| Literature DB >> 23109844 |
Yingchun Miao1,2, Xuedong Lang2, Shuaifeng Li2, Jianrong Su2, Yuehua Wang1.
Abstract
Cephalotaxus oliveri is a scarce medicinal conifer endemic to the south central region of China and Vietnam. A small fragmented population presently exists due to anthropogenic disturbance. C. oliveri has been used for its alkaloids harringtonine and homoharringtonine, which are effective against leucocythemia and lymphadenosarcoma. Monoecious plants have been detected in nature, although they were understood to be dioecious. In order to study the mating system, population genetics and the genetic effects of habitat fragmentation on C. oliveri, 15 polymorphic and 12 monomorphic microsatellite loci were developed for C. oliveri by using the Fast Isolation by AFLP of Sequences Containing repeats (FIASCO) protocol. The polymorphisms were assessed in 96 individuals from three natural populations (32 individuals per population). The number of alleles per locus ranged from two to 33, the observed and expected heterozygosity per locus ranged from 0.000 to 1.000 and from 0.000 to 0.923, respectively. These loci would facilitate a comprehensive understanding of the genetic dynamics on C. oliveri, which will be useful for establishing effective conservation strategies for this species.Entities:
Keywords: Cephalotaxus oliveri; FIASCO; PCR amplification; microsatellite loci
Mesh:
Substances:
Year: 2012 PMID: 23109844 PMCID: PMC3472736 DOI: 10.3390/ijms130911165
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Characteristics of 15 polymorphic and 12 monomorphic microsatellite loci for Cephalotaxus oliveri.
| Locus | Primer sequences(5′-3′) | Repeat motif | Size range (bp) | GenBank accession No. | |
|---|---|---|---|---|---|
| CO1 | F: GTTTACATTGGAGCCAGTCA | (AC) | 173–225 | 51 | JQ902141 |
| CO2 | F: GCAACTCATTTGAAGCATCG | (GA) | 235–247 | 61 | JQ902142 |
| CO3 | F: TCCTAAATTGAGCCTCTGTG | (TG) | 355–359 | 51 | JQ902143 |
| CO4 | F: TCAGGCTTTAGATCTTGGAATGT | (GA) | 257–261 | 49 | JQ902144 |
| CO5 | F: CACTGGTGGTTTGCTTGC | (TG) | 170–188 | 49 | JQ902145 |
| CO6 | F: CATCTTTTCATAGTTGTCTGC | (GT) | 137–141 | 55 | JQ902146 |
| CO7 | F: GAGGAGGTTCAAGGTGGTCT | (AC) | 229–423 | 66 | JQ902147 |
| CO8 | F: AATTTATTATGAAGGATAGGG | (AC) | 81–137 | 49 | JQ902148 |
| CO9 | F: CACAACTCGCAAGAGGTAAA | (CT) | 174–236 | 61 | JQ902149 |
| CO10 | F: AAGAAGAGCAGGTTTGACAT | A | 139–143 | 61 | JQ902150 |
| CO11 | F: TCATGGGCGCATTAGGAC | (CA) | 230–338 | 64 | JQ902151 |
| CO12 | F: CCAAGTGACCATTCCACCAA | (TC) | 183–191 | 61 | JQ902152 |
| CO13 | F: GTGCCCTCATACCCATTCTA | (AG) | 161–173 | 64 | JQ902153 |
| CO14 | F: ATCCTGAGTCCCTGTATGTT | (AG) | 235–293 | 55 | JQ902154 |
| CO15 | F: TCCAAGGATGCACATTCAAT | (AC) | 262–316 | 58 | JQ902155 |
| CO16 | F: TTACAAATCAACCACCCC | (GTG) | 280 | 58 | JQ902156 |
| CO17 | F: ACCTAAGGGTGCTTGGAGATA | (AG) | 304 | 61 | JQ902157 |
| CO18 | F: AGACAATCAACAAGCATACAC | (GA) | 385 | 61 | JQ902158 |
| CO19 | F: AAAACCCAAACAGTGGAAACA | (AC) | 128 | 58 | JQ902159 |
| CO20 | F: TACTAAAACAACTCATTGGAAAC | (CT) | 221 | 49 | JQ902160 |
| CO21 | F: ATTGGTGGAAGACCCTAGAAGA | (AG) | 235 | 61 | JQ902161 |
| CO22 | F: AAATATGGAAGAATGGTGATC | (AG) | 150 | 49 | JQ902162 |
| CO23 | F: GATGAAGGCACGGGAAAC | (TTTTG) | 264 | 49 | JQ902163 |
| CO24 | F: GGCTTCGGAAGACTACCTT | (AG) | 165 | 55 | JQ902164 |
| CO25 | F: AAAGGCAACATGCTATCAAAT | (GAA) | 261 | 58 | JQ902165 |
| CO26 | F: AGGGCTATGCTTTGGATGT | (GAG) | 288 | 58 | JQ902166 |
| CO27 | F: ATTCTTTGTTGGTCCGTTTA | (GAA) | 175 | 53 | JQ902167 |
Ta, annealing temperature.
Genetic characterization of 15 polymorphic microsatellite loci in three natural populations of Cephalotaxus oliveri.
| DZ population ( | PB population ( | LX population ( | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
| ||||||||||||||
| HWE | HWE | HWE | ||||||||||||||
|
|
|
| ||||||||||||||
| Locus | ||||||||||||||||
| CO1 | 22 | 13 | 0.139 | 0.607 | 0.897 | 0.0011 | 13 | 0.080 | 0.750 | 0.912 | 0.0078 n.s. | 8 | 0.004 | 0.469 | 0.476 | 0.5689 n.s. |
| CO2 | 6 | 4 | 0.249 | 0.188 | 0.609 | 0.0011 | 5 | 0.280 | 0.125 | 0.605 | 0.0011 | 5 | 0.177 | 0.313 | 0.619 | 0.0011 |
| CO3 | 2 | 2 | 0.120 | 0.000 | 0.092 | 0.0156 n.s. | 1 | 0.001 | - | - | - | 1 | 0.001 | - | - | - |
| CO4 | 3 | 3 | 0.000 | 0.844 | 0.601 | 1.0000 n.s. | 3 | 0.000 | 0.688 | 0.516 | 1.0000 n.s. | 3 | 0.000 | 0.750 | 0.566 | 1.0000 n.s. |
| CO5 | 5 | 3 | 0.000 | 0.969 | 0.599 | 1.0000 n.s. | 4 | 0.000 | 0.844 | 0.563 | 1.0000 n.s. | 3 | 0.000 | 1.000 | 0.538 | 1.0000 n.s. |
| CO6 | 3 | 3 | 0.000 | 0.656 | 0.479 | 1.0000 n.s. | 2 | 0.000 | 0.969 | 0.507 | 1.0000 n.s. | 2 | 0.000 | 0.938 | 0.506 | 1.0000 n.s. |
| CO7 | 33 | 16 | 0.000 | 0.938 | 0.889 | 0.9000 n.s. | 19 | 0.059 | 0.813 | 0.914 | 0.0467 n.s. | 13 | 0.073 | 0.750 | 0.865 | 0.0589 n.s. |
| CO8 | 22 | 12 | 0.068 | 0.656 | 0.718 | 0.1922 n.s. | 3 | 0.085 | 0.094 | 0.177 | 0.0789 n.s. | 6 | 0.000 | 0.688 | 0.687 | 0.6122 n.s. |
| CO9 | 26 | 16 | 0.000 | 0.938 | 0.923 | 0.7100 n.s. | 6 | 0.000 | 0.719 | 0.734 | 0.5844 n.s. | 16 | 0.000 | 1.000 | 0.922 | 1.0000 n.s. |
| CO10 | 3 | 3 | 0.000 | 0.063 | 0.122 | 0.0656 n.s. | 3 | 0.000 | 0.125 | 0.150 | 1.0000 n.s. | 2 | 0.000 | 0.063 | 0.092 | 1.0000 n.s. |
| CO11 | 25 | 10 | 0.000 | 0.563 | 0.503 | 1.0000 n.s. | 13 | 0.000 | 0.594 | 0.504 | 1.0000 n.s. | 14 | 0.000 | 0.438 | 0.416 | 1.0000 n.s. |
| CO12 | 5 | 4 | 0.002 | 0.344 | 0.373 | 0.5422 n.s. | 3 | 0.000 | 1.000 | 0.523 | 1.0000 n.s. | 2 | 0.000 | 0.375 | 0.372 | 0.8311 n.s. |
| CO13 | 6 | 5 | 0.096 | 0.375 | 0.485 | 0.0800 n.s. | 6 | 0.183 | 0.313 | 0.614 | 0.0011 | 4 | 0.000 | 0.625 | 0.624 | 0.6922 n.s. |
| CO14 | 19 | 9 | 0.219 | 0.438 | 0.856 | 0.0011 | 14 | 0.018 | 0.844 | 0.881 | 0.3256 n.s. | 4 | 0.000 | 0.656 | 0.627 | 0.7433 n.s. |
| CO15 | 26 | 15 | 0.205 | 0.500 | 0.917 | 0.0011 | 15 | 0.000 | 0.875 | 0.889 | 0.4756 n.s. | 7 | 0.000 | 0.750 | 0.690 | 0.9067 n.s. |
| Mean | 13.7 | 7.9 | 0.073 | 0.538 | 0.604 | - | 7.3 | 0.047 | 0.583 | 0.566 | - | 6.0 | 0.017 | 0.588 | 0.533 | - |
HWE: Hardy-Weinberg equilibrium; Nt: the total number of alleles per locus scored by 96 individuals; Na: number of alleles per locus and population; F: estimated frequency of null alleles per locus; Ho: observed heterozygosity; He: expected heterozygosity; p-value: p-value for exact tests for HWE;
showed significant deviation from HWE after Bonferroni correction (p < 0.00111);
n.s.: not significant.