Literature DB >> 22942684

DsHsp90 is involved in the early response of Dunaliella salina to environmental stress.

Si-Jia Wang1, Ming-Jie Wu1,2, Xiang-Jun Chen1,2, Yan Jiang1, Yong-Bin Yan2.   

Abstract

Heat shock protein 90 (Hsp90) is a molecular chaperone highly conserved across the species from prokaryotes to eukaryotes. Hsp90 is essential for cell viability under all growth conditions and is proposed to act as a hub of the signaling network and protein homeostasis of the eukaryotic cells. By interacting with various client proteins, Hsp90 is involved in diverse physiological processes such as signal transduction, cell mobility, heat shock response and osmotic stress response. In this research, we cloned the dshsp90 gene encoding a polypeptide composed of 696 amino acids from the halotolerant unicellular green algae Dunaliella salina. Sequence alignment indicated that DsHsp90 belonged to the cytosolic Hsp90A family. Further biophysical and biochemical studies of the recombinant protein revealed that DsHsp90 possessed ATPase activity and existed as a dimer with similar percentages of secondary structures to those well-studied Hsp90As. Analysis of the nucleotide sequence of the cloned genomic DNA fragment indicated that dshsp90 contained 21 exons interrupted by 20 introns, which is much more complicated than the other plant hsp90 genes. The promoter region of dshsp90 contained putative cis-acting stress responsive elements and binding sites of transcriptional factors that respond to heat shock and salt stress. Further experimental research confirmed that dshsp90 was upregulated quickly by heat and salt shock in the D. salina cells. These findings suggested that dshsp90 might serve as a component of the early response system of the D. salina cells against environmental stresses.

Entities:  

Keywords:  Dunaliella salina; Hsp90; gene structure; haloadaption; heat shock; osmotic stress; structural feature

Mesh:

Substances:

Year:  2012        PMID: 22942684      PMCID: PMC3430215          DOI: 10.3390/ijms13077963

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   6.208


1. Introduction

The unicellular green algae Dunaliella is the most halotolerant eukaryote known, and can survive in media of a wide range of chemical compositions and salt concentrations ranging from 0.05 M to saturation. The genus Dunaliella, a member of the Polyblepharidaceae family, was first discovered by Michel Felix Dunal in 1838 and named after him in 1905 [1]. During the past over 100 years, several well-known Dunaliella species, including D. salina, have been used as model organisms to investigate the molecular mechanism of saline adaption [1,2]. The morphology of Dunaliella is similar to another model organism Chlamydomonas reinhardtii except that the former one contains no rigid polysaccharide cell wall to facilitate the rapid alternation of cell volume upon osmotic pressure. In addition to the exceptional halotolerance, some Dunaliella species also accumulate high concentrations of carotenoids and glycerol, which makes them widely used as the cell factory for the commercial production of β-carotene and glycerol [3,4]. The accumulation of carotenoids may be important for Dunaliella to fight against excess blue light or UV irradiation [5], while glycerol is rapidly converted from starch to maintain the homeostasis when Dunaliella cells are under high-salt stress [6]. The morphological and metabolic changes of Dunaliella cells during osmotic stress have been well-established [2]. In brief, when subject to hyperosmotic or hypoosmotic shock, an alteration occurs in the Dunaliella cell shape, volume and intracellular ion strength within minutes, followed by a balance of the osmolarity via adjustment of intracellular glycerol concentration achieved within 2–3 hours, and finally the cells adapt to the new situation by synthesizing salt-induced proteins. Undoubtedly, the regulation of intracellular glycerol concentration is the most important mechanism of Dunaliella halotolerance [6,7], and the key enzymes involved in glycerol synthesis including glycerol 3-phosphate dehydrogenase1 (GPD1) have been cloned and studied [2,8]. However, the high-osmolarity glycerol (HOG) pathway, which is well-characterized in the hyperosmotic response of Saccharomyces cerevisiae [9], has not been identified in Dunaliella. Moreover, the mechanism of Dunaliella halotolerance is much more complex since the cells have to adjust their metabolism state to adapt to the new environment. Recently, several proteomic or genomic studies have revealed that many genes are regulated when Dunaliella cells are subjected to salinity stress [10-13]. Among them, the proteins involved in protein turnover are found to be up-regulated [11]. This discovery is not surprising since the conversion of the Dunaliella cells’ life style requires the synthesis of new proteins, the degradation of unnecessary proteins and the stabilization of proteins against stresses by protein quality control systems. Particularly, two heat shock proteins (Hsps) with high homology to Hsp70 and Hsp90 have been identified by proteomic analysis [11]. Hsp90, a molecular chaperone highly conserved across the species from prokaryotes to eukaryotes, is abundantly expressed in higher eukaryotes and is essential for cell viability under all growth conditions. Hsp90 exists as a dimer and each subunit contains three domains: the N-terminal ATPase domain (ND) and the C-terminal dimerization domain (CD) connected by the M-domain (MD) [14]. Hsp90 is proposed to be a hub of the signaling network and protein homeostasis of eukaryotic cells [15-17]. Compared with the other general Hsps, Hsp90 specifically interact with a subset of proteins, and more than 200 substrate (also called client) proteins have been identified. These client proteins are involved in diverse physiological/pathological processes such as signal transduction, cell mobility, tumorigenesis, steroid signaling, innate immunity, heat shock response and telomere maintenance [15-18]. The client proteins, Hsp90, Hsp70 and the regulatory proteins assemble into a large multichaperone machine to regulate the client protein function and turnover [14,19]. In Saccharomyces cerevisiae, Hsp90 is found to be required for the high osmotic stress response and regulates a novel signaling pathway via the co-chaperone Cdc37p parallel to the HOG pathway [20,21]. Considering that Hsp70- and Hsp90-like proteins were upregulated in Dunaliella under halophilic conditions [11] and the importance of Hsp90 in the stress response of eukaryotic cells, it is possible that Dunaliella Hsp90 (DsHsp90) is involved in the halotolerance of Dunaliella. In this research, we cloned the dshsp90 gene, monitored its salt-induced expression and characterized the biochemical and biophysical properties of the recombinant DsHsp90. The results herein suggested that DsHsp90 belongs to the Hsp90A family and is involved in the adaption of Dunaliella against extreme environmental conditions.

2. Results and Discussion

2.1. Cloning and Gene Structure of Dshsp90 from D. Salina

The construction of the cDNA library and the generation of the ESTs were as described previously [22], and a 566 bp fragment was identified to be homologous to Chlamydomonas reinhardtii Hsp90A (CrHsp90A). The full length gene was obtained by 5′ and 3′ RACEs to amplify the flanking regions using the primers listed in Table S1, which resulted in a 2395 bp cDNA including an ATG start codon, a TAA stop codon, a 41 bp 5′ untranslated region (UTR) and a 263 bp 3′ UTR. The cDNA open reading frame encoded a protein composed of 696 amino acids (Accession No. JQ735968) with a predicted pI of 4.96 and an estimated molecular weight of 79619.2 Da. Hsp90 is a family of proteins with the size ranging from 80 to 110 kDa, and can be divided into five families: cytoplasmic Hsp90 (Hsp90A), endoplasmic reticulum Hsp90 (Hsp90B), chloroplast Hsp90 (Hsp90C), mitochondria Hsp90 (TRAP) and bacteria Hsp90 (HtpG) [17]. The phylogenetic tree (Figure 1) constructed according to the sequences of various Hsp90s clearly indicated that DsHsp90 belongs to the cytoplasmic Hsp90, and has a close evolutionary relationship to the Hsp90As from algae.
Figure 1

Phylogenetic tree analysis of Hsp90s. The sequences used for analysis are: Arabidopsis thaliana HSP81-1 (NP_200076.1), Arabidopsis thaliana HSP81-2 (NP_200414.1), Arabidopsis thaliana HSP81-3 (NP_200412.1), Arabidopsis thaliana HtpG (NP_200411.1), Arabidopsis thaliana endoplasmin-like protein (SHD) (NP_194150.1), Arabidopsis thaliana Chaperone protein htpG family protein (CR88) (NP_178487.1), Arabidopsis thaliana HSP89.1 (NP_187434.2), Cenchrus americanus HSP90 (ADP89126.1), Chara braunii HSP90 (BAH97107.1), Chlamydomonas reinhardtii HSP90A (XP_001695264.1), Chlamydomonas reinhardtii HSP90B (EDP06860.1), Chlamydomonas reinhardtii HSP90C (AAU10511.1), Dunaliella salina HSP90 (AFK31312.1), Glycine max HSP90-1 (NP_001236612.1), Hordeum vulgare HSP90 (AAP87284.1), Oryza sativa HSP90 (BAA90487.1), Solanum lycopersicum HSP90 (AAD30456.1), Strongylocentrotus purpuratus HSP gp96 (NP_999808.1), Triticum aestivum HSP90 (AEK01109.1), Volvox carteri f. nagariensis HSP90 (XP_002947115.1), Zea mays HSP (NP_001170480.1), Blastocladiella emersonii HSP90B (ABU45371.1), Danio rerio HSP90β (NP_571385.2), Ostreococcus lucimarinus HSP90 (ABP00103.1), Rattus norvegicus HSP90β (NP_001004082.3), Homo sapiens HSP90 α (AAH68474.1), Kryptolebias marmoratus HSP90β (AEM65181.1), Oryza sativa HSP90C2 (XP_483065.1).

Sequence alignment indicated that DsHsp90 shared the highest homology with CrHsp90A (83.3%) and Hsp90 from Volvox carteri f. nagariensis (81.8%). The plant Hsp90As are highly conserved and the similarity of DsHsp90 to the other plant Hsp90s was more than 75%. As shown in Figure 2, the three structural/functional domains (ND, MD and CD) as well as the charged linker region were well-conserved in DsHsp90. Consistent with the phylogenetic tree analysis in Figure 1, DsHsp90 belonging to the cytosolic Hsp90 family was also indicated by the absence of any predictable organelle-specific N-terminal transit peptide sequence. Moreover, the five conserved signature sequences of cytosolic Hsp90As were well-conserved in DsHsp90. Motifs II-V were almost identical to those identified previously [23], while the Phe conserved in the other plant Hsp90As (NKEIFLRELISNASDALDKIR) was replaced by another aromatic residue Trp in motif I of DsHsp90 (NKEIWLRELISNASDALDKIR). Consistent with previous sequence analysis of Hsp90As, the charged linker and the C-terminus were the most variable regions in plant Hsp90s, which provided Hsp90 specificity in binding client proteins. Notably, the highly conserved motif MEEVD at the C-terminus characteristic of the Hsp90A family, which is crucial to the binding of co-chaperones containing tetratricopeptide repeats to cytosolic Hsp90s [17], was replaced by MEDVD in DsHsp90. Nonetheless, the similar properties of the acidic amino acid residues Asp and Glu implied that the motif MEDVD in DsHsp90 also maintained the conserved function of the C-terminus in Hsp90As.
Figure 2

Sequence alignment of Hsp90s. The sequences used for analysis are from D. salina Hsp90 (JQ735968), C. reinhardtii Hsp90A (XP_001695264.1), V. carteri Hsp90 (XP_002947115.1), C. braunii Hsp90 (BAK08741.1), O. sativa Hsp90 (NP_001063500.1), A. thaliana HtpG (NP_200411.1). Five signature sequences (I–V) characteristic of the cytosolic Hsp90A family according to Gupta [23] are highlighted by underlining. The C-terminal MEEVD sequence, which is also a characteristic motif of Hsp90A members, is highlighted by a box.

Analysis of the nucleotide sequence of the cloned genomic DNA fragment (Accession No. JQ735969) indicated that dshsp90 was 8.79 kb (Figure S1A), which might be the longest genomic sequence of Hsp90s (Figure 3). A comparison of the genomic sequence with the cDNA sequence of dshsp90 revealed that the ORF of dshsp90 contained 21 exons interrupted by 20 introns with an average size of 313 bp, which is longer than the mean length of higher plant introns (249 bp) [24] but smaller than that of C. reinhardtii (373 bp). The smallest intron was 108 bp (intron 19), while the largest one was 707 bp (intron 15). The 21 exons spread over the 8.79 kb region and ranged in the size from 35 bp to 241 bp with an average size of 110 bp (Table 1), which is much smaller than the mean length of 183 bp in higher plants [24]. Six of the splice junctions were type I, nine were type II, and five were type 0. There were 7 splice types found in dshsp90, and only 2 splice junctions followed the typical canonical consensus GT-AG dinucleotide sequence (Table 1). The boundary structures of the 18 other introns were distributed among 8 TG-GG type, 3 TA-GG type, 2 GC-GT type, 2 TC-GG type, 1 GT-GA type, 1 AA-GT type and 1 GC-GG type. The types of splice site of dshsp90 were much more complicated than the other algae hsp90s. For example, the 7 introns of hsp90 from C. reinhardtii contain 3 TG-GG type, 2 GT-AG type, 1 GT-GG type and 1 GT-GC type, while the 9 introns of hsp90 from V. carteri have 3 TG-GG, 2 GT-AG, 2 TA-GG, 1 AG-GT and 1 AG-TA borders. Alternate splicing of exons can occur between splice junctions of the same type. To examine whether alternate splicing occurred in dshsp90, Northern blot analysis was performed and only a single band could be obtained, implying there was a single specie of mRNA (Figure S2). Moreover, Western blot analysis also indicated that only one form of protein was expressed in the D. salina cells under various conditions (data not shown).
Figure 3

Distribution of exons and introns in the genomic DNA of hsp90s. The sequences used for analysis are from D. salina (JQ735969), A. thaliana (NM_124982.2), C. reinhardtii (XM_001695212.1), G. max (XM_003533929.1), Micromonas (XM_002499681.1), O. lucimarinus (XM_001419901.1), P. patens (XM_001777362.1), P. trichocarpa (XM_002305227.1), S. moellendorffii (XM_002981360.1), V. carteri (XM_002947069.1).

Table 1

Nucleotide sequence at the splice junction sequences and sizes of exons and introns of dshsp90.

Exon NoExon Size(bp)Intron Size(bp)Boundary SequenceJunction Type

Exon5′-Intron3′-IntronExon
198199TCTCTGTGAGTCTGCAGGATCATC0
243115TGCGGGTGAGTGCGCAGGATGTGAI
342206TCAGGTGCGCGCGCAGGTTCATGAI
456330ATCAGGTCCGTCTGCAGGATCATC0
564221CCAAGGTCAGTATTCAGGCTGACCI
635511GCCAGGTGAGGGTGCAGGAGTGGA0
7241307TGAAGGTGTGTGTGCAGGAGGACCII
8144275AGAAGGGTGGGTAGTCAGAGGATGII
9113464ATCTGGTAAGCCTCCAGGATGCGTI
10124448TCAAGTGCGTGTGCAGGTCCATCCII
11144163TCAAGGTGAGGTCTGAGGGTATTGII
1275289AGTTGAGTAGAAAGGTGATCAAGAII
13108179AGCTGGTAGGTACGCAGGGTGTGCII
14150263ACTGGTAAGGAGTCAGGTGAGAGCI
15125707TGATGGTGAGTGTGCAGGCAAGAAI
16137580AGGTGGGCGTCCAGGTGGAGAAGGII
17181277TCATGGTGGGTGTGCAGGGTGAGCII
1851243TCAAGGTAAGGGTGCAGGATCTAGII
1998108ATCAAGGTAGGTCTACAGCTTGGC0
2097373TGGAGGTGAGTCTGCAGGATGTCG0
21180
Alignment of the exon sequence of the dshsp90 gene with the other plant hsp90 genes showed that the dshsp90 gene has the most complicated gene structure. Although D. salina and C. reinhardtii have a close evolutionary relationship and DsHsp90 and CrHsp90A shared a high sequence homology of 83.3%, the gene structures between these two algae were quite different (Figure 3). The gene of hsp90 from C. reinhardtii has much fewer introns (only 7). The other plant hsp90 genes also contained less than 10 introns. For example, there are 9 introns for hsp90 from Volvox carteri f. nagariensis, 4 for Coprinopsis cinerea okayama and Schizophyllum commune, 3 for Micromonas and Selaginella moellendorffii, 2 for Oryza sativa, Arabidopsis thaliana and Ostreococcus lucimarinus, and only 1 for Physcomitrella patenshave. Although the debate regarding the origin of introns in eukaryotic cells has lasted for a long time between the introns-early and introns-late concepts, a hypothesis combining both concepts has been proposed to explain the mechanism of intron evolution in eukaryotes, which involves intron gain, intron loss and intron slide [25-27]. Moreover, the genomes of single-cell eukaryotes are usually intron-poor when compared to the intron-rich multicellular organisms [28]. However, the genomes of algae seem to be intron-rich although the mean intron length of the multicellular V. carteri is longer than the single-cellular C. reinhardtii [29,30]. Compared with hsp90s from C. reinhardtii and V. carteri, the hsp90 gene from D. salina was unusually complicated, and all of the three well-structured domains of DsHsp90 were interrupted by several introns. It is unclear yet how the intron number and size differ in the genomes of D. salina and C. reinhardtii, and whether the large number of introns also exists in the other genes from D. salina. Nonetheless, the extremely large number of the introns of dshsp90 suggested that it might be a highly expressed gene containing more introns with regulatory roles since the highly expressed genes in plants are usually less compact and contain more and long introns compared to the low expression genes [31]. To identify the potential regulatory factors involved in dshsp90 gene expression, sequence analysis was performed of the 5′ upstream region of the dshsp90 gene. The regulatory elements were analyzed by the online software plantCARE [32], and the results are shown in Figure S3. The promoter region of dshsp90 beginning at −781 bp contained several canonical cis-acting elements such as CAAT box and TATA box to ensure the transcription start. Putative cis-elements responding to light, gibberellin, MeJA, abscisic acid (ABA) and cold stimulation were also identified. The existence of response elements to ABA and MYB binding site and the lack of the other stress-responsive elements such as DRE/CRT suggested that the expression of dshsp90 might be induced by stresses via the ABA-dependent pathway [33]. The putative transcription factor (TF) binding site was also analyzed by TFSEARCHER [34], which indicated that the promoter of dshsp90 had potential heat shock transcription factor (HSF) binding sites. It is worth noting that three Alfin1 putative binding sites were identified with the motif of GTGGNG or GNGGTG (Figure 4). Alfin1 has been shown to be a novel TF that binds to the promoter of salt-inducible genes [35]. Thus the in silico analysis suggested that dshsp90 might be involved in the salt response of the D. salina cells.
Figure 4

Sequence of the promoter region of dshsp90. The three Alfin1 putative binding sites with the motif of GTGGNG or GNGGTG are highlighted in red.

2.2. Biophysical and Biochemical Characterization of Recombinant DsHsp90

The analysis of the amino acid sequence indicated that DsHsp90 belongs to the Hsp90A family. To confirm this proposal, the recombinant DsHsp90 was produced in E. coli, and was purified to a homogenous state with only one single peak in the SEC elution profile (Figure 5A). From the SEC elution volume, the apparent molecular weight (MW) of DsHsp90 was calculated to be 191 kDa, which was slightly larger than the actual MW value of the dimeric DsHsp90 (159 kDa). This is consistent with the fact that the shape of the Hsp90A molecules deviated from the sphere shape [36], which will affect its position in the SEC profile. Nonetheless, it is clear that DsHsp90 mainly existed as a dimer in solution.
Figure 5

Biophysical and biochemical characterization of DsHsp90. (A) SEC profile of the recombinant DsHsp90 using a superdex G200 10/30 column. The apparent molecular weight was calculated from the standard curve obtained from the standard markers provided by GE Healthcare; (B) Far-UV CD spectrum of DsHsp90. The percentages of the secondary structures were determined using the CONTINLL, SELCON3 and CDSSTR algorithms within the CDPro analytical software [37]. The results are presented as the average ± standard error calculated from the values of the three methods; (C) ATPase activity of DsHsp90. The enzyme assay was conducted in the presence or absence of 5 mM ATP or 20 μg DsHsp90; (D) Predicted three-dimensional structure of DsHsp90 by SWISS-MODEL using the crystal structure of yeast Hsp90 (PDB ID: 2CG9) as the template structure. ND, MD and CD are the N-terminal domain, middle domain and C-terminal domain, respectively.

The structural features of DsHsp90 were evaluated by CD spectroscopy, which revealed that the recombinant DsHsp90 was well-folded containing both α-helical and β-sheet structures (Figure 5B). The percentages of the secondary structures were calculated by CDpro [37], and the three algorithms used for prediction gave rather consistent results. The predicted values are quite consistent with the crystal structures of Hsp90As. For example, the structure of yeast Hsp90 is composed of 32.3% α-helix and 310-helix, 16.7% β-sheet and 50.9% other secondary structures [36]. Since Hsp90s are ATPases, we also examined whether recombinant DsHsp90 possessed ATPase activity using the malachite green reagent method [38]. The data shown in Figure 5C clearly indicated that DsHsp90 could exhibit ATPase activity as revealed by the significant increase in the absorbance at 630 nm when compared to the controls that either lacked the substrate ATP or the enzyme DsHsp90. The three-dimensional structure of DsHsp90 was modeled using SWISS-MODEL using the yeast Hsp90 crystal structure [36] as the template. The modeled structure of DsHsp90 (Figure 5D) shared similar structural features to the Hsp90A family.

2.3. Relative Expression of the Dshsp90 Gene

The in silico analysis above indicated that dshsp90 might be a heat- or salt-inducible gene. To verify this proposal, real-time quantitative PCR was used to analyze the relative expressions of dshsp90 under heat and salt stress. As shown in Figure 6A, the transcriptional level of DsHsp90 increased immediately after heat shock, and reached its maximum after 30 min heat shock treatment. The maximum level of the dshsp90 transcript was about 7-fold of that without heat treatment. This observation confirmed that dshsp90 responded early upon heat shock, which might facilitate to stabilize its client proteins.
Figure 6

Relative fold increase of the expression level of dshsp90 and dsgpd transcripts during stress evaluated by quantitative RT-PCR. (A) Time-course study of the transcript level of dshsp90 after heat shock. Real-time quantitative PCR was carried out using the total RNA extracted from the D. salina cells after heat treatment at 37 °C for 0–120 min; (B) Time-course study of the transcript levels of dshsp90 and dsgpd after salt shock from 2 M to 4 M NaCl for 0–24 h. The expression level of ds18S was used as an internal control.

The D. salina cells have been shown to grow optimally in ~2 M NaCl [39], and a salt shock was performed by transferring the living conditions of the D. salina cells from 2 M to 4 M NaCl. Similar to the heat shock results, the amount of the dshsp90 transcripts increased immediately upon the salt stress and reached maximum after 30 min treatment (Figure 6B). The expression of dshsp90 was maintained at a high level for the duration of our experimental time of 24 h. Meanwhile, the expression level of dsgpd was not altered significantly during the first 6 h cultivation in 4 M NaCl, increased about three-fold at 12 h, and dropped to the normal level at 24 h. One possible explanation of the minor increase of the expression level of dsgpd during the first 6 h is that the osmotic-stress induced gene expression usually occurs 12–24 h after the salt shock [2], while the other possible reason is that the Dunaliella cells have already accumulated considerable amounts of glycerol to fight against the osmotic pressure under 2 M NaCl [6]. Nonetheless, the observations in Figure 6 suggested that dshsp90 was an early response gene to heat or salt stress. The high dshsp90 expression level under stress conditions also implied that DsHsp90 was essential for the Dunaliella cells to survive under extreme conditions.

3. Experimental Section

3.1. Chemicals

Tris, sodium dodecylsulfate (SDS), isopropyl-1-thio-β-d-galactopyranoside (IPTG), ATP, ammonium molybdate, malachite green oxalate, hydrochloride acid and tween-20 were Sigma products. All other chemicals were local products of analytical grade or higher. All restriction enzymes used in this study were purchased from TaKaRa (Shiga, Japan). The SMART™ RACE cDNA Amplification Kit was from Clontech (Palo Alto, CA, USA). The PMD18-T vector, LA Tag and RNAiso Plus kit was from TaKaRa (Shiga, Japan).

3.2. Algae and Growth Conditions

The green algae D. salina strain was bought from the Institute of Hydrobiology, the Chinese Academy of Sciences. The D. Salina cells were grown at 25 °C, illuminated at 4500 lux with a long-day condition (18 h light and 6 h dark) in medium comprising 2 M NaCl, 50 mM NaHCO3, 2.5 mM NaNO3, 5 mM MgSO4, 0.2 mM KH2 PO4, 6 μM EDTA, 2 μM FeCl3, 0.2 mM CaCl2, 7 μM MnCl2, 1 μM ZnSO4, 1 μM Co(NO3)2 and 1 μM CuSO4. The pH was adjusted to 7.5 using 2 M HCl. The Dualiella salina cells used in this study were collected at their logarithmic phase.

3.3. Gene Cloning and Sequence Analysis

The genome of D. salina was extracted by cetyltrimethylammonium bromide (CTAB) using the standard protocol [40], and the RNA was isolated by RNAiso Plus. The full length cDNA was obtained using the SMARTer™ RACE cDNA Amplification Kit. The whole cDNA was divided into two segments with an overlap, and two pairs of primers were designed accordingly to amplify these two segments by step-down PCR method (Table S1). PCR was run using the following conditions: 1cycle of denaturation at 95 °C/4 min followed by 30 three-round cycles of amplification (95 °C/30 sec, 59 °C, 56 °C, 53 °C/30 sec (5/5/20 cycles), 72 °C/3 min), finally extension at 72 °C/10 min. The PCR products were constructed to the pMD19-T vector, and were confirmed by DNA sequencing (Invitrogen, Shanghai, China). The boundaries of the introns and exons were identified by the Vector NTI 11 software. The promoter sequences were cloned by adaptor PCR using the genome walking method [41,42], and the GSP primers were designed according to the 5′-UTR region. The sequence was analyzed using plantCARE [32,43].

3.4. Material Treatments and Total RNA Isolation

50 mL algae cells in the logarithmic phase were collected for further processing. The heat shock treatment was performed by transferring the cells from 25 °C to 37 °C with the temperature controlled by water bath. The samples used for further time-course analysis were gathered after 15 min, 30 min, 60 min, 90 min and 120 min heat shock treatment. The salt shock was carried out by adding 5.844 g NaCl to 50 mL algae cell solutions, and the final concentration of NaCl was 4 M. The collected cells were treated by liquid nitrogen before total RNA isolation. RNA was isolated by RNAiso Plus, and contaminating DNA was degraded by treating each sample with RNase-free DNase. The total RNA was quantified by optical density and the quality was evaluated by gel electrophoresis by the intactness of the 28S and 18S rRNA subunit. One μg total RNA was reverse transcribed using ReverTra Ace (Toyobo, Japan) and random primer according to the manufacturers’ recommendations. The obtained cDNA was diluted 1:20 with H2O prior to the quantitative PCR analysis.

3.5. Quantitative PCR with SYBR Green

The relative gene expressions of DsHsp90 and DsGPD (Accession No.AY845323.1) in D. salina were analyzed by real-time quantitative reverse-transcription PCR. The relative abundance of the ds18S gene (Accession No. EF195157.1) was also determined and used as the internal control. For each transcript, a standard curve was constructed using the purified PCR product generated for each specific primer pair. The 20 μL reaction solutions contained 4 μL diluted cDNA, 10 pmol primer, 4 μL H2O and 10 μL SYBR Green real time PCR master mix (TOYOBO, Japan). The real time qPCR was run on iQ5(Bio-Rad) with 1 cycle of denaturation at 95 °C/10 min, followed by 40 two-segment cycles of amplification (95 °C/30 sec, 55 °C (18S and GPD) or 57 °C (Hsp90)/15 sec, 72 °C/15 sec). The fluorescence was measured during PCR and one three-segment cycle of product melting (95 °C/1 min, 55 °C/30 sec, 95 °C/30 sec). The baseline adjustment method of the Bio-RadiQ5 software was used to determine the Ct in each reaction. A melting curve was constructed for each primer pair to verify the presence of one gene-specific peak and the absence of primer dimer. All samples were repeated three times.

3.6. Protein Expression and Purification

After digestion of the PCR product and of the plasmid pET28a with NdeI and BamHI, the dshsp90 gene was ligated into the expression vector pET28a (Novagen). The six-His Tag sequence of pET28a vector was fused to the N-terminus of the open reading frame for further purification. The recombinant plasmids were then transformed into E. coli BL21(DE3) (Novagen). The recombinant strain was inoculated into 5 mL of Luria–Bertani medium supplemented with 50 μg/mL kanamycin and grown overnight at 200 r/min and 37 °C. The cultures were diluted (1:100) in the same medium and grown at 37 °C to reach an OD value of 0.6–0.8, and then the recombinant protein expression was induced by the addition of 1 mM IPTG. After 4 h induction at 37 °C, the cultures were harvested and sonicated. The His-tagged recombinant proteins in the soluble fractions were first purified by the metal-chelated affinity chromatography using a 1 mL Pharmacia Ni-NTA His-Bind column, followed by a further step of purification by Mono Q 5/50 GL anion-exchange chromatography. The final products were collected after purification by size exclusion chromatography (SEC) using a Superdex G200 column equipped on an ÄKTA purification system. The buffer used for gel filtration contained 40 mM HEPES and 25 mM KCl, pH 7.5. The purified proteins were found to be homogeneous by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and SEC analysis, and the purity of the final products was above 98%.

3.7. ATPase Activity Assay

The ATPase activity of DsHsp90 was determined by the liberation of inorganic phosphate using a modified procedure [44] of the malachite green reagent method [38]. In brief, the working reagent to terminate the reaction was freshly prepared by mixing 130 mM Malachite Green, 7.5% (w/v) ammonium molybdate and 11% (v/v) Tween-20 with a volume ratio of 10:2.5:0.2. The reaction solution contained the enzyme in 40 mM HEPES and 100 mM KCl, pH 7.5, with the addition of 5 mM ATP. The reaction was terminated after 30 min reaction by adding 400 μL hydrochloride acid, 500 μL water and 250 μL working reagent in 100 μL reaction solutions. After 10 min equilibrium, the absorbance at 630 nm was recorded.

3.8. Spectroscopy

The samples used for spectroscopic experiments were prepared by dissolving the protein in 50 mM Tris-HCl buffer containing 25 mM KCl, pH 7.5, with a final protein concentration of 0.2 mg/mL. Far-UV circular dichroism (CD) spectra were recorded on a Jasco 715 spectrophotometer with a 1 mm pathlength cell. The resultant spectrum was baseline-subtracted versus the buffer spectrum. The percentages of the secondary structures were determined from the CD spectrum with a wavelength range of 200–250 nm using the CONTINLL, SELCON3 and CDSSTR algorithms within the CDPro analytical software [37]. The results were presented as the average ± standard error calculated from the values of the three methods.

3.9. Homology Modeling

The automated protein structure homology modeling was performed using the online software SWISS-MODEL in the project mode [45]. The crystal structure of Hsp90 from Saccharomyces cerevisiae (PDB ID: 2CG9) [36] was used as the template structure. The model structure of DsHsp90 was manipulated and rendered in PyMol (Available online: http://www.pymol.org/).

4. Conclusions

In this research, we cloned the dshsp90 gene encoding a polypeptide composed of 696 amino acids from the halotolerant unicellular green algae D. salina. Sequence alignment indicated that DsHsp90 shares high homology to the cytosolic Hsp90 family with conserved motifs characteristic of Hsp90A. Further biophysical and biochemical studies of the recombinant protein revealed that DsHsp90 possessed ATPase activity and existed as a dimer with similar percentages of secondary structures to those well-studied Hsp90As. Thus the gene was named dshsp90 according to its structure and function relationship to the Hsp90A family. Analysis of the nucleotide sequence of the cloned genomic DNA fragment indicated that dshsp90 contained 21 exons interrupted by 20 introns, which is much more complicated than the other plant hsp90 genes. Such a large number of introns of dshsp90 suggested that it might be a highly expressed gene containing more introns with regulatory roles. The promoter region of dshsp90 contained putative cis-acting stress-responsive elements and binding sites of transcriptional factors that respond to heat shock and salt stress. Further experimental study confirmed that the dshsp90 transcripts were induced early by heat shock and salt shock, suggesting that dshsp90 was involved in the early response of the D. salina cells against environmental stresses. The characterization of dshsp90 provides a starting point for further investigation of the role of dshsp90 in the haloadaption mechanism of D. salina.
  41 in total

1.  PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.

Authors:  Magali Lescot; Patrice Déhais; Gert Thijs; Kathleen Marchal; Yves Moreau; Yves Van de Peer; Pierre Rouzé; Stephane Rombauts
Journal:  Nucleic Acids Res       Date:  2002-01-01       Impact factor: 16.971

2.  Rates of intron loss and gain: implications for early eukaryotic evolution.

Authors:  Scott William Roy; Walter Gilbert
Journal:  Proc Natl Acad Sci U S A       Date:  2005-04-12       Impact factor: 11.205

3.  In plants, highly expressed genes are the least compact.

Authors:  Xin-Ying Ren; Oscar Vorst; Mark W E J Fiers; Willem J Stiekema; Jan-Peter Nap
Journal:  Trends Genet       Date:  2006-08-24       Impact factor: 11.639

4.  Crystal structure of an Hsp90-nucleotide-p23/Sba1 closed chaperone complex.

Authors:  Maruf M U Ali; S Mark Roe; Cara K Vaughan; Phillipe Meyer; Barry Panaretou; Peter W Piper; Chrisostomos Prodromou; Laurence H Pearl
Journal:  Nature       Date:  2006-04-20       Impact factor: 49.962

Review 5.  A survey on intron and exon lengths.

Authors:  J D Hawkins
Journal:  Nucleic Acids Res       Date:  1988-11-11       Impact factor: 16.971

Review 6.  HSP90 manages the ends.

Authors:  Diane C DeZwaan; Brian C Freeman
Journal:  Trends Biochem Sci       Date:  2010-03-16       Impact factor: 13.807

7.  Cdc37p is involved in osmoadaptation and controls high osmolarity-induced cross-talk via the MAP kinase Kss1p.

Authors:  Xiao-Xian Yang; Patricija Hawle; Jan Paul Bebelman; Annemarie Meenhuis; Marco Siderius; Saskia M van der Vies
Journal:  FEMS Yeast Res       Date:  2007-04-20       Impact factor: 2.796

8.  Phylogenetic analysis of the 90 kD heat shock family of protein sequences and an examination of the relationship among animals, plants, and fungi species.

Authors:  R S Gupta
Journal:  Mol Biol Evol       Date:  1995-11       Impact factor: 16.240

9.  Salt-induced changes in the plasma membrane proteome of the halotolerant alga Dunaliella salina as revealed by blue native gel electrophoresis and nano-LC-MS/MS analysis.

Authors:  Adriana Katz; Patrice Waridel; Andrej Shevchenko; Uri Pick
Journal:  Mol Cell Proteomics       Date:  2007-06-14       Impact factor: 5.911

10.  Chromosomal mapping and zygosity check of transgenes based on flanking genome sequences determined by genomic walking.

Authors:  Akira Noguchi; Naho Takekawa; Thorbjorg Einarsdottir; Minako Koura; Yoko Noguchi; Kaoru Takano; Yoshie Yamamoto; Junichiro Matsuda; Osamu Suzuki
Journal:  Exp Anim       Date:  2004-04
View more
  5 in total

1.  Transcriptomic Characterization of Tambaqui (Colossoma macropomum, Cuvier, 1818) Exposed to Three Climate Change Scenarios.

Authors:  Marcos Prado-Lima; Adalberto Luis Val
Journal:  PLoS One       Date:  2016-03-28       Impact factor: 3.240

2.  Analysis of carotenogenic genes promoters and WRKY transcription factors in response to salt stress in Dunaliella bardawil.

Authors:  Ming-Hua Liang; Jian-Guo Jiang
Journal:  Sci Rep       Date:  2017-01-27       Impact factor: 4.379

3.  The Carotenogenic Dunaliella salina CCAP 19/20 Produces Enhanced Levels of Carotenoid under Specific Nutrients Limitation.

Authors:  Sushanta Kumar Saha; Naresh Kazipet; Patrick Murray
Journal:  Biomed Res Int       Date:  2018-04-30       Impact factor: 3.411

4.  Liver transcriptome analysis reveals extensive transcriptional plasticity during acclimation to low salinity in Cynoglossus semilaevis.

Authors:  Yufeng Si; Haishen Wen; Yun Li; Feng He; Jifang Li; Siping Li; Huiwen He
Journal:  BMC Genomics       Date:  2018-06-18       Impact factor: 3.969

5.  Osmotic Stress Induced Cell Death in Wheat Is Alleviated by Tauroursodeoxycholic Acid and Involves Endoplasmic Reticulum Stress-Related Gene Expression.

Authors:  Liting Zhang; Zeyu Xin; Xing Yu; Chao Ma; Weiwei Liang; Meichen Zhu; Qiwei Cheng; Zongzhen Li; Yanan Niu; Yongzhe Ren; Zhiqiang Wang; Tongbao Lin
Journal:  Front Plant Sci       Date:  2017-05-03       Impact factor: 5.753

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.