Literature DB >> 22773102

Functional characterization of an active Rag-like transposase.

Cary G Hencken1, Xianghong Li, Nancy L Craig.   

Abstract

The formation of diverse immunoglobulin genes results in part from Rag protein-mediated DNA double-strand breaks at the edges of immunoglobulin gene segments, followed by combinatorial reassembly of these segments. We report that a Transib transposase from the insect Helicoverpa zea is active in vitro and that its breakage and joining activities mimic those of Rag, providing strong evidence that Rag and Transib transposases were derived from a common progenitor.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22773102      PMCID: PMC3414642          DOI: 10.1038/nsmb.2338

Source DB:  PubMed          Journal:  Nat Struct Mol Biol        ISSN: 1545-9985            Impact factor:   15.369


The assembly of an immunoglobulin gene mimics transposon excision, followed by joining of the flanking donor sites to form the coding gene segments[1] (Supplementary Figure 1). This excised intervening segment from an immunoglobulin gene can also mimic transposon insertion in vitro by inserting into a target DNA[2,3]. Sequence similarities between the Rag1 subunit of Rag protein that mediates immunoglobulin breakage and joining and the transposases of the fossil Transib transposon superfamily suggested that the core region of Rag1 was derived from a Transib transposon[4]. We have characterized an active Transib transposase and have found that the transposase from the Transib transposon called Hztransib of Helicoverpa zea [5], is active in vitro. Notably, the mechanism of its breakage and joining activities are like those of Rag, providing strong evidence that Rag1 and Transibs were derived from a common progenitor. Hztransib was found in the insect cotton and corn bollworm pest Helicoverpa zea[5], by genome sequencing of the region around a Cytochrome P450 gene of interest. The fact that there is variation in its genomic position and copy number in different populations suggested that it might be a still active element[6]. To analyze its activity directly, we isolated the Hztransib transposase by tagging the ORF with a hexahistidine tag, expressing it in E. coli and affinity purifying the protein. To evaluate Hztransib's ability to excise the transposon end from flanking DNA and then join it to a target, we used a DNA fragment containing a 51 bp Hztransib end sequence and 37 bp of flanking DNA in which the interior 5′ end of the transposon was labeled as a substrate in reaction mixtures using a plasmid as target DNA and then displayed the products on a native agarose gel (Figure 1). Two products are visible in these reactions, one in which a single transposon end oligonucleotide joins to the plasmid target DNA, giving a nicked circle product (Single End Join = SEJ); alternatively, if two end oligonucleotides join at the same target position, the plasmid is linearized (Double End Join = DEJ) (Figure 1, lane 2).
Figure 1

Hztransib transposase can promote coupled cleavage and strand transfer

a. The pathway of transposition. The transposase introduces a double strand break between a transposon end and the flanking donor DNA to expose the 3′ OH transposon end. The joining of one 3′ OH to one target strand a plasmid target generates a nicked circle product (Single End Join; SEJ). The joining of two 3′ OH ends to two target strands at complementary positions in a single target plasmid yields a linearized version of the plasmid attached to the two end oligonucleotides (Double End Join; DEJ).

b. Reactions contained wildtype or mutant Hztransib transposase as indicated. We suspect the lower transposase-dependent band likely results from end binding.

Mutational analysis of many transposases, integrases and the Rag1 subunit of Rag has identified three conserved acidic amino acids essential for catalytic activity that lie on an RNase H-like fold that closely juxtaposes them to bind essential divalent metal, usually Mg2+, ions at the catalytic center[7,8]. These positions are conserved in Transibs[4]. Hztransib residues Asp126, Asp225, and Glu436 align with the cognate amino acids in the Rag1 subunit (Supplementary Figure 2) and mutation of these conserved amino acids in Hztransib significantly decreases the excision and target joining reaction (Figure 1, lanes 3-5). Such active site mutations also block Rag-mediated DNA end cleavage and target joining[8]. The double strand breaks at the RSSs promoted by Rag involve both a hydrolysis reaction and a direct transesterification that occur by mechanisms used by other transposases and integrases[7]. Rag DNA breakage initiates with a nick that frees the 5′ end of the RSS from the flanking coding DNA segment[1]. The newly exposed coding segment 3′ OH then attacks its complementary strand, generating a hairpin on the coding DNA and introducing the double strand break that frees the RSS-bounded segment. Cellular enzymes open the hairpins and join the coding segments to form the immunoglobulin genes[1]. To analyze the mechanism by which Hztransib makes the double strand break at the transposon end to separate it from the flanking DNA, we used a DNA substrate fragment containing a 51 bp Hztransib end sequence and 37 bp of flanking DNA in which the interior 5′ end of the transposon and the flanking DNA was labeled and displayed the reaction products on a denaturing acrylamide gel (Figure 2a). The 37 nt species is the donor top strand fragment resulting from nicking at the junction of the flanking DNA with the top transposon strand (Figure 2b, lane 2). This nicking position is identical to that of Rag and distinct from that of hAT transposases that also excise via hairpin formation, which are initiated by a nick one nucleotide into the flanking donor DNA[9]. Present at lower amount is the 51 nt, 3′ OH transposon bottom strand fragment that results from the double strand break that separates the transposon end from the flanking donor DNA. We also assayed the Hztransib transposases with active site Asp126, Asp225, and Glu436 mutations, finding that nicking is not detectable (Figure 2b lanes 3,4) or is reduced (lane 5). We suspect that the residual nicking activity with the Hztransib mutant E436A results from the use of Mn2+ rather than Mg2+ as a co-factor[10](see also below). No recombination was observed using Mg2+ as a cofactor (data not shown).
Figure 2

Analysis of the Hztransib DNA cleavage mechanism

a. The mechanism of transposition. Transposition begins with a nick at the 5′ end of the transposon end. The newly exposed donor 3′ OH then attacks the complementary strand to form a hairpin and release the transposon end.

b. In vitro transposition reactions were carried out using the transposon end fragments labeled as indicated, transposases as indicated and displayed on a denaturing acrylamide gel. The image is of a single gel with a masked lane.

With Rag, cleavage of the bottom strand occurs when the 3′ OH on the newly released donor top strand attacks its complementary strand, forming a hairpin on the flanking DNA. Such a hairpin is faintly visible in an incubation using WT protein and an intact oligonucleotide as a substrate (Figure 2b, lane 2). The hairpin is much more prominent, however, when a substrate “pre-nicked” at the 5′ end of the transposon is used as a substrate (Figure 2b, lane 7). A series of species is evident, the most slowly migrating of which co-migrates with an authentic 74 nt hairpin, indicating that the Hztransib transposase generates a double strand break via a hairpin. The ladder of species below the authentic hairpin may reflect degradation at the 3′ end of the hairpin or imprecise hairpinning; the use of the recessed 3′ OH in the 32 nt product may contribute to such imprecise hairpinning. Such species are not evident with a substrate that is pre-nicked to expose the 3′ OH end of the transposon (data not shown). As is also true with Rag containing mutations in Rag1[7,8], reduced hairpinning is observed using the Hztransib transposase active site mutants D126A, D225A, and E436A (Figure 2b, lanes 8-10). We suggest that the residual nicking activity with the Hztransib mutant E345A results from the use of Mn2+ as a co-factor[10]. We also find that Hztransib can promote target joining in vitro to form SEJs and DEJs using a “pre-cleaved” transposon end substrate in which the terminal 3′ OH is already exposed (Figure 3a). We observe about the same amount of SEJ and DEJ products using a 50 bp Hztransib end as with a 294 bp Hztransib ends (data not shown). As occurs with Rag1 mutants [8], less target joining is observed using the active site mutants D126A, D225A, and E436A Hztransib transposases (Figure 3b). We suggest that the residual target joining activity with the Hztransib mutants results from the use of high amounts of Mn2+ as a co-factor[10] (Supplemental Figure 3). When a reaction using a transposon fragment labeled at its interior 5′ end is displayed on a denaturing gel (Figure 3c), a product the length plasmid plus the transposon end is observed, consistent with joining of the 3′ OH end to the target DNA.
Figure 3

Hztransib Transposition in vitro using pre-cleaved transposon ends

a. Target joining by decreasing amounts of wildtype transposase. The reactions contained 1×, 1/3×, 1/9× and 1/27× transposase.

b. Target joining by transposase mutants. The transposon end substrate was a 294 bp Hztransib left end labeled at both 5′ ends (asterisk) and reactions contained wildtype or mutant Hztransib transposase as indicated. The reaction products were displayed on a native agarose gel.

c. The 3′ OH transposon end joins to target DNA. The transposon end substrate was a 50 bp Hztransib left end labeled only at the internal 5′ end* (asterisk) of the strand that joins covalently to target DNA.

Finally, to further analyze the structure the products formed by the joining of Hztransib ends to a target DNA, we constructed a miniHztransib transposon in which 50 bp Hztransib ends flanked a KanR gene fragment, incubated it with a target plasmid and transposase, and recovered insertion products by selection for KanR following transformation in E. coli. DNA sequence analysis of 44 insertions at different sites revealed that all had perfect 5 bp target site duplications that were enriched with 5′ CGnCG as occurs with RAG[1,3] (Supplementary Figure 4). Transposition is reduced more than 20-fold when the Hztransib transposases mutated at the conserved RNase H residues D126A, D225A, and E436A are used in the transformation transposition assay (Supplementary Figure 4). These experiments have revealed that a Transib transposase uses the same mechanism for the same breakage and joining reactions as does the immunoglobulin gene recombinase Rag. The nick that initiates the double strand break occurs exactly at the junction of the transposon end and the flanking donor DNA, the subsequent double strand break occurs by hairpinning of the exposed 3′ OH donor end to its complementary strand, and the released 3′ OH end of the transposon directly attacks the target DNA. Moreover, mutation of a conserved catalytic triad of amino acids in both Rag1 and Hztransib transposase block breakage and joining. This functional analysis provides strong evidence that Rag and Transib transposases are descended from a common progenitor.

ONLINE METHODS

Cell Growth and Transposase Purification

An E. coli codon-optimized version of the Hztransib transposase gene was synthesized by DNA2.0 and cloned into the NcoI-EcoRI sites of the pBAD Myc/His (Invitrogen) vector and expressed in Top10 cells. One liter of cells was grown in LB + 100 ug/mL carbenecillin until about OD600 0.7, arabinose was added to 0.01% and cell growth continued overnight at 16°C. The cells were chilled, harvested by centrifugation and then resuspended in 10 ml Column Buffer (5 mM imidazole, 500 mM NaCl, 20 mM Tris (pH 7.8), 10 % glycerol). The cells were lysed in a French press, the lysate spun at 36,000 rpm for 70 min, the resulting supernatant filtered through a 0.45 um syringe filter and then diluted 1:1 with column buffer. The lysate was then loaded onto a 1 ml Nickel Sepharose, washed with 15 ml Column buffer, washed with Wash buffer (40 mM imidazole, 500 mM NaCl, 20 mM Tris (pH 7.8), 10 % glycerol), transposase eluted with Elution buffer (150 mM imidazole, 500 mM NaCl, 20 mM Tris (pH 7.8), 10 % glycerol) and dialyzed in Storage buffer (500 mM NaCl, 1 mM EDTA, 2 mM DTT, 20 mM Tris (pH 7.8), 25 % glycerol). The final protein concentration was 1 mg/ml and Hztransib transposase was about 5-10 % of the total protein. Hztransib transposase mutants, D126A, D225A and E436A were generated using the Quick Change Site Directed Mutagenesis Kit (Stratagene) and the pBAD-Hztransib plasmid using the following oligonucleotides: Hz D1mut-Forward 5′CTAAATGGGGTTTCGCCGGCGCATCGAATCAG and Hz D1mut-Reverse 5′CTGATTCGATGCGCCGGCGAAACCCCATTTAG; Hz D2mut-For 5′ GATGACCATGATCGCCGGTAAGATCTGTACC and Hz D2mut-Rev 5′ GGTACAGATCTTACCGGCGATCATGGTCATC; and Hz Emut-For 5′GAAGAGGCGAGCGCGGCGCGCAACAAG and Hz Emut-Rev 5′CTTGTTGCGCGCCGCGCTCGCCTCTTC.

Transposon end fragments

DNA fragments and oligonucleotides were end-labeled using [γ-32P] ATP and T4 polynucleotide kinase. A 294 bp Hztransib L end was synthesized by DNA2.0 and cloned into their pJ201 vector. Short double-stranded DNA segments were assembled by incubating oligonucleotides together at 75°C, followed by cooling for 4 hours. The flanking DNA + transposon end substrate used in Figure 1 was assembled using oligonucleotides CGH10 GCTAGTAACGGCCGCCAGTGTGCTAAGTGCAACGTCGCACGGTGGATCGAAAATC GGCTCTAGAAGACATAGGATCTCGATGTCTCAA and 5′ end labeled CGH11 5′ TTGAGACATCGAGATCCTATGTCTTCTAGAGCCGATTTTCGATCCACCGTGCGA CGTTGCACTTAGCACACTGGCGGCCGTTACTAGC. The flanking DNA + transposon end substrate used in Figure 2 lanes 1-5 was assembled using 5′ end labeled oligonucleotides CGH10 GCTAGTAACGGCCGCCAGTGTGCTAAGTGCAACGTCGCACGGTGGATCGAAAATC GGCTCTAGAAGACATAGGATCTCGATGTCTCAA and CGH11 5′ TTGAGACATCGAGATCCTATGTCTTCTAGAGCCGATTTTCGATCCACCGTGCGA CGTTGCACTTAGCACACTGGCGGCCGTTACTAGC. The pre-nicked flanking DNA + transposon end substrate used in Figure 2 lanes 6-10 was assembled from oligonucleotides 5′ end-labeled CGH12 5′ GCTAGTAACGGCCGCCAGTGTGCTAAGTGCAACGTCG, CGH2 5′ CACGGTGGATCGAAAATCGGCTCTAGAAGACATAGGATCTCGATGTCTCAA and CGH11 5′ TTGAGACATCGAGATCCTATGTCTTCTAGAGCCGATTTTCGATCCACCGTGCGA CGTTGCACTTAGCACACTGGCGGCCGTTACTAGC. The 294 bp Hztransib L end fragment used on Figure 3a and b was generated by PCR from the Hztransib L end in pJ201 by PCR amplification with the 5′ end labeled primers (Hztransib = bold) 5′ CACGGTGGATCGAAAATCGGCT and 5′ CGCAAGTGATGCCGCAATATG. The pre-cleaved 50 bp Hztransib end fragment used in Figure 3d was assembled from oligonucleotides 5′ CACGGTGGATCGAAAATCGGCTCTAGAAGACATAGGATCTCGATGTCTCAA and 5′ TTGAGACATCGAGATCCTATGTCTTCTAGAGCCGATTTTCGATCCACCGTG. The Hztransib L50-KanR-R50 fragment used in Supplementary Figure 4 was generated by PCR using a Kan gene as template with the primers 5′ CACGGTGGATCGAAAATCGGCTCTAGAAGACATAGGATCTCGATGTCTCAACA CTAGTATTACCCTGTTATCC and 5′CACGGTGGATCGAAAATCGGCTGTAGAAGACATAGGATCTCGATGTCTTACA ACAAAGCCGCCGTCCCGTC.

In vitro transposition reactions

Reaction mixtures were 20 μl and included 0.2 pmol transposon end DNA, 0.3 pmol pUC19 as target DNA, and 3 μl of Hztransib protein fraction in Storage Buffer. They contained 8 mM MnCl2, 2 mM DTT, 0.01% BSA and 25 mM HEPES (pH 8.0) and (from Storage Buffer) 75 mM NaCl, 0.15 mM EDTA, 0.3 mM DTT, 3.0 mM Tris (pH 7.8), 3.7 % glycerol. Reactions were incubated at 30°C for 1 hr (or as indicated) and then stopped by the addition of STOP buffer (10 mM EDTA, 10% SDS, 0.15% Bromophenol Blue, 0.25% Xylene Cyanol).

Electrophoresis

Native samples were displayed on 1% agarose gels in 1 × TAE. For alkaline agarose gels, in vitro transposition reactions were ethanol precipitated and resuspended in 50 mM NaOH and 1 mM EDTA following the addition of 6x loading dye (300 mM NaOH, 6 mM EDTA, 18% Ficoll, 0.15% Bromophenol Blue, 0.25% Xylene Cyanol). Denatured samples were displayed on a 1% agarose gel in 50 mM NaOH and 1 mM EDTA. For denaturing acrylamide gels, samples were phenol extracted, ethanol precipitated and resuspended in 12 μl 95% formaldehyde, 20 mM EDTA, 0.05% Bromophenol Blue, 0.05% Xylene Cyanol, boiled and then placed on ice. Samples were displayed on denaturing acylamide gels containing 8% EXPLORER acrylamide and 7M urea in 1 × TBE.

Transformation Assay for Hztransib integration

300 ng Hztransib L50-KanR-R50 fragment and 500 ng pUC19 were used as substrates in in vitro transposition reactions. The reaction mixtures were phenol extracted, ethanol precipitated and resuspended in 10 μl H2O.5 μl was transformed into 25 μl Mach1 cells (Invitrogen), LB added to 500 μl and transposition products recovered by selection for kanamycin resistance.
  13 in total

1.  Mutational analysis of RAG1 and RAG2 identifies three catalytic amino acids in RAG1 critical for both cleavage steps of V(D)J recombination.

Authors:  M A Landree; J A Wibbenmeyer; D B Roth
Journal:  Genes Dev       Date:  1999-12-01       Impact factor: 11.361

2.  Mutations of acidic residues in RAG1 define the active site of the V(D)J recombinase.

Authors:  D R Kim; Y Dai; C L Mundy; W Yang; M A Oettinger
Journal:  Genes Dev       Date:  1999-12-01       Impact factor: 11.361

3.  Transposition of hAT elements links transposable elements and V(D)J recombination.

Authors:  Liqin Zhou; Rupak Mitra; Peter W Atkinson; Alison Burgess Hickman; Fred Dyda; Nancy L Craig
Journal:  Nature       Date:  2004-12-23       Impact factor: 49.962

4.  Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system.

Authors:  A Agrawal; Q M Eastman; D G Schatz
Journal:  Nature       Date:  1998-08-20       Impact factor: 49.962

5.  DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations.

Authors:  K Hiom; M Melek; M Gellert
Journal:  Cell       Date:  1998-08-21       Impact factor: 41.582

Review 6.  V(D)J recombination: mechanisms of initiation.

Authors:  David G Schatz; Patrick C Swanson
Journal:  Annu Rev Genet       Date:  2011-08-19       Impact factor: 16.830

Review 7.  Making and breaking nucleic acids: two-Mg2+-ion catalysis and substrate specificity.

Authors:  Wei Yang; Jae Young Lee; Marcin Nowotny
Journal:  Mol Cell       Date:  2006-04-07       Impact factor: 17.970

Review 8.  RAG: a recombinase diversified.

Authors:  Adam G W Matthews; Marjorie A Oettinger
Journal:  Nat Immunol       Date:  2009-07-21       Impact factor: 25.606

Review 9.  Integrating prokaryotes and eukaryotes: DNA transposases in light of structure.

Authors:  Alison Burgess Hickman; Michael Chandler; Fred Dyda
Journal:  Crit Rev Biochem Mol Biol       Date:  2010-02       Impact factor: 8.250

10.  RAG1 core and V(D)J recombination signal sequences were derived from Transib transposons.

Authors:  Vladimir V Kapitonov; Jerzy Jurka
Journal:  PLoS Biol       Date:  2005-05-24       Impact factor: 8.029

View more
  28 in total

1.  Mapping and Quantitation of the Interaction between the Recombination Activating Gene Proteins RAG1 and RAG2.

Authors:  Yu-Hang Zhang; Keerthi Shetty; Marius D Surleac; Andrei J Petrescu; David G Schatz
Journal:  J Biol Chem       Date:  2015-03-05       Impact factor: 5.157

Review 2.  Epigenetic aspects of lymphocyte antigen receptor gene rearrangement or 'when stochasticity completes randomness'.

Authors:  Sébastien Jaeger; Bastien Fernandez; Pierre Ferrier
Journal:  Immunology       Date:  2013-06       Impact factor: 7.397

3.  Structural basis for the activation and suppression of transposition during evolution of the RAG recombinase.

Authors:  Yuhang Zhang; Elizabeth Corbett; Shenping Wu; David G Schatz
Journal:  EMBO J       Date:  2020-09-18       Impact factor: 11.598

Review 4.  Diversity-generating Retroelements in Phage and Bacterial Genomes.

Authors:  Huatao Guo; Diego Arambula; Partho Ghosh; Jeff F Miller
Journal:  Microbiol Spectr       Date:  2014-12

Review 5.  Horizontal acquisition of transposable elements and viral sequences: patterns and consequences.

Authors:  Clément Gilbert; Cédric Feschotte
Journal:  Curr Opin Genet Dev       Date:  2018-03-02       Impact factor: 5.578

Review 6.  Transposable elements in cancer.

Authors:  Kathleen H Burns
Journal:  Nat Rev Cancer       Date:  2017-06-09       Impact factor: 60.716

Review 7.  Role of recombination activating genes in the generation of antigen receptor diversity and beyond.

Authors:  Mayilaadumveettil Nishana; Sathees C Raghavan
Journal:  Immunology       Date:  2012-12       Impact factor: 7.397

Review 8.  Transposable elements in human genetic disease.

Authors:  Lindsay M Payer; Kathleen H Burns
Journal:  Nat Rev Genet       Date:  2019-09-12       Impact factor: 53.242

Review 9.  New insights into the evolutionary origins of the recombination-activating gene proteins and V(D)J recombination.

Authors:  Lina Marcela Carmona; David G Schatz
Journal:  FEBS J       Date:  2017-01-06       Impact factor: 5.542

10.  Discovery of an Active RAG Transposon Illuminates the Origins of V(D)J Recombination.

Authors:  Shengfeng Huang; Xin Tao; Shaochun Yuan; Yuhang Zhang; Peiyi Li; Helen A Beilinson; Ya Zhang; Wenjuan Yu; Pierre Pontarotti; Hector Escriva; Yann Le Petillon; Xiaolong Liu; Shangwu Chen; David G Schatz; Anlong Xu
Journal:  Cell       Date:  2016-06-09       Impact factor: 41.582

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.