Literature DB >> 23109844

Characterization of 15 polymorphic microsatellite loci for Cephalotaxus oliveri (Cephalotaxaceae), a conifer of medicinal importance.

Yingchun Miao1,2, Xuedong Lang2, Shuaifeng Li2, Jianrong Su2, Yuehua Wang1.   

Abstract

Cephalotaxus oliveri is a scarce medicinal conifer endemic to the south central region of China and Vietnam. A small fragmented population presently exists due to anthropogenic disturbance. C. oliveri has been used for its alkaloids harringtonine and homoharringtonine, which are effective against leucocythemia and lymphadenosarcoma. Monoecious plants have been detected in nature, although they were understood to be dioecious. In order to study the mating system, population genetics and the genetic effects of habitat fragmentation on C. oliveri, 15 polymorphic and 12 monomorphic microsatellite loci were developed for C. oliveri by using the Fast Isolation by AFLP of Sequences Containing repeats (FIASCO) protocol. The polymorphisms were assessed in 96 individuals from three natural populations (32 individuals per population). The number of alleles per locus ranged from two to 33, the observed and expected heterozygosity per locus ranged from 0.000 to 1.000 and from 0.000 to 0.923, respectively. These loci would facilitate a comprehensive understanding of the genetic dynamics on C. oliveri, which will be useful for establishing effective conservation strategies for this species.

Entities:  

Keywords:  Cephalotaxus oliveri; FIASCO; PCR amplification; microsatellite loci

Mesh:

Substances:

Year:  2012        PMID: 23109844      PMCID: PMC3472736          DOI: 10.3390/ijms130911165

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   6.208


1. Introduction

Cephalotaxus oliveri Masters (Cephalotaxaceae) is a scarce medicinal conifer endemic to the south central region of China and Vietnam [1]. It is a Tertiary species of Cephalotaxus [2], and is well-known for producing the alkaloids harringtonine and homoharringtonine, which are effective against leucocythemia and lymphadenosarcoma [3]. Moreover, the seed oil is used for cooking, the wood for furniture, leaf extracts can be used for adhesives, and the tree itself is cultivated as an ornamental. However, due to limited natural reproduction, excessive exploitation and destruction of its natural habitats over past decades, a small fragmented population presently exists. The species has been placed under state protection and listed as vulnerable in the IUCN Red List (http://www.iucnredlist.org). C. oliveri was understood to be dioecious [4]. However, we have recently detected monoecious plants in Zheneng Country (24°17′56.4″N/101°21′E), Xinping County, Yunnan Province. Thus, there is a need for a comprehensive analysis of the mating system, population genetics and genetic effects of habitat fragmentation. Unfortunately, few studies have occurred due to the lack of codominant markers, such as microsatellites. Based on their codominant and hypervariable nature, microsatellites have become ideal markers in mating system [5] and population genetics analysis [6]. Presently only 13 polymorphic and 6 monomorphic microsatellite loci have been developed in C. oliveri. [7]. However, Koskinen et al. [8] had suggested it was important to maximize the number of microsatellites to obtain correct phylograms and increase the stability of genetic distances and corresponding phylograms even if optimally high microsatellite numbers (>30) were out of reach when studying population genetics. Furthermore, motif types and motif lengths have a significant effect on microsatellite variability [9]. Thus, 15 polymorphic and 12 monomorphic microsatellite loci with other various motif types and motif lengths for C. oliveri are characterized here. The total 46 microsatellite loci developed by us and Pan et al. [7] would be useful for a comprehensive understanding of the mating system, population genetics and genetic effects of habitat fragmentation, and a basis for studying microsatellite evolution and dynamics [10], genetic mapping [11] and molecular breeding [12] of the species in the future.

2. Results and Discussion

A total of 1056 white positive clones were captured, among which only 312 (29.5%) microsatellite clones were detected. Seventy-nine (25.3%) microsatellite sequences with sufficient flanking regions were used to design primers. As a result, only 27 primers (34.2%) produced clear and reliable bands, and were tested polymorphism in 96 individuals from three natural populations (32 individuals per population). Fifteen of the 27 loci in C. oliveri were polymorphic (CO1–CO15), and 12 (CO16–CO27) were monomorphic (Table 1).
Table 1

Characteristics of 15 polymorphic and 12 monomorphic microsatellite loci for Cephalotaxus oliveri.

LocusPrimer sequences(5′-3′)Repeat motifSize range (bp)Ta (°C)GenBank accession No.
CO1F: GTTTACATTGGAGCCAGTCAR: TTTTCCACCTTCTTTGACCT(AC)19(AG)6173–22551JQ902141
CO2F: GCAACTCATTTGAAGCATCGR: AGGTAGACCAGGCTTCCATT(GA)9235–24761JQ902142
CO3F: TCCTAAATTGAGCCTCTGTGR: TGAAGGTGTTGAGGTGGTCT(TG)26355–35951JQ902143
CO4F: TCAGGCTTTAGATCTTGGAATGTR: GTGGTGGGAGTTCGGAGTTTT(GA)33T(AG)5257–26149JQ902144
CO5F: CACTGGTGGTTTGCTTGCR: CATCACCTTGCATCCTCA(TG)37170–18849JQ902145
CO6F: CATCTTTTCATAGTTGTCTGCR: CTTAGGTCTAGGTCAAGTGTA(GT)7137–14155JQ902146
CO7F: GAGGAGGTTCAAGGTGGTCTR: CCCACTTCCTCCAGCAATAC(AC)37(AG)22229–42366JQ902147
CO8F: AATTTATTATGAAGGATAGGGR: CTAATACATTGAATTGGGTAA(AC)3581–13749JQ902148
CO9F: CACAACTCGCAAGAGGTAAAR: GTATCCCTAGTGACTTGGCAT(CT)11C2(CT)7174–23661JQ902149
CO10F: AAGAAGAGCAGGTTTGACATR: GCTACAACTCCCTTGATGACA10139–14361JQ902150
CO11F: TCATGGGCGCATTAGGACR: TCTCCTTCGCTCATCAAACTT(CA)45230–33864JQ902151
CO12F: CCAAGTGACCATTCCACCAAR: GTCTCACGTCCATCTTAGCA(TC)7183–19161JQ902152
CO13F: GTGCCCTCATACCCATTCTAR: CCATCACATCTGCCACATCA(AG)9161–17364JQ902153
CO14F: ATCCTGAGTCCCTGTATGTTR: CTACTATCTGAGCACGCCAC(AG)18235–29355JQ902154
CO15F: TCCAAGGATGCACATTCAATR: AAACAAAACCTCACTCAATGAA(AC)18262–31658JQ902155
CO16F: TTACAAATCAACCACCCCR: GTGCTTGTCAGTGCTAAGGT(GTG)528058JQ902156
CO17F: ACCTAAGGGTGCTTGGAGATAR: GATGATGACACCTGTTATGCC(AG)630461JQ902157
CO18F: AGACAATCAACAAGCATACACR: AACAGGCACATAACTACAAAT(GA)1038561JQ902158
CO19F: AAAACCCAAACAGTGGAAACAR: ACGTTTACGTAGACCTGAATGC(AC)1612858JQ902159
CO20F: TACTAAAACAACTCATTGGAAACR: TGGTGAAGACCCTGGAAGA(CT)922149JQ902160
CO21F: ATTGGTGGAAGACCCTAGAAGAR: GCAACTAGGGATGCTAAAACAG(AG)1023561JQ902161
CO22F: AAATATGGAAGAATGGTGATCR: TGATTTAGGGACCTTAGCAC(AG)815049JQ902162
CO23F: GATGAAGGCACGGGAAACR: TTGAGAATTGACAAAGTCAAA(TTTTG)326449JQ902163
CO24F: GGCTTCGGAAGACTACCTTR: AATGACCATGCCAACAAAC(AG)11G(GA)1316555JQ902164
CO25F: AAAGGCAACATGCTATCAAATR: TACCGTGTCTTCTGCCTCTGG(GAA)426158JQ902165
CO26F: AGGGCTATGCTTTGGATGTR: TTGATGAAGTTATGGGTGC(GAG)428858JQ902166
CO27F: ATTCTTTGTTGGTCCGTTTAR: AGGAGGAGTAGGGATGGTAG(GAA)517553JQ902167

Ta, annealing temperature.

No significant linkage disequilibrium was detected after Bonferroni correction (p < 0.05). The number of alleles per locus ranged from 2 to 33, with a total of 206 different alleles scored in 96 individuals. The observed and expected heterozygosity varied from 0.000 to 1.000 and 0.092 to 0.923, respectively (Table 2). Most loci in the three populations did not significantly deviate from HWE (Table 2). Estimated frequencies of null alleles were very low for 14 loci, varying from 0%–9% with a mean of 3%, except the locus CO2 characterized with 24% (Table 2). CO2 significantly deviated from HWE after Bonferroni correction (p < 0.00111) for the three populations due to heterozygote deficiency, suggesting the possibility of existence of null alleles in this locus.
Table 2

Genetic characterization of 15 polymorphic microsatellite loci in three natural populations of Cephalotaxus oliveri.

DZ population (N = 32)PB population (N = 32)LX population (N = 32)



HWEHWEHWE



LocusNtNaFnHoHep-valueNaFnHoHep-valueNaFnHoHep-value
CO122130.1390.6070.8970.0011 *130.0800.7500.9120.0078 n.s.80.0040.4690.4760.5689 n.s.
CO2640.2490.1880.6090.0011 *50.2800.1250.6050.0011 *50.1770.3130.6190.0011 *
CO3220.1200.0000.0920.0156 n.s.10.001---10.001---
CO4330.0000.8440.6011.0000 n.s.30.0000.6880.5161.0000 n.s.30.0000.7500.5661.0000 n.s.
CO5530.0000.9690.5991.0000 n.s.40.0000.8440.5631.0000 n.s.30.0001.0000.5381.0000 n.s.
CO6330.0000.6560.4791.0000 n.s.20.0000.9690.5071.0000 n.s.20.0000.9380.5061.0000 n.s.
CO733160.0000.9380.8890.9000 n.s.190.0590.8130.9140.0467 n.s.130.0730.7500.8650.0589 n.s.
CO822120.0680.6560.7180.1922 n.s.30.0850.0940.1770.0789 n.s.60.0000.6880.6870.6122 n.s.
CO926160.0000.9380.9230.7100 n.s.60.0000.7190.7340.5844 n.s.160.0001.0000.9221.0000 n.s.
CO10330.0000.0630.1220.0656 n.s.30.0000.1250.1501.0000 n.s.20.0000.0630.0921.0000 n.s.
CO1125100.0000.5630.5031.0000 n.s.130.0000.5940.5041.0000 n.s.140.0000.4380.4161.0000 n.s.
CO12540.0020.3440.3730.5422 n.s.30.0001.0000.5231.0000 n.s.20.0000.3750.3720.8311 n.s.
CO13650.0960.3750.4850.0800 n.s.60.1830.3130.6140.0011 *40.0000.6250.6240.6922 n.s.
CO141990.2190.4380.8560.0011 *140.0180.8440.8810.3256 n.s.40.0000.6560.6270.7433 n.s.
CO1526150.2050.5000.9170.0011 *150.0000.8750.8890.4756 n.s.70.0000.7500.6900.9067 n.s.
Mean13.77.90.0730.5380.604-7.30.0470.5830.566-6.00.0170.5880.533-

HWE: Hardy-Weinberg equilibrium; Nt: the total number of alleles per locus scored by 96 individuals; Na: number of alleles per locus and population; F: estimated frequency of null alleles per locus; Ho: observed heterozygosity; He: expected heterozygosity; p-value: p-value for exact tests for HWE;

showed significant deviation from HWE after Bonferroni correction (p < 0.00111);

n.s.: not significant.

3. Experimental Section

Three microsatellite-enriched libraries were constructed following the FIASCO (Fast Isolation by AFLP of Sequences Containing repeats) protocol [13]. Genomic DNA of a single individual of C. oliveri was extracted from dried leaves following the cetyltrimethyl ammonium bromide (CTAB) method [14]. About 500 ng genome DNA was completely digested with MseI (Fermentas, Glen Burmie, Maryland, USA) at 65 °C for 3 h, and then ligated to an MseI adaptor pair (5′-TACTCAGGACTCAT-3′/5′-GACGATGAGTCCTGAG-3′) using T4 DNA ligase (Fermentas, Glen Burmie, Maryland, USA). Five microliters of ligated DNA fragments diluted 10-fold were amplified with adapter-specific primer MseI-N (5′-GATGAGTCCTGAGTAAN-3′) in a 20 μL reaction mixture containing 2.0 mM MgCl2, 1.25 pM MseI-N primer, 0.2 mM dNTP, 1 U Taq DNA polymerase (TransGen, Beijing, China). PCR amplification was as follows: 95 °C for 3 min, 23 cycles of 94 °C for 1 min, 53 °C for 1 min, 72 °C for 1 min, followed by 72 °C for 10 min. To enrich the fragments containing microsatellite repeats, 100 μL of PCR products were denatured at 95 °C for 5 min, then hybridized with four 1 μM 5′-biotinylated microsatellite probes [library 1 = (AG)15 and (AC)15; library 2 = (CT)15, and library 3 = (AAG)10] at 48 °C for 2 h, 55 °C for 3 h, and 52 °C for 2 h, respectively. DNA fragments containing targeted repeats were selectively captured by magnetic streptavidin-coated particles (Promega, Madison, Wisconsin, USA). Recovered microsatellite DNA fragments were amplified with MseI-N by 30 cycles according to the conditions described above. About 20 ng PCR product with a range of 200 to 800 bp purified via the E.Z.N.A. Gel Extraction kit (Omega Bio-Tek, Winooski, Vermont, USA) were directly ligated into a pEASY-T1 Cloning vector (TransGen, Beijing, China), and then transformed into Escherichia coli DH5a competent cells (Biomed, Beijing, China). Positive clones were selected using blue/white screening after growing on IPTG-XGal media, and further tested by PCR with M13 primers (5′-GTAAAACGACGGCCAGT-3′/5′-CAGGAAACAGCTATGAC-3′) and the corresponding primer-mix (AG)15 and (AC)15, or (CT)15, and or (AAG)10, respectively, for confirming positive clones containing microsatellites. PCR amplification was performed in a 15 μL reaction mixture containing 2 μL of bacterial suspension, 2.0 mM MgCl2, 0.2 μM each primer, 0.2 mM dNTP, 1 U Taq DNA polymerase (TransGen, Beijing, China). PCR amplification was as follows: 95 °C for 3 min, 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, followed by 72 °C for 10 min. Detected microsatellite clones were sequenced by an ABI3730xl Genetic Analyzer (Applied Biosystems, Carlsbad, California, USA). Microsatellite sequences with sufficient flanking regions were used to design primers with Primer 5 [15]. Ninety-six individuals in three natural populations (32 per population) from Daozhen County (DZ) (29°4′55.2″N, 107°24′54″E), Guizhou Province; Pingbian (PB) (24°59′56.4″N, 101°21′E) County, Yunnan Province; and Luxi (LX) (27°16′34.6″N, 114°4′33.5″E) County, Jiangxi Province were used for primer testing. Herbarium voucher (Daozhen: L.X.D. 09-103; Pingbian: L.X.D. 09-275; Luxi: L.X.D. 10-366) deposited in Yunnan University Herbarium Laboratory of Pteridophyta (PYU), Kunming, Yunnan, China. We labeled 6-FAM at the 5′ end of each forward primer for the loci showed clear and reliable bands. The above 96 individuals were also used to test the polymorphism of these workable microsatellite primers. Microsatellite loci were amplified in 20 μL volume with approximately 25 ng genomic DNA as the template, 2.0 mM MgCl2, 0.5 mM each primer, 0.25 mM dNTP, 1.5 U Taq DNA polymerase (TransGen, Beijing, China). PCR amplification was as follows: 95 °C for 3 min; 35 cycles of 94 °C for 30 s, annealing at optimal temperature 49 °C–66 °C for 30 s (see Table 1), and 72 °C for 30 s, followed by 72 °C for 10 min. These microsatellite fragments were separated on an ABI 3730xl genetic analyzer (Applied Biosystems, Carlsbad, CA, USA) with GenScan-500 size standard. All alleles were scored with the help of GeneMapper 4. The linkage disequilibrium between loci and number of alleles per locus (Na) per population were estimated using FSTAT 2.9.3 (A program to estimate and test gene diversities and fixation indices) [16]. The observed (Ho) and expected (He) heterozygosities were calculated by ARLEQUIN 3.01[17]. The significant test of Hardy-Weinberg equilibrium (HWE) was done in GENEPOP 4.0.9 [18]. Lastly, the frequencies of null alleles per locus were calculated with FreeNA [19].

4. Conclusions

In summary, 15 polymorphic microsatellite markers have been specifically developed for the C. oliveri in this study. These markers will facilitate the further studies on the mating system, population genetics, and genetic effects of habitat fragmentation of the species. Such information will be useful for developing sound and effective conservation strategies for this endangered species. Furthermore, these developed SSR markers for C. oliveri would also be potentially useful for exploring population genetics in the Cephalotaxus species.
  12 in total

Review 1.  Strategies for microsatellite isolation: a review.

Authors:  L Zane; L Bargelloni; T Patarnello
Journal:  Mol Ecol       Date:  2002-01       Impact factor: 6.185

2.  Evaluating the influence of different aspects of habitat fragmentation on mating patterns and pollen dispersal in the bird-pollinated Banksia sphaerocarpa var. caesia.

Authors:  T M Llorens; M Byrne; C J Yates; H M Nistelberger; D J Coates
Journal:  Mol Ecol       Date:  2011-12-12       Impact factor: 6.185

3.  Development and mapping of microsatellite (SSR) markers in wheat.

Authors:  Q J Song; J R Shi; S Singh; E W Fickus; J M Costa; J Lewis; B S Gill; R Ward; P B Cregan
Journal:  Theor Appl Genet       Date:  2005-01-18       Impact factor: 5.699

4.  Microsatellite null alleles and estimation of population differentiation.

Authors:  Marie-Pierre Chapuis; Arnaud Estoup
Journal:  Mol Biol Evol       Date:  2006-12-05       Impact factor: 16.240

5.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

6.  Development of microsatellite loci for Cephalotaxus oliveri (Cephalotaxaceae) and cross-amplification in Cephalotaxus.

Authors:  Hua-Wei Pan; Ying-Rong Guo; Ying-Juan Su; Ting Wang
Journal:  Am J Bot       Date:  2011-08       Impact factor: 3.844

7.  Mutation and evolution of microsatellites in Drosophila melanogaster.

Authors:  M D Schug; C M Hutter; M A Noor; C F Aquadro
Journal:  Genetica       Date:  1998       Impact factor: 1.082

8.  The benefits of increasing the number of microsatellites utilized in genetic population studies: an empirical perspective.

Authors:  Mikko T Koskinen; Heikki Hirvonen; Pierre-Alexandre Landry; Craig R Primmer
Journal:  Hereditas       Date:  2004       Impact factor: 3.271

9.  Characteristics and analysis of simple sequence repeats in the cotton genome based on a linkage map constructed from a BC1 population between Gossypium hirsutum and G. barbadense.

Authors:  Yanxin Zhang; Zhongxu Lin; Qizhong Xia; Mingju Zhang; Xianlong Zhang
Journal:  Genome       Date:  2008-07       Impact factor: 2.166

10.  Arlequin (version 3.0): an integrated software package for population genetics data analysis.

Authors:  Laurent Excoffier; Guillaume Laval; Stefan Schneider
Journal:  Evol Bioinform Online       Date:  2007-02-23       Impact factor: 1.625

View more
  3 in total

1.  Highly informative single-copy nuclear microsatellite DNA markers developed using an AFLP-SSR approach in black spruce (Picea mariana) and red spruce (P. rubens).

Authors:  Yong-Zhong Shi; Natascha Forneris; Om P Rajora
Journal:  PLoS One       Date:  2014-08-15       Impact factor: 3.240

2.  Full-Length Transcriptome Analysis of Four Different Tissues of Cephalotaxus oliveri.

Authors:  Ziqing He; Yingjuan Su; Ting Wang
Journal:  Int J Mol Sci       Date:  2021-01-14       Impact factor: 5.923

3.  Development and characterization of 15 microsatellite markers for Cephalotaxus fortunei (Cephalotaxaceae).

Authors:  Chunbo Wang; Zhiyou Guo; Xilian Huang; Lu Huang
Journal:  Appl Plant Sci       Date:  2016-05-16       Impact factor: 1.936

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.