| Literature DB >> 22911717 |
Alfonso H Magadán1, Marie-Ève Dupuis, Manuela Villion, Sylvain Moineau.
Abstract
Streptococcus thermophilus, similar to other Bacteria and Archaea, has developed defense mechanisms to protect cells against invasion by foreign nucleic acids, such as virus infections and plasmid transformations. One defense system recently described in these organisms is the CRISPR-Cas system (Clustered Regularly Interspaced Short Palindromic Repeats loci coupled to CRISPR-associated genes). Two S. thermophilus CRISPR-Cas systems, CRISPR1-Cas and CRISPR3-Cas, have been shown to actively block phage infection. The CRISPR1-Cas system interferes by cleaving foreign dsDNA entering the cell in a length-specific and orientation-dependant manner. Here, we show that the S. thermophilus CRISPR3-Cas system acts by cleaving phage dsDNA genomes at the same specific position inside the targeted protospacer as observed with the CRISPR1-Cas system. Only one cleavage site was observed in all tested strains. Moreover, we observed that the CRISPR1-Cas and CRISPR3-Cas systems are compatible and, when both systems are present within the same cell, provide increased resistance against phage infection by both cleaving the invading dsDNA. We also determined that overall phage resistance efficiency is correlated to the total number of newly acquired spacers in both CRISPR loci.Entities:
Mesh:
Substances:
Year: 2012 PMID: 22911717 PMCID: PMC3401199 DOI: 10.1371/journal.pone.0040913
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Figure 1Architecture of CRISPR1-Cas and CRISPR3-Cas systems of S. thermophilus DGCC7710.
A. CRISPR loci are represented by grey boxes. The percentages of amino acid identity between the Cas protein sequences are indicated in the grey shading. The percentages of identity were calculated by dividing the number of identical residues per the length of the alignment (i.e., the higher protein size). B. Csn2 amino acid alignment of CRISPR1-Cas and CRISPR3-Cas systems. Bars, dots, and hyphens emphase identical amino acids and gaps, respectively. Numbers at the right side are the positions on the related protein sequence. EMBOSS Needle (from the European Bioinformatics Institute) was used to align protein sequences (http://www.ebi.ac.uk/Tools/psa/emboss_needle/).
Characteristics of S. thermophilus DGCC7710 BIMs.
| Bacteriophage-insensitive mutants (%) | |
| N° of BIMs | 320 |
| This study | 292/320 (91.3) |
| Deveau | 26/320 (8.1) |
| Garneau | 2/320 (0.6) |
| CRISPR loci of BIMs | |
| CRISPR1 | 288/320 (90.0) |
| CRISPR3 | 30/320 (9.4) |
| CRISPR1-CRISPR3 | 2/320 (0.6) |
| N° of deletions | 2/320 (0.6) |
| N° of single insertions | 302/320 (94.4) |
| N° of multiple insertions | 18/320 (5.6) |
| CRISPR1 double | 14/18 (77.8) |
| CRISPR3 double | 1/18 (5.6) |
| CRISPR1-CRISPR3 | 2/18 (11.1) |
| Quadruple | 1/18 (5.6) |
|
| |
| N° of identified spacers | 338 |
| CRISPR1 | 307/338 (90.8) |
| CRISPR3 | 31/338 (9.2) |
| N° of different spacers | 163/338 (48.2) |
| CRISPR1 | 139/307 (45.3) |
| CRISPR3 | 24/31 (77.4) |
| Spacers length CRISPR1 | |
| <30 nt < | 31/307 (10.1) |
| = 30 nt | 276/307 (89.9) |
| Spacers length CRISPR3 | |
| <30 nt < | 1/31 (3.2) |
| = 30 nt | 30/31 (96.8) |
|
| |
| N° of different CRISPR1 | 139 |
| Coding strand | 98/139 (70.5) |
| Non-coding strand | 41/139 (29.5) |
| N° of different CRISPR3 | 22 |
| Coding strand | 14/22 (63.6) |
| Non-coding strand | 8/22 (36.4) |
Only in CRISPR1.
List of spacers found in S. thermophilus CRISPR3 loci.
| Spacer | Position | Length | Sequence (5′→3′) | PAM | ORF; function |
| S61 | 2095–2066 | 30 |
| GGGCG | ORF3; large terminase |
| S62 | 3181–3152 | 30 |
| TGGTG | ORF5; portal protein |
| S63 | 3713–3742 | 30 |
| TGGTG | ORF5; portal protein |
| S64 | 6300–6329 | 30 |
| TGGCG | ORF8; capsid protein |
| S65 | 6515–6544 | 30 |
| AGGAG | ORF8; capsid protein |
| S66 | 6978–7007 | 30 |
| TGGAG | ORF9; capsid protein |
| S67 | 13,754–13,783 | 30 |
| TGGCG | ORF18; MTP |
| S68 | 17,665–17,636 | 30 |
| TGGTG | ORF20; RBP |
| S69 | 21,076–21,105 | 30 |
| AGGTG | ORF20; RBP |
| S70 | 21,346–21,375 | 30 |
| AGGAG | ORF20; RBP |
| S71 | 21,670–21,699 | 30 |
| TGGTG | ORF21; tail protein |
| S72 | 23,182–23,211 | 30 |
| TGGGG | ORF21; tail protein |
| S73 | 23,329–23,300 | 30 |
| AGGGG | ORF21; tail protein |
| S74 | 24,038–24,067 | 30 |
| TGGCG | ORF24; unknown |
| S75 | 24,325–24,354 | 30 |
| GGGAG | ORF24; unknown |
| S76 | 25,297–25,326 | 30 |
| CGGTG | ORF26–ORF27** |
| S77 | 26,729–26,758 | 30 |
| TGGTG | ORF32–ORF33** |
| S78 | 26,917–26,946 | 30 |
| GGGAG | ORF32–ORF33** |
| S79 | 27,975–28,004 | 30 |
| TGGCG | ORF34; SSAP |
| S80 | 28,087–28,058 | 30 |
| TGGCG | ORF34; SSAP |
| S81 | 29,120–29,091 | 30 |
| CGGCG | ORF35; helicase |
| S82 | 29,121–29,091 | 31 |
| CGGCG | ORF35; helicase |
| S83 | 30,033–30,004 | 30 |
| TGGTG | ORF37; replication |
| S84 | 34,662–34,633 | 30 |
| TGGTG | ORF44; unknown |
| S85* | 16,681–16,652 | 30 |
| ATAGAAA | ORF20; RBP |
| S86* | 29,923–29,894 | 30 |
| TTAGAAT | ORF37; replication |
These spacers from CRISPR1 locus are specified (*) since they were acquired in BIMs having double spacer acquisitions in this study.
The position of the protospacer in the phage 2972 genome.
PAMs are 5′-NNAGAAW-3′ and 5′-NGGNG-3′ for CRISPR1 and CRISPR3 protospacers, respectively. Consensus nucleotides are underlined.
Spacers found in intergenic regions are also specified (**).
MTP: major tail protein; RBP: Receptor Binding Protein; SSAP: Single Strand Annealing Protein.
S. thermophilus BIMs used in the study and details on cleavage and EOP.
| Strain name | Other name | Spacer names | CRISPR loci | Sequence (5′ → 3′) | PAM | EOP values |
| DGCC7710Φ2972 +S4 | BIM S4 | S4 | CRISPR1 | CTCAGTCGTT | TG | (6.7±5.4)×10−6 |
| DGCC7710Φ2972 +S85 | BIM S85 | S85 | CRISPR1 | TGTTTCAAGGTTTCGGGTCCAAGTATC | AT | (3.0±2.0)×10−6 |
| DGCC7710Φ2972 +S73 | BIM S73 | S73 | CRISPR3 | TATTTGGGCGTGAGTATTGTAACTTCC | A | (3.6±1.7)×10−4 |
| DGCC7710Φ2972 +S77 | BIM S77 | S77 | CRISPR3 | TAAACCGTTCTTCAATCCGTAGCCACA | T | (9.6±0.8)×10−6 |
| DGCC7710Φ2972 +S79 | BIM S79 | S79 | CRISPR3 | TGCTCGACTTGTTAAAAAAACTACTGA | T | (6.9±4.0)×10−6 |
| DGCC7710Φ2972 +S81 | BIM S81 | S81 | CRISPR3 | TATTAACACCTTTTAGTGACCATTCAC | C | (1.1±0.4)×10−5 |
| DGCC7710Φ2972 +S82 | BIM S82 | S82 | CRISPR3 | TTATTAACACCTTTTAGTGACCATTCAC | C | (9.4±3.0)×10−6 |
| DGCC7710Φ2972 +S61+S85 | BIM S61/S85 | S61 | CRISPR3 | CAAAATATCTCTATCGTAGAATTTGCC | G | <10−8 |
| S85 | CRISPR1 | TGTTTCAAGGTTTCGGGTCCAAGTATC | AT | |||
| DGCC7710Φ2972 +S75+S86 | BIM S75/S86 | S75 | CRISPR3 | AAACACAGATGTTTTAGACCATGCGCA | G | <10−8 |
| S86 | CRISPR1 | TTATGGAGATGGTTGATTACGCAATCA | TT | |||
| DGCC7710Φ2972 +S61+S78 | BIM S61/S78 | S61 | CRISPR3 | CAAAATATCTCTATCGTAGAATTTGCC | G | <10−8 |
| S78 | CRISPR3 | CCATGAAAACATTTAAAATTACAACAA | G |
The other names are used in the text to help the reading.
BIM S4 was characterized elsewhere [12], [15] and used here as a control.
Experimentally proved cleavage site are symbolized with plain arrows, previously published [12], [15] cleavage sites are represented by clear arrows, whereas not experimentally determined cleavage sites are represented by grey arrows.
PAMs are 5′-NNAGAAW-3′ and 5′-NGGNG-3′ for CRISPR1 and CRISPR3 protospacers, respectively. Consensus nucleotides are underlined.
EOPs are the mean of at least three independent assays.
Figure 2Simultaneous cleavage of phage DNA by CRISPR1-Cas and CRISPR3-Cas systems of S. thermophilus BIMs.
A. Representation of the phage 2972 genome. Arrows symbolize the open reading frames (ORFs) as identified previously [18] and colors indicate associated transcriptional modules [24]. Three protospacers (PS61, PS78 and PS85) are positioned below the genome and the CRISPR-Cas systems that have acquired the respective spacers are specified (CRISPR1 or CRISPR3). B. The fragment sizes obtained from restriction and/or CRISPR digestion are specified. Probes used in the Southern blot assays are also indicated and details of the primers used are presented in Supplemental Table S1. C. Comparison by Southern blot assays of CRISPR-Cas cleavage occurring in the two selected BIMs S61/S78, and S61/S85, which share the S61 spacer (CRISPR3), but not a second spacer (CRISPR3 and CRISPR1, respectively). The Southern profiles show that independent cleavage of CRISPR1-Cas (PS85) and CRISPR3-Cas (PS61 and PS78) systems can occur simultaneously, when infected by phage 2972. Corresponding cleavage bands are identified with asterisks, and their sizes are specified. The two BIMs were infected with phage 2972 for 45 minutes before total DNA was extracted. Five micrograms of SpeI-restricted DNA was then loaded in each lane. NI, non-infected strain. C+, 10 ng of 2972 phage DNA digested with SpeI.
Figure 3Determination of the cleavage site in 2972 phage genome by the BIM S79 CRISPR3-Cas system.
Nucleotide positions of the phage genome sequence are given for each fragment and the CRISPR3 PAM is underlined. A. Phage 2972 genome sequence showing the protospacer PS79 and surrounding regions. The protospacer’s nucleotide positions (1st, 27th, and 30th) are indicated by a vertical black line to highlight the distal dsDNA cleavage position occurring after the 27th nucleotide, at the extremity near the PAM (5′-NGGNG-3′). B. Sequencing chromatograms of inverse PCR reactions following intramolecular ligation of the 3′-PS79 end, produced by CRISPR3 cleavage, and the blunt–end, produced by DraI restriction. C. Sequencing chromatograms of inverse PCR reactions following intramolecular ligation of the 5′-PS79 end, produced by CRISPR3 cleavage, and the blunt–end, produced by SspI restriction. In both B and C, the joining point corresponding to the ligation of both extremities is indicated.