| Literature DB >> 27213121 |
Chunbo Wang1, Zhiyou Guo1, Xilian Huang1, Lu Huang2.
Abstract
PREMISE OF THE STUDY: To survey population variation and the adaptive evolution of Cephalotaxus fortunei (Cephalotaxaceae), an endemic and endangered conifer in China, microsatellite markers were developed and characterized for this species. METHODS ANDEntities:
Keywords: Cephalotaxaceae; Cephalotaxus fortunei; FIASCO; cross-amplification; genetic analysis; microsatellite primers
Year: 2016 PMID: 27213121 PMCID: PMC4873268 DOI: 10.3732/apps.1500129
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Characteristics of 15 microsatellite loci for Cephalotaxus fortunei.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size (bp) | GenBank accession no. | |
| CF1 | F: GCCCTAAACGCTTCTCAA | (AC)17 | 129 | 54 | KT832555 |
| R: CGGTACGGGATAGCAAGA | |||||
| CF2 | F: ACGATTCCCGAGATTCAT | (TG)12 | 139 | 57 | KT832556 |
| R: ACGGTCAGAGTTGTAGCG | |||||
| CF3 | F: CGGGTATTCCAGGGCTAA | (AC)13TGC(TC)18 | 207 | 54 | KT832557 |
| R: TCCGCGTTACGTCAGGTT | |||||
| CF4 | F: CCGCGTGGGACATTCTAG | (GT)15 | 122 | 53.5 | KT832558 |
| R: CCATGGACTTGGGCAACA | |||||
| CF5 | F: GTAGAAAACTTCACAGGGAC | (CA)19 | 114 | 56 | KT832559 |
| R: ACACGCGATGTGCTAAAC | |||||
| CF6 | F: CTCAGGCACTGGGCAATC | (TG)26 | 204 | 54.5 | KT832560 |
| R: CGCTGTAGGCGTCGATTT | |||||
| CF7 | F: ATTCCCGAACTTCCCAGG | (AC)25 | 122 | 57 | KT832561 |
| R: CTCACAGTAAACGGCGTC | |||||
| CF8 | F: GGCAATCCCTTGGGTTAG | (AC)29 | 105 | 53 | KT832562 |
| R: CTAAAGCCTCTGGGACGC | |||||
| CF9 | F: CTAAGCACGACTGGACAAAG | (CA)11 | 102 | 55 | KT832563 |
| R: GGCGCTGAATCCGACACT | |||||
| CF10 | F: AGCGCCCATTTGAAAGTA | (TC)9AA(CA)12 | 258 | 58 | KT832564 |
| R: TGCCGATTAGTGGAAGTGTA | |||||
| CF11 | F: CGTAGGCAACCCGCTTTC | (TG)23 | 124 | 55 | KT832565 |
| R: GGCGATCCGATTGACACC | |||||
| CF12 | F: CCCGTAAGTGACTGTCCG | (AC)21 | 106 | 56 | KT832566 |
| R: TTAGCCGTTGAAATGTGC | |||||
| CF13 | F: ATCCGATTTCGCCGTGTT | (GT)17 | 125 | 57 | KT832567 |
| R: CTTGACGGTGCCATTGTG | |||||
| CF14 | F: CTTACCCAGGCAAATGTG | (GT)8CTA(CA)7 | 103 | 54 | KT832568 |
| R: GTATCGGCCCTTTGGTAG | |||||
| CF15 | F: TACCTCGGGAGACATCAT | (TG)16 | 141 | 56 | KT832569 |
| R: CTCGTTAGTAGCCCGTTGG |
Note: Ta = annealing temperature.
Monomorphic loci.
Genetic diversity of 13 polymorphic microsatellite loci in Cephalotaxus fortunei populations.
| Enshi population ( | Suining population ( | Jinping population ( | Jinggangshan population ( | Shiping population ( | ||||||||||||||||
| Locus | ||||||||||||||||||||
| CF1 | 4 | 3.437 | 0.323 | 0.235 | 5 | 4.274 | 0.6020 | 0.474 | 4 | 3.7540 | 0.383 | 0.277 | 2 | 1.372 | 0.247 | 0.209 | 2 | 1.842 | 0.488 | 0.421 |
| CF2 | 5 | 3.573 | 0.466 | 0.401 | 4 | 3.527 | 0.386 | 0.305 | 2 | 1.463 | 0.707 | 0.635 | 3 | 2.889 | 0.600 | 0.478 | 6 | 4.791 | 0.873 | 0.598 |
| CF3 | 2 | 1.331 | 0.197 | 0.114 | 2 | 1.510 | 0.208 | 0.173 | 3 | 2.582 | 0.538 | 0.281 | 5 | 3.996 | 0.584 | 0.501 | 4 | 3.588 | 0.731 | 0.627 |
| CF4 | 7 | 5.716 | 1.000 | 0.738 | 6 | 5.0282 | 0.877 | 0.539 | 3 | 2.375 | 0.436 | 0.374 | 3 | 2.037 | 0.373 | 0.286 | 3 | 2.736 | 0.217 | 0.190 |
| CF5 | 3 | 2.554 | 0.252 | 0.243 | 2 | 1.742 | 0.273 | 0.209 | 3 | 2.486 | 0.211 | 0.207 | 2 | 1.814 | 0.137 | 0.126 | 3 | 1.477 | 0.562 | 0.392 |
| CF6 | 3 | 2.764 | 0.485 | 0.386 | 5 | 4.337 | 0.409 | 0.317 | 3 | 2.371 | 0.319 | 0.188 | 2 | 1.753 | 0.281 | 0.194 | 4 | 3.522 | 0.613 | 0.485 |
| CF7 | 2 | 1.724 | 0.536 | 0.524 | 3 | 2.646 | 0.434 | 0.282 | 5 | 4.877 | 0.485 | 0.429 | 3 | 1.344 | 0.813 | 0.528 | 5 | 3.985 | 0.741 | 0.677 |
| CF8 | 4 | 3.015 | 0.632 | 0.206 | 3 | 2.127 | 0.211 | 0.193 | 6 | 4.835 | 0.947 | 0.487 | 1 | 1.000 | 0.000 | 0.108 | 2 | 1.371 | 0.318 | 0.251 |
| CF9 | 3 | 2.544 | 0.530 | 0.381 | 4 | 3.486 | 0.785 | 0.274 | 4 | 2.742 | 0.374 | 0.218 | 3 | 2.378 | 0.713 | 0.454 | 2 | 1.319 | 0.301 | 0.217 |
| CF10 | 3 | 2.322 | 0.274 | 0.197 | 3 | 2.712 | 0.277 | 0.176 | 3 | 2.615 | 0.598 | 0.472 | 3 | 2.086 | 0.251 | 0.136 | 2 | 1.436 | 0.462 | 0.366 |
| CF11 | 4 | 3.706 | 0.522 | 0.209 | 3 | 2.854 | 0.306 | 0.298 | 1 | 1.000 | 0.000 | 0.108 | 4 | 2.792 | 0.815 | 0.630 | 4 | 3.091 | 0.750 | 0.519 |
| CF12 | 4 | 3.418 | 0.387 | 0.328 | 3 | 2.371 | 0.299 | 0.187 | 2 | 1.784 | 0.193 | 0.180 | 3 | 2.514 | 0.277 | 0.217 | 4 | 3.802 | 0.800 | 0.718 |
| CF13 | 4 | 3.273 | 0.623 | 0.544 | 3 | 2.668 | 0.275 | 0.204 | 5 | 4.613 | 0.828 | 0.382 | 5 | 4.281 | 0.626 | 0.464 | 4 | 3.517 | 0.732 | 0.635 |
Note: A = actual number of alleles; Ae = effective number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size for each population.
Locality and voucher information is available in Appendix 1.
Genetic diversity in five Cephalotaxus oliveri populations using 10 polymorphic microsatellite loci originally developed in C. fortunei.
| Changyang population ( | Hupingshan population ( | Fanjingshan population ( | Anfu population ( | Daweishan population ( | ||||||||||||||||
| Locus | ||||||||||||||||||||
| CF1 | 3 | 2.766 | 0.439 | 0.382 | 5 | 3.638 | 0.2040 | 0.126 | 3 | 2.5270 | 0.205 | 0.193 | 2 | 1.771 | 0.385 | 0.218 | 2 | 1.426 | 0.536 | 0.412 |
| CF2 | 5 | 3.432 | 0.628 | 0.571 | 3 | 2.757 | 0.527 | 0.483 | 2 | 1.343 | 0.284 | 0.205 | 6 | 4.648 | 1.000 | 0.831 | 3 | 2.825 | 0.429 | 0.375 |
| CF3 | 4 | 2.488 | 0.482 | 0.276 | 2 | 1.436 | 0.266 | 0.214 | 5 | 3.719 | 0.799 | 0.510 | 3 | 2.731 | 0.426 | 0.304 | 4 | 3.463 | 0.671 | 0.482 |
| CF4 | 5 | 3.653 | 0.927 | 0.803 | 4 | 2.7882 | 0.726 | 0.548 | 3 | 2.380 | 0.372 | 0.274 | 5 | 3.547 | 0.418 | 0.373 | 3 | 2.319 | 0.317 | 0.202 |
| CF5 | 3 | 2.072 | 0.372 | 0.210 | 3 | 2.382 | 0.353 | 0.213 | 2 | 1.826 | 0.179 | 0.137 | 2 | 1.380 | 0.173 | 0.137 | 4 | 2.331 | 0.828 | 0.746 |
| CF6 | 3 | 1.364 | 0.518 | 0.454 | 4 | 3.738 | 0.536 | 0.437 | 3 | 2.737 | 0.257 | 0.208 | 4 | 3.283 | 0.218 | 0.148 | 3 | 2.2523 | 0.602 | 0.560 |
| CF7 | 4 | 3.632 | 0.7398 | 0.571 | 3 | 2.442 | 0.267 | 0.189 | 5 | 4.566 | 0.703 | 0.542 | 2 | 1.739 | 0.852 | 0.727 | 4 | 3.092 | 0.718 | 0.592 |
| CF8 | 4 | 3.281 | 0.835 | 0.706 | 1 | 1.000 | 0.000 | 0.116 | 5 | 4.201 | 0.808 | 0.746 | 2 | 1.514 | 0.177 | 0.119 | 4 | 3.304 | 0.892 | 0.539 |
| CF9 | 3 | 2.737 | 0.243 | 0.217 | 5 | 4.237 | 0.845 | 0.677 | 4 | 3.782 | 0.527 | 0.327 | 3 | 2.747 | 0.727 | 0.542 | 2 | 1.109 | 0.283 | 0.203 |
| CF10 | 3 | 2.455 | 0.306 | 0.258 | 2 | 1.536 | 0.252 | 0.165 | 4 | 3.091 | 0.361 | 0.296 | 3 | 2.806 | 0.317 | 0.231 | 3 | 2.377 | 0.737 | 0.586 |
Note: A = actual number of alleles; Ae = effective number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size for each population.
Locality and voucher information is available in Appendix 1.
Geographic location and voucher information of each population for Cephalotaxus fortunei and C. oliveri in this study. All voucher specimens were deposited at the herbarium of Qiannan Normal College for Nationalities (QNCN).
| Species | Population | Geographic coordinates | Voucher specimens |
| Enshi, Hubei Province | 30°17′N, 109°23′E | ||
| Suining, Hunan Province | 26°30′N, 109°30′E | ||
| Jinping, Guizhou Province | 26°41′N, 109°11′E | ||
| Jinggangshan, Jiangxi Province | 26°35′N, 114°08′E | ||
| Shiping, Yunnan Province | 23°43′N, 102°25′E | ||
| Changyang, Hubei Province | 30°17′N, 109°23′E | ||
| Hupingshan, Hunan Province | 26°30′N, 109°30′E | ||
| Fanjingshan, Guizhou Province | 26°41′N, 109°11′E | ||
| Anfu, Jiangxi Province | 26°35′N, 114°08′E | ||
| Daweishan, Yunnan Province | 23°43′N, 102°25 ′E |