500 Real-Time PCR System (Applied Biosystems). The PCR products were resolved on a 2% agarose gel and analyzed using Quantity One software (Bio-Rad).

Prediction of miRNA Targets

Previously assembled mRNA contigs were clustered using the Gene Indices Clustering Tools (http://compbio.dfci.harvard.edu/tgi/software/) [30] to reduce any sequence redundancy. The clustering output was passed to the CAP3 assembler [31] for multiple alignment and consensus building. Contigs that did not reach the set threshold and fell into any assembly remained as a list of singletons. The prediction of target genes for the most abundant mature miRNAs from the conserved and novel pre-miRNAs was performed by psRNAtarget [32]. The program uses a 0–5 scale to indicate the complementarity between miRNA and their target, with the smaller numbers representing higher complementary and zero corresponding to a perfect complementation. Default parameters with an expectation value of 4 and E. uniflora assembled unigenes longer than 600 bp were used. Candidate RNA sequences were then annotated by assignment of putative gene descriptions based on sequence similarity with previously identified genes annotated with details deposited in the protein database of NR and the Swiss-Prot/Uniprot protein database using BLASTx implemented in blast2GO v2.3.5 software [33]. The annotation was improved by the analysis of conserved domains/families using the InterProScan tool and Gene Ontology terms as determined by the GOslim tool from blast2GO software. At the same time, the orientations of the transcripts were obtained from BLAST annotations. Finally, to verify if the genes targeted by the identified miRNAs regulate any metabolic pathways involved in the secondary metabolites synthesis, we obtained the enzyme EC numbers for each target gene from the blast2GO annotation. These codes were uploaded to iPATH2 server [34] to generate metabolic pathway maps.

Results

E. uniflora RNA Library Sequencing

To identify conserved and novel miRNAs in E. uniflora, sRNA library was constructed from leaves and sequenced using Solexa high-throughput technology. After removing low quality sequences, those without inserts, or those with adapter contaminants or lengths outside of the 18–25 nt range, a total of 14,849,131 reads were obtained (Table 1). The number of reads with different lengths in the redundant and non-redundant sRNA datasets is shown in Figure 1 and Table S1. The most abundant sRNA species contained 21 nt, whereas the highest sequence diversity was observed in the 24-nt fraction. Approximately 6.55% of the reads matched other types of non-coding sRNAs, such as rRNAs, tRNAs, snRNAs or snoRNAs, and 9.45% matched organellar DNA (Table 2).
Table 1

Summary of data from sequencing of E. uniflora small RNA library.

TypeNumber of readsPercentage (%)
Total reads* 14,849,131100
18–25 nt12,759,50686
<18 nt1,554,97510
>25 nt534,6504

Reads with high quality with lenghts of 1 to 44 nt.

Figure 1

Length distribution and diversity of small RNA reads in the E. uniflora leaf library.

Table 2

Categorization of E. uniflora noncoding and organellar small RNAs*.

Small RNA typeNumber of readsPercentage (%)
miRNA1,852,72214.52%
rRNA765,9896.00%
tRNA67,4910.53%
snRNA1,5550.01%
snoRNA8590.01%
mtRNA159,1061.25%
cpRNA1,046,3058.20%
Other sRNA8,865,47969.48%

18–25 nt reads considered.

Reads with high quality with lenghts of 1 to 44 nt. As there is no genome sequence available for E. uniflora, we sequenced the mRNA transcriptome of the E. uniflora leaf for use as a reference sequence in further analyses. The pooled mRNA-seq yielded 16,759,528 reads, which were imported into the CLC Genomics Workbench and de novo assembled into 170,568 contigs with an average length of 306 bp. Contigs and non-assembled reads with minimum lengths of 100 bp were further considered. The contigs ranged in size between the minimum set threshold of 100 bp and 7,808 bp (N50 = 447 bp), with 22,308 contigs more than 500 bp in length. 18–25 nt reads considered.

Identification of Conserved miRNAs in E. uniflora

There are 4,677 miRNAs from 47 Magnoliophyta species deposited in miRBase. To identify conserved miRNAs in E. uniflora, the small RNA library was matched against a set of 2,585 unique, mature plant miRNA sequences from the database. In total, 1,852,722 reads perfectly matched 204 known miRNAs (Figure 2 and Table S2). All identified sequences are distributed in 45 miRNA families, with an average of approximately 4 miRNA members per family. The largest family was miR166 with 21 members, which include isoforms found in several plant species. The miR156 (19 members), miR396 (15 members) and miR395 (14 members) families were the second, third and fourth largest miRNA families, respectively. Of the remaining miRNA families, 23 contained 2 to 10 members, and 18 were represented by a single member (Figure 2).
Figure 2

Number of identified miRNAs in each conserved miRNA family in plants.

The values above the bars indicate the number of members identified in each conserved miRNA family.

Number of identified miRNAs in each conserved miRNA family in plants.

The values above the bars indicate the number of members identified in each conserved miRNA family. With respect to the abundance of each miRNA family, the frequencies varied from 1 read (7 families) to 656,093 reads (miR167), indicating that expression varies significantly among different miRNA families. This relative abundance is also observed in certain members from the same family. For example, the abundance of miR167 varied from 98 to 616,862 reads, as was the case for some other families, such as miR166 (1 to 381,733 reads), miR159 (2 to 235,279 reads) and miR396 (2 to 217,485 reads). These results indicate that different members have variable expression levels within one miRNA family. Since the genome of E. uniflora is not publically available, the small RNA library was matched against a set of de novo assembled contigs from the E. uniflora leaf RNA-seq to identify putative miRNA precursor sequences. Candidate sequences with hairpin-like structures and mature miRNAs anchored in either or both of the 5p or 3p arms were further considered (Figure S2). Initial analysis allowed for the identification of 25 precursor sequences grouped into 15 conserved families (Table 3). The average value of MFE was -66.51 in these precursors and included two precursors (MIR167-2 and MIR169) with extreme values due to their long sizes. With respect to the % GC and MFEI, the average values were 47.63 and −0.94, respectively.
Table 3

Pre-miRNAs identified in E. uniflora with sequence similarities to plant conserved miRNA families.

miRNAPrecursor miRNAMature miRNA
Contig codeLengthGC %MFEAMFEMFEI5p sequence more abundantRead count3p more abundant sequenceRead countTotal reads
eun-MIR156Contig928899754.64−55.20−56.91−1.04 TTGACAGAAGATAGAGAGCAC 83933 GCTCTCCCTCTCCTGTCAACA 185396
eun-MIR159Contig9324516345.40−55.86−34.27−0.75 AGCTGCTGGTCTATGGATCCC 376 CTTGCATATGCCAGGAGCTTC 4931302
eun-MIR160Contig8181611653.45−54.30−46.81−0.88 TGCCTGGCTCCCTGTATGCCA 293 GCGTATGAGGAGCCAAGCATA 22323
eun-MIR162Contig16540010848.15−35.80−33.15−0.69 GGAGGCAGCGGTTCATCGATC 24 TCGATAAACCTCTGCATCCAG 1071310884
eun-MIR166Contig9422322843.42−72.40−31.75−0.73 GGAATGTTGTCTGGCTCGAGG 11016 TCGGACCAGGCTTCATTCCCC 381733409546
eun-MIR167-1Contig1263509045.56−50.00−55.56−1.22 TGAAGCTGCCAGCATGATCTGA 616862 AGATCATCTGGCAGTTTCAAC 262620306
eun-MIR167-2Contig16348761537.40−163.60−26.60−0.71 TGAAGCTGCCAGCATGATCTGG 32188 TCAGGTCATCTTGCAGCTTCA 93934461
eun-MIR167-3Contig784s8148.15−38.60−47.65−0.99 TGAAGCTGCCAGCGTGATCTCA 16305 ATCAGATCATGTGGCAGCTTCACC 7322056
eun-MIR1674Contig784a8148.15−38.70−47.78−0.99 TGAAGCTGCCACATGATCTGA 71ND72
eun-MIR169Contig14208873039.18−160.80−22.03−0.56 TTATAGGCGATTGGAGGTATG 876 TTAGCTAAAGTCGTCTTGCCCA 68188961
eun-MIR172-1Contig8380212247.54−55.10−45.16−0.95 CAGGTGTAGCATCATCAAGAT 36 AGAATCTTGATGATGCTGCAT 4951076
eun-MIR172-2Contig1135679242.39−39.70−43.15−1.02 GCAGCATCATCAAGATTCACA 12 AGAATCTTGATGATGCTGCAT 495523
eun-MIR172-3Contig8592816543.64−71.20−43.15−0.99 GTAGCATCATCAAGATTCACA 33 AGAATCTTGATGATGCTGCAT 4951048
eun-MIR395Contig1147178851.14−47.50−53.98−1.06 TCCCCTAGAGTTCTCCTGAACA 107 ATGAAGTGTTTGGGGGAACTC 13561659
eun-MIR396-1Contig9438816042.50−68.60−42.88−1.01 TTCCACGGCTTTCTTGAACTG 217485 GTTCAATAAAGCTGTGGGAAG 2028223828
eun-MIR396-2Contig15330812842.19−49.10−38.36−0.91 TTCCACAGCTTTCTTGAACTG 23061 GTTCAAGCTAGCTGTGGGAAG 1298164439
eun-MIR397-1Contig87345s12651.59−68.80−54.60−1.06 TCATTGAGTGCAGCGTTGAT 626 CGGTTTCGACAGCGCTGCACT 591052
eun-MIR397-2Contig87345a12651.59−63.20−50.16−0.97 TGCAGCGCTGTCGAAACCGAT 20 TCAACGCTGCACTCAATGATG 273322
eun-MIR482-1Contig8844515353.90−94.60−61.43−1.14 CATGGGTTGTTTGGTGAGAGG 24202 TCTTGCCAATACCACCCATGCC 70833100235
eun-MIR482-2Contig8844513953.96−71.00−51.08−0.95 GAAATGGGAGGGTGGGAAAGA 982 TTTCCTATTCCTCCCATTCCAT 33715574
eun-MIR482-3Contig8506516950.89−92.40−54.67−1.07 GAGATTCGAGCTACCGGAAGTTGTG 329 TTCCCAAGGCCGCCCATTCCGA 1491517039
eun-MIR530Contig1875018351.37−82.30−44.97−0.88 TCTGCATTTGCACCTGCACCT 185 AGGTGCGGGTGCAGGTGCAGA 12280
eun-MIR535-1Contig6809410250.00−42.60−41.76−0.84 TGACAACGAGAGAGAGCACGC 62562 GTGCTCTCTATCGCTGTCATA 419976334
eun-MIR535-2Contig7180310049.00−47.00−47.00−0.96 TGACAACGAGAGAGAGCACGC 62562 TGCTCTCTACCGTTGTCATG 11672263
eun-MIR827Contig939288145.68−44.30−54.69−1.20 CTTTGTTGATGGCCATCTAATC 27 TTAGATGACCATCAGCGAACA 266304

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected.

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected. Within the identified families, MIR167 was the most abundant, with 676,895 reads, and contained 4 members (MIR167-1, MIR167-2, MIR167-3 and MIR167-4). In addition, several miRNA isoforms were detected in the libraries, and several of these were more abundant than the known miRNAs reported in miRBase for other plants (Figure 3). Furthermore, in the family MIR397, one precursor was identified with a typical structure and mature reads in the sense and antisense orientations. Both orientations were considered two independent precursors from the same family for the following analysis.
Figure 3

Predicted secondary structures of conserved and novel miRNAs of E. uniflora.

Secondary structures of the precursors eun-MIR535-1 and eun-nMIR012, their locations and the expression of small RNAs mapped onto these precursors. Sequences of the most abundant mature miRNAs in the 5p and 3p arms are labeled in purple and red, respectively. Values on the left side of the miRNA sequence represent read counts in the leaf library.

Predicted secondary structures of conserved and novel miRNAs of E. uniflora.

Secondary structures of the precursors eun-MIR535-1 and eun-nMIR012, their locations and the expression of small RNAs mapped onto these precursors. Sequences of the most abundant mature miRNAs in the 5p and 3p arms are labeled in purple and red, respectively. Values on the left side of the miRNA sequence represent read counts in the leaf library.

Identification of Novel miRNAs in E. uniflora

Using the previously described criteria in the identification of conserved pre-miRNAs, we obtained another 17 potential miRNA candidates grouped into 15 families (Table 4). In addition to the hairpin structure, the detection of miRNA* in 14 precursors is a strong indication to consider these miRNAs as true candidates. Comparisons among the mature sequences of candidate miRNAs and those miRNAs deposited in miRBase suggest that these candidates are novel miRNAs that have not been identified in others species and are possibly specific to the Myrtaceae family. These novel miRNAs displayed an average negative folding value of −137.89, which included 4 miRNAs with long sizes similarly observed in some previously identified conserved pre-miRNAs. With respect to the % GC and MFEI, the average values were 42.86 and −1.05, respectively. In addition, one novel pre-miRNA was found with mature sequences in the sense and antisense orientations and was considered to represent 2 members of the same family (nMIR001-1 and −2).
Table 4

New putative miRNA precursors identified in E. uniflora.

miRNAPrecursor miRNAMature miRNA
Contig nameLengthGC %MFEAMFEMFEI5p more abundant sequenceRead count3p more abundant sequenceRead countTotal reads
eun-nMIR001-1Contig164780s82054.39−451.70−55.09−1.01 TCGGCTGTCAATTTCTGGATT 185919 ATCCAGAAATTGGCAGCCGTT 110192103
eun-nMIR001-2Contig164780a82054.39−446.00−54.39−1.00 CAATTTCTGGATTTCAGTTCG 20 TCGAACTGAAATCCAGAAATT 263
eun-nMIR002Contig2978517330.06−56.70−32.77−1.09 CGAAAAATGATTGGTTGTATCGCT 18 CGATCTAATCAATCATTTTTCGGG 221
eun-nMIR003Contig12110011048.18−63.20−57.45−1.19 TACTCGTTCCGTTGATCCATC 88 TGGATCAATAGAACGAGCAGGTGA 157561
eun-nMIR004-1Contig37387s10429.81−47.10−45.29−1.52 TCGTAAATCCACTATATCTCT 3 TAGATATAGTGGATTTTCGAT 913
eun-nMIR004-2Contig37387a10429.81−46.40−44.62−1.50ND CAGAGATATAGTGGATTTACG 314385
eun-nMIR005Contig14356310634.91−21.40−20.19−0.58ND GAGAATGATGAGTTAAATGGA 1230
eun-nMIR006Contig11361711333.63−42.70−37.79−1.12 TCTCTGTTGATCTGATAAATA 19 TTTGTCGGATGAACAGGGAAT 1855
eun-nMIR007Contig116664r9646.88−55.80−58.13−1.24 TAGGGTCAGATCGCTACTTAG 211 TAAGTGGTGATCTGACTCTAA 44465750
eun-nMIR008Contig7971642643.66−228.00−53.52−1.23 TCGAGCCCCTCCCACAGATTG 313 ATCTGTGGAAGAGACTCGACT 840313617
eun-nMIR009Contig81320154537.41−397.90−25.75−0.69 TTCAAGTCTAACAACCTCAGCT 5774 TGGAGGTTGTTTGGCTTGAGCT 196811577
eun-nMIR010Contig8424835048.86−143.30−40.94−0.84 TGCTGTTCTTCCGTTCACGAAT 309 TCGTGAAGGAAGAATGTGCAAT 634010307
eun-nMIR011Contig16455920751.21−98.70−47.68−0.93 GCTCGAGGTCAGTTTGTCGCC 1553 CGGCAAACTGGACCTCGAGATC 1102884
eun-nMIR012Contig16795716435.98−91.80−55.98−1.56 CATGTAACAAGTTGGCTGTCA 126 TTCATGGACAGCCAGCTTATT 3243
eun-nMIR013Contig8766517956.42−84.90−47.43−0.84 TGAAGCAGATCAAGAACCCAG 155 TCTCGTTCCGCTTCATCTGAA 2172
eun-nMIR014Contig200629r8755.17−23.40−26.90−0.49ND GCATCACTAGCTTACGCTCTG 30159
eun-nMIR015Contig16588612437.90−45.10−36.37−0.96ND CAATGAACGCATTTGCAGGTG 2122

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected.

MFE: minimal folding free energy (kcal/mol); AMFE: Adjusted MFE; MFEI: minimal folding free energy index; ND: no detected.

Biological Confirmation of Identified miRNAs in E. uniflora

The stem-loop RT-PCR method was used to validate the expression of seventeen conserved miRNAs (eun-MIR156, eun-MIR159, eun-MIR160, eun-MIR166, eun-MIR167-1, eun-MIR167-2, eun-MIR167-3, eun-MIR167-4, eun-MIR395, eun-MIR396-1, eun-MIR396-2, eun-MIR397-1, eun-MIR397-2, eun-MIR482-1, eun-MIR482-2, eun-MIR530, eun-MIR827) and ten novel miRNAs (eun-MIR001-1, eun-MIR001-2, eun-MIR004-2, eun-MIR005, eun-MIR006, eun-MIR008, eun-MIR009, eun-MIR012, eun-MIR013, eun-MIR014). We confirmed that these miRNAs were expressed in three different individuals collected in situ (Figure S3).

Identification and Classification of miRNA Targets

To understand the biological function of miRNAs in E. uniflora, the putative mRNA target sites of miRNA candidates were identified by aligning the most abundant mature miRNAs of each conserved and novel precursor to a set of E. uniflora assembled unigenes using psRNA target with default parameters and a maximum expectation value of 4. We found 87 potential targets in total, where 52 were targets of conserved miRNAs and 35 were targets of novel miRNAs, with an approximate average of 3 targets per miRNA. Detailed annotation results are given in Table 5 and S3.
Table 5

Predicted targets of novel miRNAs in E. uniflora.

miRNAInhibitionScore* Putative Function
eun-nMIR001Cleavage1.5Atp-dependent helicase rhp16-like
Cleavage3Cytochrome p450
Cleavage3.5Long chain acyl- synthetase 9
Cleavage3.5Kinesin-related protein
Translation3Transcription initiation factor iib
Translation3Brassinazole-resistant 1
Translation3.5Myosin family protein with dil domain
eun-nMIR002Cleavage3Serine threonine-protein phosphatase 2a regulatory subunit b subunit alpha-like
Cleavage3.5Probable receptor-like protein kinase at1g67000-like
eun-nMIR003Cleavage4Udp-glycosyltransferase 74b1
eun-nMIR004Cleavage2.5Auxin efflux carrier protein
Cleavage3.5Sucrose nonfermenting 4-like
Translation3.5Type i inositol- -trisphosphate 5-phosphatase 2-like
eun-nMIR005Translation3Pentatricopeptide repeat-containing protein
Cleavage3.5Protein reticulata-related 1
Cleavage3.5Agenet domain-containing protein
eun-nMIR006Translation3.5Outward rectifying potassium channel
eun-nMIR007Cleavage3.5Aspartate semialdehyde
Cleavage3Primary-amine oxidase
eun-nMIR008Translation3.5Adenosine deaminase
eun-nMIR009Cleavage3Cc-nbs-lrr resistance protein
eun-nMIR010Translation4P8mtcp1
Cleavage4Nbs-lrr resistance protein
Translation4Cullin-1-like isoform 1
eun-nMIR011Translation3E3 ubiquitin-protein ligase upl7
Cleavage3.5Eukaryotic peptide chain release factor subunit 1-1
eun-nMIR012Translation3.5Tho complex subunit 2
eun-nMIR013Translation3.5Beta-amylase
Translation3.5Integral membrane single c2 domain protein
eun-nMIR014Cleavage0Ycf68 protein
eun-nMIR015Cleavage3.5Rna-binding motif x-linked 2
Cleavage3.5Transducin wd-40 repeat-containing protein
Cleavage3.5Clip-associating protein
Cleavage3.5Probable exocyst complex component 4-like
Cleavage3.5Photosystem i p700 apoprotein a1

psRNATarget value.

psRNATarget value. Among the most important miRNA targets, also previously identified in other plants, we found the squamosa promoter binding protein (SBP)-like (SPL) genes, which are targets of the miR156 family and have functions that are conserved across plant species [17], affecting diverse developmental processes, such as leaf development, shoot maturation, phase change and flowering in plants [35]-[40]. We also identified the auxin response factor (ARF), a plant-specific family of DNA binding proteins involved in hormone signal transduction that are targets for the miRNA families miR167 and miR160 [15], [41], [42]. Another important gene identified and targeted by miR162, with a significant role in the regulation of gene expression, is the pentatricopeptide repeat gene (PPR). This gene belongs to a large family implicated in post-transcriptional processes, such as splicing, editing, processing and translation specifically in organelles like mitochondria and chloroplasts [43]. These results substantiate the in silico identification of conserved and novel targets from E. uniflora. All targets regulated by the conserved and novel miRNAs identified in this study were subjected to GO analysis to evaluate their potential functions. The categorization of these genes, according to biological processes, cellular components and molecular functions, is summarized in Figure 4. Based on biological processes, these targets were classified into 13 categories, and the three most overrepresented GO terms, either for conserved or novel miRNAs, were cellular processes, metabolic processes and responses to stimulus, suggesting that Eugenia miRNAs are involved in a broad range of physiological functions. Categories based on molecular function revealed that the target genes were related to 7 functions, and the four most frequent terms were protein binding, nucleotide binding, hydrolase activity and nucleic acid binding. In the category of cellular components, the analysis revealed that the protein products from the genes targeted by conserved and novel miRNAs are expressed mainly in the plastid and nucleus.
Figure 4

Gene categories and the distribution of target genes of the most abundant mature miRNAs in the conserved and novel pre-miRNA identified in E. uniflora.

The iPATH2 server was used to produce an overview of the metabolic pathways involved in the secondary metabolites synthesis and potentially regulated by miRNAs in E. uniflora. Our results showed that three enzymes involved in several types of metabolism and secondary metabolites are regulated by identified miRNAs (Figure S4). The phosphoglycerate mutase is a potential target of eun-MIR396-2 and is involved in the pathway of gluconeogenesis while the hydroxyphenylpyruvate reductase is targeted by eun-MIR162 and is involved in terpenoid-quinone, tropane, pireridine and pyridine biosynthesis. In a similar way, eun-nMIR007 regulates primary-amine oxidase, an enzyme involved in the tropane, pireridine, pyridine and isoquinoline alkaloid biosynthesis.

Discussion

Though several miRNAs have been identified via computational or experimental approaches in different plant families, there is no sequence or functional information available about miRNAs in any Myrtaceae species, which are economically important in the spice, fruit, timber and pharmacology industries [44]. We used Solexa technology for deep sequencing of a small RNA library to identify miRNAs in E. uniflora. The length distribution pattern obtained indicates that the majority of the redundant small RNAs from the library were 21 nt in length, which is atypical because 24 nt is the most abundant size produced by DCL3 in other plants [45]. This distribution pattern is similar to those observed in previous reports of plant small RNA sequencing using Solexa technology, such as wheat [46], grapevine [47], melon [48] and trifoliate orange [49], suggesting that the composition of the small RNA population varies among species. Additionally, other important causes for this variation include the developmental stage and environmental conditions in which the sample was collected. Contrary to the results observed with the redundant sequences, the analysis of the unique sequences showed that 24 nt was the dominant read length in comparison to all other sequence lengths, and similar results have been observed in other studies [50]-[53]. Small RNAs of 24 nt in length are known to be involved in heterochromatin transcriptional silencing in genomes with a high content of repetitive sequences [54], indicating the possible genome complexity of E. uniflora. In this study, we compared our small RNA library from E. uniflora against known plant miRNAs from the miRBase database and identified 204 conserved miRNAs from different species grouped into 45 families. High throughput sequencing, which has the ability to generate millions of small RNA sequences, is a powerful tool to estimate expression profiles of miRNA. This technology provides the resources to determine the abundance of various miRNA families and even distinguish among different members of a given family. In our case, we found significant differences among the number and abundance of the members identified in each family, which is in agreement with previous studies [48], [55], [56] and suggests that this wide variation is due to a functional divergence in the conserved miRNA families. Although conserved miRNAs have been identified by sequencing and comparison against miRNAs from other species, most plant species-specific miRNAs remain unidentified due to their lower levels of expression, which result in a small number of sequenced reads in comparison to the conserved miRNAs [57]. For this reason, we used a new approach to identify novel miRNAs in species where genomic data and resources were not available. We made use of simultaneous sequence comparison of small RNA and RNAseq libraries. Using this methodology, we identified 17 potential miRNA candidates specific for E. uniflora. From these, 14 contained complementary antisense miRNA, which provided more evidence for their existence as novel miRNAs, as observed in cucumber [51] and grapevine [53]. The other miRNAs that do not satisfy this last criterion require further investigation for their confirmation as miRNAs. To understand the function of the identified miRNAs, their putative targets were predicted using a bioinformatics approach. Several identified targets of conserved miRNAs of E. uniflora are transcriptional factors, similar to the results reported in other studies [47], [48], [58], [59]. In the case of the novel miRNA targets, we found that the transcription initiation factor iib and the pentatricopeptide repeat-containing proteins are targeted by eun-nMIR001 and eun-nMIR005, respectively. It has been reported in Arabidopsis that regulation of ARF17 by miR160 is important for growth and development [60], regulation of ARF6 and 8 by miR167 is important for development of anthers and ovules [61] and regulation of ARF10 and 16 by miR160 plays a role in root cap formation [62]. In the present study, we found that ARF17 is regulated by eun-MIR160 while other members of ARF family were not targeted by eun-MIR167. This discrepancy agrees with the previously reported in Arabidopsis because we used a leaf transcriptome as reference for the target identification. We confirm this observation not found homologs for AtARF6, 8, 10 and 16 by BLASTx in E. uniflora transcriptome. In addition, with the analysis of GO terms, we identified 3 candidate targets likely involved in the response to abiotic stress: ATP-dependent helicase rhp16-like (eun-nMIR002), sucrose nonfermenting 4-like (eun-nMIR004) and serine threonine-protein phosphatase 2a regulatory subunit b'' subunit alpha-like (eun-nMIR002). The sucrose nonfermenting 4-like (SNF4) protein is a subunit of the probable trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants [63]. Otherwise, the serine threonine-protein phosphatase 2A regulatory subunit b ''subunit alpha-like PP2Ab′′ is a structural subunit of the Ser/Thr phosphatases holoenzyme (PP2A) and recent studies suggesting the possible physiological role of PP2A in the drought stress response [64]. These results indicated that the targets from novel miRNAs identified here are possibly related to the adaptation of E. uniflora to different types of stress and environmental conditions observed in natura. Future experimental validation will determine how many of these predicted targets are genuinely targeted by miRNAs in specific environmental and physiological conditions. Interestingly, we found three miRNAs involved in the regulation of enzymes that play critical roles in secondary metabolites synthesis. These findings suggest that variation in the levels of expression of these miRNAs could alter the levels of production of certain types of secondary metabolites. It is consistent with the previous reports that the concentration of these metabolites varies between specimens of E. uniflora from different geographical locations [2], [3]. More studies are necessary to confirm these preliminary findings and evaluate the correlation between the miRNA expression and secondary metabolite production.

Conclusions

In summary, this study provides the first view of the diversity of miRNAs and their abundance in Myrtaceae and strongly supports the idea that miRNAs play an important conserved role in several physiological processes, as previously proposed for other plants. Our bioinformatics analysis indicates that miRNAs might contribute to different processes by affecting multiple target genes and different signaling pathways. Although the exact function of these miRNA target genes remains to be confirmed, we believe the present study provides novel insights into the molecular processes involved in conserved miRNA function. Flow chart of procedures for miRNA identification. (TIF) Click here for additional data file. Represetation of the predicted secondary structures of the conserved and novel miRNA precursors of and the locations of the more abundant mature miRNAs. (PDF) Click here for additional data file. Detection of miRNA expression in different individuals by RT-PCR. Products generated by stem-loop RT-PCR were resolved on a 2% agarose. Leaf samples from three independent Eugenia uniflora trees were used to evaluate the presence of each miRNA. (TIFF) Click here for additional data file. iPath secondary metabolite map showing the different pathways where are involved each evaluated enzyme. Each grey dot represents a metabolite and each colored line represents the different route affected by the enzyme targeted. In red: phosphoglycerate mutase (regulated by eun-MIR396-2). In blue: primary-amine oxidase (regulated by eun-nMIR007). (TIFF) Click here for additional data file. Length distribution and read sequence abundance in the small RNA library. (XLS) Click here for additional data file. Abundance of predicted plant conserved miRNAs in the small RNA library of . (XLS) Click here for additional data file. Predicted transcript targets of plant conserved miRNAs in . (XLS) Click here for additional data file.
  58 in total

1.  Improving effects of the extracts from Eugenia uniflora on hyperglycemia and hypertriglyceridemia in mice.

Authors:  I Arai; S Amagaya; Y Komatsu; M Okada; T Hayashi; M Kasai; M Arisawa; Y Momose
Journal:  J Ethnopharmacol       Date:  1999-12-15       Impact factor: 4.360

Review 2.  Small RNA-mediated epigenetic modifications in plants.

Authors:  Stacey A Simon; Blake C Meyers
Journal:  Curr Opin Plant Biol       Date:  2010-12-13       Impact factor: 7.834

Review 3.  microRNA functions.

Authors:  Natascha Bushati; Stephen M Cohen
Journal:  Annu Rev Cell Dev Biol       Date:  2007       Impact factor: 13.827

4.  SOAP2: an improved ultrafast tool for short read alignment.

Authors:  Ruiqiang Li; Chang Yu; Yingrui Li; Tak-Wah Lam; Siu-Ming Yiu; Karsten Kristiansen; Jun Wang
Journal:  Bioinformatics       Date:  2009-06-03       Impact factor: 6.937

5.  A wheat (Triticum aestivum) protein phosphatase 2A catalytic subunit gene provides enhanced drought tolerance in tobacco.

Authors:  Chongyi Xu; Ruilian Jing; Xinguo Mao; Xiaoyun Jia; Xiaoping Chang
Journal:  Ann Bot       Date:  2007-02-01       Impact factor: 4.357

Review 6.  The evolution of RNA editing and pentatricopeptide repeat genes.

Authors:  Sota Fujii; Ian Small
Journal:  New Phytol       Date:  2011-05-09       Impact factor: 10.151

7.  Tablet--next generation sequence assembly visualization.

Authors:  Iain Milne; Micha Bayer; Linda Cardle; Paul Shaw; Gordon Stephen; Frank Wright; David Marshall
Journal:  Bioinformatics       Date:  2009-12-04       Impact factor: 6.937

Review 8.  Small RNAs and developmental timing in plants.

Authors:  R Scott Poethig
Journal:  Curr Opin Genet Dev       Date:  2009-08       Impact factor: 5.578

9.  Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis.

Authors:  Vitantonio Pantaleo; Gyorgy Szittya; Simon Moxon; Laura Miozzi; Vincent Moulton; Tamas Dalmay; Jozsef Burgyan
Journal:  Plant J       Date:  2010-06-01       Impact factor: 6.417

10.  'Evidence of an auxin signal pathway, microRNA167-ARF8-GH3, and its response to exogenous auxin in cultured rice cells'.

Authors:  Ji Hyun Yang; So Jeong Han; Eun Kyung Yoon; Woo Sung Lee
Journal:  Nucleic Acids Res       Date:  2006-04-05       Impact factor: 16.971

View more
  13 in total

Review 1.  Trans-acting small interfering RNA4: key to nutraceutical synthesis in grape development?

Authors:  Christopher D Rock
Journal:  Trends Plant Sci       Date:  2013-08-28       Impact factor: 18.313

2.  Repetitive genomic elements in Campomanesia xanthocarpa: prospection, characterization and cross amplification of molecular markers.

Authors:  Vanessa S Petry; Valdir Marcos Stefenon; Lilian O Machado; Gustavo H F Klabunde; Fábio O Pedrosa; Rubens O Nodari
Journal:  3 Biotech       Date:  2019-10-28       Impact factor: 2.406

3.  MicroRNA dynamics in a wild and cultivated species of Convolvulaceae exposed to drought stress.

Authors:  Vallabhi Ghorecha; Yun Zheng; Li Liu; Ramanjulu Sunkar; N S R Krishnayya
Journal:  Physiol Mol Biol Plants       Date:  2017-03-14

4.  High-throughput sequencing analysis of Eugenia uniflora: insights into repetitive DNA, gene content and potential biotechnological applications.

Authors:  Valdir Marcos Stefenon; Deise Schröder Sarzi; Luiz Fernando Würdig Roesch
Journal:  3 Biotech       Date:  2019-05-03       Impact factor: 2.406

Review 5.  Tools for visualization and analysis of molecular networks, pathways, and -omics data.

Authors:  Jose M Villaveces; Prasanna Koti; Bianca H Habermann
Journal:  Adv Appl Bioinform Chem       Date:  2015-06-04

6.  Identification and characterization of Wilt and salt stress-responsive microRNAs in chickpea through high-throughput sequencing.

Authors:  Deshika Kohli; Gopal Joshi; Amit Atmaram Deokar; Ankur R Bhardwaj; Manu Agarwal; Surekha Katiyar-Agarwal; Ramamurthy Srinivasan; Pradeep Kumar Jain
Journal:  PLoS One       Date:  2014-10-08       Impact factor: 3.240

7.  Identification of novel and conserved microRNAs in Coffea canephora and Coffea arabica.

Authors:  Guilherme Loss-Morais; Daniela C R Ferreira; Rogério Margis; Márcio Alves-Ferreira; Régis L Corrêa
Journal:  Genet Mol Biol       Date:  2014-11-03       Impact factor: 1.771

8.  A Review of Computational Tools in microRNA Discovery.

Authors:  Clarissa P C Gomes; Ji-Hoon Cho; Leroy Hood; Octávio L Franco; Rinaldo W Pereira; Kai Wang
Journal:  Front Genet       Date:  2013-05-15       Impact factor: 4.599

9.  Identification and comparative analysis of the Tegillarca granosa haemocytes microRNA transcriptome in response to Cd using a deep sequencing approach.

Authors:  Yongbo Bao; Lili Zhang; Yinghui Dong; Zhihua Lin
Journal:  PLoS One       Date:  2014-04-01       Impact factor: 3.240

10.  Identifying microRNAs and transcript targets in Jatropha seeds.

Authors:  Vanessa Galli; Frank Guzman; Luiz F V de Oliveira; Guilherme Loss-Morais; Ana P Körbes; Sérgio D A Silva; Márcia M A N Margis-Pinheiro; Rogério Margis
Journal:  PLoS One       Date:  2014-02-13       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.