| Literature DB >> 22675544 |
Yu Cui1, Mi Yeon Lee, Naxin Huo, Jennifer Bragg, Lijie Yan, Cheng Yuan, Cui Li, Sara J Holditch, Jingzhong Xie, Ming-Cheng Luo, Dawei Li, Jialin Yu, Joel Martin, Wendy Schackwitz, Yong Qiang Gu, John P Vogel, Andrew O Jackson, Zhiyong Liu, David F Garvin.
Abstract
The ND18 strain of Barley stripe mosaic virus (BSMV) infects several lines of Brachypodium distachyon, a recently developed model system for genomics research in cereals. Among the inbred lines tested, Bd3-1 is highly resistant at 20 to 25 °C, whereas Bd21 is susceptible and infection results in an intense mosaic phenotype accompanied by high levels of replicating virus. We generated an F(6:7) recombinant inbred line (RIL) population from a cross between Bd3-1 and Bd21 and used the RILs, and an F(2) population of a second Bd21 × Bd3-1 cross to evaluate the inheritance of resistance. The results indicate that resistance segregates as expected for a single dominant gene, which we have designated Barley stripe mosaic virus resistance 1 (Bsr1). We constructed a genetic linkage map of the RIL population using SNP markers to map this gene to within 705 Kb of the distal end of the top of chromosome 3. Additional CAPS and Indel markers were used to fine map Bsr1 to a 23 Kb interval containing five putative genes. Our study demonstrates the power of using RILs to rapidly map the genetic determinants of BSMV resistance in Brachypodium. Moreover, the RILs and their associated genetic map, when combined with the complete genomic sequence of Brachypodium, provide new resources for genetic analyses of many other traits.Entities:
Mesh:
Substances:
Year: 2012 PMID: 22675544 PMCID: PMC3366947 DOI: 10.1371/journal.pone.0038333
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Disease responses of diverse Brachypodium distachyon lines.
| Inbred line | Visual Phenotype | Serological Results | Origin |
| Adi-1 | Susceptible | Positive | Turkey |
| Adi-10 | Resistant | Negative | Turkey |
| Adi-11 | Susceptible | Positive | Turkey |
| Adi-12 | Susceptible | Positive | Turkey |
| Adi-15 | Susceptible | Positive | Turkey |
| Adi-2 | Susceptible | Positive | Turkey |
| Adi-21 | Susceptible | Positive | Turkey |
| Adi-23 | Resistant | Negative | Turkey |
| Adi-3 | Resistant | Negative | Turkey |
| Adi-4 | Susceptible | Positive | Turkey |
| Adi-6 | Susceptible | Positive | Turkey |
| Adi-7 | Susceptible | Positive | Turkey |
| Adi-8 | Resistant | Negative | Turkey |
| Adi-9 | Susceptible | Positive | Turkey |
| Bd21 | Susceptible | Positive | Iraq |
| Bd21-3 | Susceptible | Positive | Iraq |
| Bd2-3 | Susceptible | Positive | Iraq |
| Bd3-1 | Resistant | Negative | Iraq |
| BdTR10C | Susceptible | Positive | Turkey |
| BdTR11I | Susceptible | Positive | Turkey |
| BdTR12C | Susceptible | Positive | Turkey |
| BdTR13C | Susceptible | Positive | Turkey |
| BdTR2G | Susceptible | Positive | Turkey |
| BdTR3C | Susceptible | Positive | Turkey |
| BdTR5I | Susceptible | Positive | Turkey |
| BdTR9K | Susceptible | Positive | Turkey |
| Bis-1 | Susceptible | Positive | Turkey |
| Bis-4 | Susceptible | Positive | Turkey |
| Bis-5 | Susceptible | Positive | Turkey |
| Gaz-4 | Resistant | Negative | Turkey |
| Gaz-5 | Resistant | Negative | Turkey |
| Gaz-8 | Susceptible | Positive | Turkey |
| Gaz-9 | Susceptible | Positive | Turkey |
| Kah-2 | Susceptible | Positive | Turkey |
| Kah-4 | Susceptible | Positive | Turkey |
| Kah-5 | Susceptible | Positive | Turkey |
| Koz-3 | Susceptible | Positive | Turkey |
| Koz-4 | Resistant | Negative | Turkey |
| Koz-6 | Resistant | Negative | Turkey |
| Koz-7 | Susceptible | Positive | Turkey |
| Tek-1 | Susceptible | Positive | Turkey |
| Tek-10 | Susceptible | Positive | Turkey |
| Tek-12 | Susceptible | Positive | Turkey |
| Tek-2 | Susceptible | Positive | Turkey |
| Tek-3 | Susceptible | Positive | Turkey |
| Tek-4 | Resistant | Negative | Turkey |
| Tek-5 | Resistant | Negative | Turkey |
| Tek-9 | Resistant | Negative | Turkey |
Figure 1Geographic and genotypic distributions of the phenotype elicited during BSMV ND18 infection of diverse Brachypodium lines.
A) Infection phenotype of 44 Brachypodium lines from 11 locations in Turkey. Red dots represent the locations of the 33 susceptible lines; Green dots show the distribution of the 11 resistant lines. B) Plot of the phenotypic responses of the Brachypodium lines on a previously created neighbor joining tree based 44 SSR markers (Vogel et. al. 2009). Red ovals represent susceptible lines and green ovals show resistant lines.
Figure 2Disease responses of Brachypodium lines Bd3-1, Bd21 and Bd21-3 to infection with BSMV ND18.
(A–C) Uninfected Bd3-1 and inoculated Bd-3-1, Bd21 and Bd21-3 at 12 dpi. (A) Uninfected Bd3-1 plants remained green and continued to grow rapidly, as was typical of uninfected Bd21 and Bd21-3 plants. Nd18 inoculated Bd3-1 plants failed to develop symptoms and had the same general appearance as their uninoculated counterparts. In contrast, Bd21 and Bd21-3 inoculated plants developed visible mosaic symptoms on emerging leaves by 7 days post inoculation (dpi) and the symptoms remain visible until at least 20 dpi. (B) Western blots to determine the presence of the 22 KD BSMV coat protein in leaf extracts from the first emerging leaf of uninoculated and inoculated plants at 6 dpi. (C) RT-PCR analyses of leaf extracts taken at 21 dpi from the lines shown in the top panel. A forward primer complementary to the 3′ end of BSMV RNAs and a reverse primer of the same polarity as the γb gene were designed to produce an ∼800 nt product. (D–E) Chronic disease symptoms on Brachypodium lines inoculated with BSMV ND18. (D) Bd3-1 and Bd21 at 25 dpi. Note stunting of Bd21 compared to Bd3-1. (E) Healthy Bd3-1 and Bd 3-1 and Bd21 at 55 dpi. Note: Uninoculated plants and inoculated Bd3-1 plants have a similar growth characteristics and seed population, but Bd21 plants are stunted and fail to flower or set seeds.
Segregation ratios of Bd21 × Bd3-1 F2 and Bd3-1 × Bd21F6∶7 RIL populations for BSMV ND18 resistance.
| Population | Size | Segregation | |||||
| Type | Expected ratio | R | H | S | χ2 | ||
| RILs | 165 | Single locus | A:B = 1∶1 | 76 | 3 | 86 | 0.62 |
| F2 | 57 | Dominant | (A+H):B = 3∶1 | 41 | 16 | 0.28 | |
Comparison of SNP-based genetic linkage maps of Bd3-1 × Bd21 F2 and F6∶7 RIL populations.
| Number of markers | Genetic map length (cM) | cM/marker | Physical size (Mb) | kb/marker | Recombination rate (cM/Mb) | |||||||
| Type | F2 | RILs | F2 | RILs | F2 | RILs | F2 | RILs | F2 | RILs | ||
| Chr 1 | 152 | 159 | 449.1 | 376.3 | 3.0 | 2.4 | 74.8 | 492.1 | 470.4 | 6.0 | 5.0 | |
| Chr 2 | 91 | 96 | 348.3 | 388.0 | 3.8 | 4.0 | 59.3 | 651.6 | 617.7 | 5.9 | 6.5 | |
| Chr 3 | 137 | 136 | 350.9 | 418.6 | 2.6 | 3.1 | 59.9 | 437.2 | 440.4 | 5.9 | 7.0 | |
| Chr 4 | 112 | 110 | 267.0 | 304.7 | 2.4 | 2.8 | 48.6 | 433.9 | 441.8 | 5.5 | 6.3 | |
| Chr 5 | 66 | 69 | 182.7 | 198.0 | 2.8 | 2.9 | 28.4 | 430.3 | 411.6 | 6.4 | 7.0 | |
| Total | 558 | 570 | 1598.0 | 1685.6 | 2.9 | 3.0 | 271.0 | 485.7 | 475.4 | 5.9 | 6.2 | |
Note: Chr 1 includes small groups A, B, D; Chr 2 includes small group C.
Primer sequence and physical location of Indel and CAPS markers used for fine structure mapping of the Brachypodium Bd3-1 × Bd21 F6∶7 RIL population.
| Marker | Physical locationin Bd21 | Correspondinggene in Bd21 | Primer sequence | Comments | ||
| Start | End | Left (forward) | Right (reverse) | |||
| Bd3-2 | 181391 | 181574 | Bradi3g00450 |
|
| 181484 -10:TAGCGGTAAG |
| Indel-1 | 297714 | 297916 |
|
| 297805+11:CTTTCCTATTC | |
| Indel-6 | 328743 | 328916 | Bradi3g00620 |
|
| 328831+9:TGAATATGC |
| Caps-4 | 371691 | 372044 |
|
| 371773+6:GAGTCG | |
| Caps-5 | 402366 | 402756 | Bradi3g00730 |
|
| 402688 T/C |
| Caps-9 | 407773 | 408091 |
|
| 408018 G/A | |
| Caps-11 | 419695 | 419958 | Bradi3g00757 |
|
| 419812 G/A |
| Caps-12 | 424681 | 425029 | Bradi3g00767 |
|
| 424950 G/C |
| Caps-8 | 426497 | 426965 | Bradi3g00767 |
|
| 426590+6:CGCGGG |
| Indel-4 | 441377 | 441529 |
|
| 441530 -14:TATTTAGCAGATAC | |
| Indel-2 | 460601 | 460839 |
|
| 460661 -20:ATATAAGTGGTAATGTTGAC | |
| Caps-2 | 487758 | 487991 |
|
| 487847 A/G | |
| Caps-3 | 525604 | 525912 | Bradi3g00940 |
|
| 525675 T/C |
| Bd3-6 | 607733 | 607982 |
|
| 607813 -23:CTACCCATATCACTTGTCTCGAA | |
Figure 3Genetic map of BSMV Bsr1 resistance within the distal region of Bd21 chromosome 3.
(a) Cartoon of the short arm of Bd21 chromosome 3 (Chr3S). The white region shows 705 kb of distal region of Chr 3 encompassing the fine mapping region. (b) Genetic map of the 705 Kb region of chromosome 3. Markers are shown on the right with map distances on the left. The furthest flanking markers that were previously assigned to the Brachypodium Chr 3 are indicated by dashed lines. The Bsr1 locus is indicated in red. The six markers located within the predicted Bd21 locus served as anchors to establish co-linearity between the Bsr1 genetic map and the physical map of Bd21. (c) Physical map of the interval. Annotated genes are indicated by arrows and candidate genes are indicated in green. Approximate locations (bp) are shown on the left.