Literature DB >> 22590552

A CI-independent form of replicative inhibition: turn off of early replication of bacteriophage lambda.

Sidney Hayes1, Monique A Horbay, Connie Hayes.   

Abstract

Several earlier studies have described an unusual exclusion phenotype exhibited by cells with plasmids carrying a portion of the replication region of phage lambda. Cells exhibiting this inhibition phenotype (IP) prevent the plating of homo-immune and hybrid hetero-immune lambdoid phages. We have attempted to define aspects of IP, and show that it is directed to repλ phages. IP was observed in cells with plasmids containing a λ DNA fragment including oop, encoding a short OOP micro RNA, and part of the lambda origin of replication, oriλ, defined by iteron sequences ITN1-4 and an adjacent high AT-rich sequence. Transcription of the intact oop sequence from its promoter, p(O) is required for IP, as are iterons ITN3-4, but not the high AT-rich portion of oriλ. The results suggest that IP silencing is directed to theta mode replication initiation from an infecting repλ genome, or an induced repλ prophage. Phage mutations suppressing IP, i.e., Sip, map within, or adjacent to cro or in O, or both. Our results for plasmid based IP suggest the hypothesis that there is a natural mechanism for silencing early theta-mode replication initiation, i.e. the buildup of λ genomes with oop(+)oriλ(+) sequence.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22590552      PMCID: PMC3349717          DOI: 10.1371/journal.pone.0036498

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Normal cellular immunity to λ infection arises upon the lysogenic conversion of E. coli cells by a λ prophage. The CI repressor protein encoded by the prophage binds to the o and o operator sites, each with three repressor binding sites, e.g., o3, o2, o1, within the immλ gene cluster p-rexB-rexA-cI-p-o-p. CI protein within a λ lysogenic cell blocks transcription of the phage genes situated downstream from the major leftward and rightward phage promoters p and p [1], both from the resident prophage, or when a homo-immune immλ phage infects the cells. The variant λvir efficiently forms plaques on cells lysogenized by λ because it carries point mutations v2 in o, v1 in o2, and v3 in o1[2]. Transcription from p (Fig. 1A) is required for expression of genes cro-cII-O-P, respectively encoding a second repressor (Cro) that binds to o; an unstable stimulator (CII) of the establishment mode of cI transcription from promoter p [3]; and the repλ replication initiation cassette including genes O, P, and the origin (oriλ within O) site, which participate in oriλ-dependent bidirectional (theta mode) replication initiation. The gene oop, is transcribed from promoter p [4] (opposite orientation from p), partially overlaps the terminal end of cII, and encodes a short self-terminating antisense RNA (OOP) opposing CII expression [5]. Part of oop and p share a 33 bp region of high sequence homology within lambdoid phages (Fig. S1). The organizational similarity within the region encoding the cII-like–oop–“orf”–O-like–P-like genes for lambdoid phages is shown in Fig. S2.
Figure 1

Replication-targeted inhibition of repλ phage plating.

A. Plasmid cloned λ DNA fragments used to map the sequence requirement(s) for an inhibition phenotype (IP). B. Genomic region spanning five contiguous and partially homologous genes of phages λ and P22 (see Fig. S2). Phage λ is naturally missing the orf48 gene between oop and O that is present between oop and 18 in P22 [37], [51]. C. Assay for EOP, defined as phage titer on strain 594 (with one of the indicated plasmids) / titer on 594 cells, where plating on 594  =  EOP of 1.0. All of the plasmids shown were derived from pBR322. The oopλ+ plasmid used was p27. The DNA substitution of the “ice” [16] sequence of λ to make plasmid Δice oop + oriλ+ ( =  p50) is shown in Fig. S3A. Numbers in brackets represent standard error values.

Replication-targeted inhibition of repλ phage plating.

A. Plasmid cloned λ DNA fragments used to map the sequence requirement(s) for an inhibition phenotype (IP). B. Genomic region spanning five contiguous and partially homologous genes of phages λ and P22 (see Fig. S2). Phage λ is naturally missing the orf48 gene between oop and O that is present between oop and 18 in P22 [37], [51]. C. Assay for EOP, defined as phage titer on strain 594 (with one of the indicated plasmids) / titer on 594 cells, where plating on 594  =  EOP of 1.0. All of the plasmids shown were derived from pBR322. The oopλ+ plasmid used was p27. The DNA substitution of the “ice” [16] sequence of λ to make plasmid Δice oop + oriλ+ ( =  p50) is shown in Fig. S3A. Numbers in brackets represent standard error values. The dual infection of a λ lysogen with two phages, a homo-immune immλ phage and a hybrid hetero-immune λimm434 phage, each of which share an identical repλ replication initiation cassette, revealed that the imm434 phage predominated by 20+-fold over the immλ phage in the cell burst [6]. The impaired replication of the homo-immune immλ phage, described as replicative inhibition, which we consider herein “CI-dependent” was explained by the assumption that CI repressor molecules made by the λ prophage in the co-infected lysogenic cells prevented replication of the homo-immune phage, even when the λ replication initiation proteins (gpO and gpP) were provided in trans by the hetero-immune phage. The observations that CI-dependent replicative inhibition was suppressed by mutations in o causing p to become insensitive to repression, or by base changes creating new promoter sites downstream from p, as exemplified by c17 and four ri c (replication inhibition constitutive) mutations [7], provided support for an argument that transcription from p (transcriptional activation) was required in cis for theta-mode replication initiation, and that replicative inhibition was explained by CI repressor in the lysogen preventing transcriptional activation of replication initiation from the co-infecting immλ repλ phage. Plasmids termed λdv were derived from phage λvir [8], [9]. They encode the immλ and repλ regions and are capable of autonomous replication. Early studies with cells transformed with λdv suggested that the cells acquired an unusual immunity or exclusion phenotype [8], [10] and inhibited plating by homo-immune phages, including λvir, and hetero-immune hybrid phages as λimm434. Some other hetero-immune phages (e.g., λimm21 and λimm80) that were presumably repλ were able to escape the inhibition, i.e., could plate efficiently on cells transformed with λdv [8], [10]. The ability of cells with λdv plasmids to inhibit λvir development was rationalized by the suggestion that cells with this plasmid make more CI repressor than would a cell with a single λ prophage, and the higher levels of repressor would eventually bind the altered λvir operators [8]. However, CI levels were not actually measured. No explanation was provided for the inhibition of λimm434 development. When RNA transcription levels from cells with λdv1 plasmid were measured, it was found that little [10] or no [11] cI transcription was detected, showing that the inhibition of homo-immune infecting phage development by λdv plasmid was not due to CI repressor activity. It was proposed [10] that the λdv-mediated inhibition of infecting repλ phage development represents a competition for bacterial protein(s) between the plasmid and an infecting phage, and that the site for the competition was different in the λimm21 and λimm80 phages that escaped the inhibition. Independently, Rao and Rogers [12] demonstrated that cells containing a pBR322/λ hybrid plasmid that included the immλ and repλ regions exhibited an inhibition phenotype (referred to herein as “IP”), that prevented the plating of λvir and λimm434 infecting phage, but allowed λimm21 to plate at high EOP. They reported isolating mutants of λvir and λimm434 which formed plaques at high EOP on cells with the plasmid, but the causative mutations were not further identified. Another inhibition phenotype, termed nonimmune exclusion (NIE) [13], was specific for immλ and imm434 phages that were repλ. NIE was exhibited by a variety of engineered cells with thermally induced (CI-inactivated) cryptic cI [Ts] prophage deleted for attL through kil, all genes rightward of P, and had acquired mutations inactivating P [14]. Seven independent λ se (suppress exclusion) mutations of λ wt (wild type) were isolated from NIE phenotype cells having a cro27 mutation in the cryptic prophage. The se defects were point mutations within o2 (se100a, identical to mutation v1; and se101b) and within o1 (five mutations represented by se109b, identical to mutation vC1, and at the same site as vs387) [13]. All seven λ se isolates exhibited a CI-defective phenotype, complemented for cII and cIII, and were about 10-fold less sensitive to replicative inhibition than λ wt or λ cI - [13]. We have attempted to understand further the inhibition phenotype(s), IP, by constructing plasmids with portions of repλ. By removing immλ from plasmids, the conflicting plating data for λvir was eliminated. We have shown that CI-independent, plasmid-dependent IP requires cis acting oriλ iteron (ITN) sequences [2], [15] and oop transcription, and is directed to repλ phages. We suggest that the target of IP is early (theta-mode) replication initiation. Phage mutations suppressing IP, i.e., Sip, map within, or adjacent to cro or in O, or both.

Results

Plasmid-mediated Inhibition Phenotype (IP)

The bacterial strains, phage, plasmids and primers for modifying plasmids are described in Tables 1, 2, 3. Plasmid pCH1, theoretically identical to the IP plasmid described by Rao and Rogers [12], and deletion derivatives as p25 and others (Table 2, Fig. 1A) were made to determine which λ sequences were responsible for IP. Plasmids pCH1 and p25 inhibited the plating of λvir, but versions deleting immλ (including the p promoter) did not (data not shown). The IP toward repλ phage was seen with plasmids as p26 (data not shown), p27, (rop +, oop +, oriλ+), p27R (oop +, oriλ+), and p50 (Δice oop + oriλ+) in Fig. 1C. p50 was deleted for the proposed replication inceptor site ice [16] (Fig. S3A,C,D), including all λ DNA from 31 bp leftward / downstream of the oop sequence (Fig. S3A). Plasmids that were oop + Δoriλ, or oriλ+ but deleted for the t sequence expressing the self-terminating 77 nt OOP RNA [17] (Fig. S3B), were defective in IP. In contrast, phages where repλ was replaced by repP22 as in λcI857(18,12)P22 escape IP (Fig. 1C; gene replacements are shown in Fig.'s 1B, S2, S3C). These results strongly suggest that IP is directed to repλ phages that employ genes O and P to initiate replication from oriλ.
Table 1

E. coli K12 and Bacteriophage λ Strains.

Bacteria and phagesRelevant GenotypeHayes lab # and source
594 [70] (presumably  = R594)[71] Supo cells; F lac-3350 galK2 galT22 rpsL179 IN(rrnD-rrnE)1B10 [70]; Bachmann [71]
W3350 [72] (W3350A )Supo cells; F lac-3350 galK2 galT22 IN(rrnD-rnE)1B12, Campbell & Balbinder, 1958, cited in [72]; Bachmann [71]
W3350 dnaB-GrpD55 dnaB-GrpD55 malF3089::Tn10 TetR nB15; Bull & Hayes [36]
TC600 thr1 leuB6 fhuA21lacY1 glnV44 el4- glpR200 thi1supE B8; Bachmann [71]
Y836Strain with cryptic λc [Ts]857 prophage a Y836; Hayes and Hayes [13], derived from strain SA431 [73]
594(λcI857)b immλ cI[Ts]857 repλ prophagenY1016; this work
594(λcI857(18,12)P22)b immλ cI[Ts]857 repP22 prophagenY1111; this work
λcI857 cI[Ts]857 repλ1002; Hayes [49]
λcI72 cI repλ999; Hayes [49]
λ virpoint mutations in oL2, oR1, and oR3, repλ1000; Hayes [49]
λcI857(18,12)P22 immλ cI[Ts]857 repP22  =  λhy106998; Hayes & Hayes [13]
λcI +ΔcII 326-bp deletion of cII in λ c + 992; L. Thomason [50]
λ papa( = wild type cI +)241; Hayes & Hayes [13]
λcI90c17c17, 9-bp duplication at 38341λ [2] 1006; Hayes & Hayes [13]
λse100a oR 37979λ GC->TA, CI phenotype1003; Hayes & Hayes [13]
λse101b oR 37985λ CG->AT, CI phenotype1004; Hayes & Hayes [13]
λse109b oR 38009λ CG->AT, CI phenotype1005; Hayes & Hayes [13]
λimm434cI#5 imm434 cI 957, Hayes et al. [14]
λimm434 Δnin5deletion NinR recombination functions c 969; Hayes et al. [18]
λbio275 imm434 deletion of NinL recombination functions c 958; Hayes et al. [18]
λbio275 imm434 Δnin5deletion of NinL and NinR functions952; Hayes et al. [18]

The λ prophage genes int-xis-exo-bet-gam-kil in strain Y836 were substituted with bio275 [13]. The strain carries the chromosomal deletion Δ431[33] that removes genes rightward from ninB in prophage through moaA in host, including prophage genes orf146 (orf) – Jb2 (i.e., all the late genes required for cell lysis and phage morphogenesis). A map of the cryptic lambda prophage in strain Y836 is drawn in Fig. 4A.

Lysogenic strains show the prophage within the cell by “( )” bordering the prophage.

The NinR region deleted by Δnin5 removes λ bases 40,503–43,307, i.e., ren-ninA – ninI (including orf -ninC and rap-ninH ); the NinL region substituted by bio275 replaces genes int-xis-hin-exo-bet-gam-kil, representing λ bases 27,731–∼33,303 [18].

Table 2

Plasmidsa.

Plasmidλ basesBases from pBR322
pCH1b 34500–417311–375, 376–4361
p25b 34500–393541–187, 376–4361
p26b 38215–393541–187, 376–4361
p27b 38215–391681426–4359
p27Rb 38359–391682297–4359
p28b 38815–393541–187, 376–4361
p29b 38215–388351–187, 376–4361
p50c 38568–39168188–4359
p51c 38568–38759, 38820–39168d 188–4359
p51kanc 38568–38759, 38814–39168e 188–4359
p52c 38568–38759, 38814–39168f 188–4359
p27RpO38359–38683, 38689–39168, bases 38684–38688 (ATTAT) replaced with GCGCG2297–4359
p27R-R45OOP38359–38629, 38675–39168, bases 38630–38674 substitutedg 2297–4359
p27RΔAT38359–391272297–4359
p27RΔITN1–438359–39043, 39120–391682297–4359
p27RΔITN3–438359–39077, 39120–391682297–4359
pcIpR-O-timmmodified 35799–35824, 37203–38036, 38686–39582h 1–3, 651–4361
P434'pR-O-timmmodified 35799–35824, 37203–37464, 38686–39582i 1–3, 651–4361

All plasmids were prepared in this laboratory.

Described in [11], some illustrated in Fig. 1A.

Described in [37], [69], illustrated in Figures 1, S3.

Deletes 60 bp within O between 38759 and 38820, include one of two BglII sites.

∼1450 bp BglII DNA fragment with KanR (derived from Tn903) within pUC4K was inserted within the remaining BglII site in p51.

Removal of ∼1426 bp PstI fragment from ∼1450 bp KanR fragment, adding 24 bp within the 60 bp deletion region between bases 38759 and 38820.

Initially 45 random bases were chosen, but then some bases were modified to remove the possibility for secondary structure (hairpin) formation.

Expression plasmid [74]–[76] where O expression is regulated by CI[Ts]857 repressor from p promoter.

Part of cI857 –p in pcIpR-O-timm was replaced with 379 bp N-terminal 434-cI[Ts]–p sequence, resulting in constitutive expression of O [75].

Table 3

Primers used for plasmid modification.

PlasmidUnique Primersa Sequence
p27RΔATLPo1 5′-CACACCGCATATGGTTCGTGCAAAC
p27RΔATRΔAT1 5′-AAGAATTCCTTTTGTGTCCCCCT
p27RpORPo2 5′-TGCTGTATTTG TCGCGCGGACTCCTGTTGA
p27RpOLPo3 5′-TCAACAGGAGTCCGCGCGACAAATACAGCA
p27RpORPo4 5′-AAGAATTCTCTGACGAATAATCT
p27R-R45OOPLROOP35′-TAATGAGAGTATAAAAGCAAAGGGAGAGAG- ATAATAGTACAGAAGCAGGAGTCATTATGACAA
p27R-R45OOPRROOP25′-CTTCTGTACTATTATCTCTCTCCTTTGCTTTT-ATACTCTCATTAAGAACGCTCGGTTGCCGC
p27RΔITN1–4LΔITN1–45′-AAAACATCTCAGAATGGTGCCACAAAAGAC-ACTATTACAAAAGAA
p27RΔITN1–4RΔITN1–45′-TTCTTTTGTAATAGTGTCTTTTGTGGCACCA-TTCTGAGATGTTTT
p27ΔITN3–4LΔITN3–45′-CCTAAAACGAGGGATAAAACCACAAAAGA- CACTATTACAAAAGAA
p27ΔITN3–4RΔITN3–45′-TTCTTTTGTAATAGTGTCTTTTGTGGTTTTA-TCCCTCGTTTTAGG

L and R primer sequences are from the lambda l-strand (coding strand for cII-O) and r-strand (coding strand for cI and oop) sequences, respectively.

The λ prophage genes int-xis-exo-bet-gam-kil in strain Y836 were substituted with bio275 [13]. The strain carries the chromosomal deletion Δ431[33] that removes genes rightward from ninB in prophage through moaA in host, including prophage genes orf146 (orf) – Jb2 (i.e., all the late genes required for cell lysis and phage morphogenesis). A map of the cryptic lambda prophage in strain Y836 is drawn in Fig. 4A.
Figure 4

Assay for prophage replication from oriλ.

This experiment was undertaken in parallel with the experiment shown in columns “e–g” of Fig. 3D. A. Map of λ fragment within Y836 cells. The thick solid line shows λ fragment within the E. coli chromosome (open boxes); the NdeI restriction sites within λ and chromosome are shown along with the DNA bands formed after cleavage; the λ region amplified to prepare a DNA probe is drawn. B. Map region of the λ DNA fragment cloned within plasmid p27R (2873 bp) (without indicating the small mutational changes within similar λ fragments in the other plasmids). C. Assay for replication initiation from oriλ after shifting Y836 culture cells from 30° to 42° to induce transcription and oriλ replication from the cryptic prophage. Cultures were grown to mid-log and aliquots were removed at time 0 as described in legend, Fig. 3. Thereupon, cultures were transiently swirled in a 60°C water bath and transferred to a 42°C shaking bath for one hour and aliquots were removed. Cell concentration of the 42°C aliquots was based upon the calculations for 30°C 0-time cultures, and DNA was prepared using Qiagen DNAeasy Kit from 2.0×109 cells. The concentration of extracted DNA was determined by spectrophotometer (A260nm x DNA dilution X 50 ng/ml). The Y836 cellular DNA (2.5 ug of ethanol precipitated and resuspended DNA) was digested 2 hrs with NdeI and digests were run on horizontal 0.7% agarose gel, followed by Southern transfer of DNA bands. The Southern blot bands for the 1774 bp chromosomal prophage fragments were each scanned 3X using GE Healthcare software program ImageQuant version 5.2 and the region under the peaks was integrated and averaged. The numbers below the bands compare the relative levels of 1774 bp fragment obtained for induced / noninduced sample pairs. Refer to Hayes et al. [18] for detailed hybridization methodology, and for comparing the effect of a cI + repressor expressed from a plasmid on prophage induction, the influence of host recombination defects on replication initiation from oriλ from the prophage in Y836 cells, and the inhibition of replication initiation from oriλ by host mutations.

Lysogenic strains show the prophage within the cell by “( )” bordering the prophage. The NinR region deleted by Δnin5 removes λ bases 40,503–43,307, i.e., ren-ninA – ninI (including orf -ninC and rap-ninH ); the NinL region substituted by bio275 replaces genes int-xis-hin-exo-bet-gam-kil, representing λ bases 27,731–∼33,303 [18]. All plasmids were prepared in this laboratory. Described in [11], some illustrated in Fig. 1A. Described in [37], [69], illustrated in Figures 1, S3. Deletes 60 bp within O between 38759 and 38820, include one of two BglII sites. ∼1450 bp BglII DNA fragment with KanR (derived from Tn903) within pUC4K was inserted within the remaining BglII site in p51. Removal of ∼1426 bp PstI fragment from ∼1450 bp KanR fragment, adding 24 bp within the 60 bp deletion region between bases 38759 and 38820. Initially 45 random bases were chosen, but then some bases were modified to remove the possibility for secondary structure (hairpin) formation. Expression plasmid [74]–[76] where O expression is regulated by CI[Ts]857 repressor from p promoter. Part of cI857 –p in pcIpR-O-timm was replaced with 379 bp N-terminal 434-cI[Ts]–p sequence, resulting in constitutive expression of O [75]. L and R primer sequences are from the lambda l-strand (coding strand for cII-O) and r-strand (coding strand for cI and oop) sequences, respectively. The influence of IP on the temporal events for cell lysis and phage burst following thermal induction of a prophage was examined (Fig. 2). None of the four plasmids, p27R, p27Rp - (oop + p − oriλ+), p28 (oriλ+) and p29 (t +) (Fig. 2A) prevented phage-dependent cell lysis by an induced repP22 prophage (Fig. 1B). In contrast, vegetative development of the repλ prophage was markedly inhibited (as was cell lysis) in cells with the oop + oriλ+ plasmid (Fig. 2B); but, when the plasmid was altered by changing the -10 region for p or removing the t, or oriλ regions, no inhibition of repλ prophage development was observed, in agreement with the plating results in Fig. 1C.
Figure 2

Thermal Induction of repλ or the repP22 –hybrid λcI857 prophages.

Lysogenic cultures of strain 594 were grown at 30° and each prophage was thermally induced by shifting the culture from 30° to 42° at time 0. A. Thermally induced repP22 prophage. B. Thermally induced repλ prophage. The results represent the averages for 2 independent assays. Plasmids within lysogenic cells: square, Po + oop + ori + (results shown for p27R, but identical results were observed for p27); triangle, Po− oop + ori +; inverted triangle, Δ (to-oop-Po) oriλ+ (ITN-AT+); diamond, cII-oop-Po + Δoriλ; circle, none (no plasmid). The standard deviation is shown for all of the data points, but is too small for visualization in some data intervals.

Thermal Induction of repλ or the repP22 –hybrid λcI857 prophages.

Lysogenic cultures of strain 594 were grown at 30° and each prophage was thermally induced by shifting the culture from 30° to 42° at time 0. A. Thermally induced repP22 prophage. B. Thermally induced repλ prophage. The results represent the averages for 2 independent assays. Plasmids within lysogenic cells: square, Po + oop + ori + (results shown for p27R, but identical results were observed for p27); triangle, Po− oop + ori +; inverted triangle, Δ (to-oop-Po) oriλ+ (ITN-AT+); diamond, cII-oop-Po + Δoriλ; circle, none (no plasmid). The standard deviation is shown for all of the data points, but is too small for visualization in some data intervals. We examined if a cloned intact O gene, repressed at 30°C, but expressed at 39° and 42°, exhibited IP to repλ phage plating (Table 4). The result was similar to that for the Δ (t) oriλ+ plasmid carrying a fragment of O (Fig. 1C), i.e., no significant IP. The plasmid version containing intact O/oriλ, with cI from immλ, reduced the plaque diameter of all four assayed repλ phages but the version with a hybrid immλ-imm434 cI gene did not. λvir was inhibited for plating at 30° in cells with multiple copies of the O/oriλ plasmid version with cI from immλ, while λimm434cI was not inhibited, suggesting λvir plating remains sensitive to high CI repressor concentration (we made a similar observation with another cI + plasmid [18]).
Table 4

Averaged EOP on host cells +/− plasmids with cloned O genea.

Phage594594[pcIpR-O-timm]b 594[p434′pR-O-timm]b
(30, 39, 42°)c 30° d 39° d 42° d 30° e 42° e
λimm434cI 1.00.250.300.651.01.0
λcI721.0<1×10−8 <1×10−8 0.200.760.76
λcI[Ts]8571.0ndf ndf 0.270.771.0
λvir1.0<1×10−6 0.750.741.01.0

The average EOP per indicated phage was relative to that phage plating on strain 594 cells. The standard errors were all <0.05.

The precise O sequence (ATG = 38686–39582 plus TAA stop codon that replaces normal TGA stop at end of O) was cloned to make plasmids pcIpR-O-timm and p434′pR-O-timm. In each plasmid, gene O occupies the position corresponding to λ gene cro (in phage) and the consensus Shine Dalgarno sequence for cro was maintained ahead of O in pcIpR-O-timm [75], [76]. In p434′pR-O-timm, the SD differed by one bp compared to the SD in pcIpR-O-timm because of the slightly different sequence ahead of cro in imm434 DNA [77]. The O gene within pcIpR-O-timm is transcribed from p and regulated by cI[Ts]857 repressor: at 30° O is repressed, at 39° and 42° O is expressed, or fully expressed. Gene O is constitutively expressed from p in p434′pR-O-timm.

The column for plating at 30°, 39° and 42° yielded equivalent phage titers on 594 and the EOP was set to 1. Plaques ranged between 0.5–2 mm in diameter.

Plaques formed were tiny.

Plaques ranged from 0.3–1 mm diameter.

nd is not done, since equivalent results were expected as seen for λcI72.

The average EOP per indicated phage was relative to that phage plating on strain 594 cells. The standard errors were all <0.05. The precise O sequence (ATG = 38686–39582 plus TAA stop codon that replaces normal TGA stop at end of O) was cloned to make plasmids pcIpR-O-timm and p434′pR-O-timm. In each plasmid, gene O occupies the position corresponding to λ gene cro (in phage) and the consensus Shine Dalgarno sequence for cro was maintained ahead of O in pcIpR-O-timm [75], [76]. In p434′pR-O-timm, the SD differed by one bp compared to the SD in pcIpR-O-timm because of the slightly different sequence ahead of cro in imm434 DNA [77]. The O gene within pcIpR-O-timm is transcribed from p and regulated by cI[Ts]857 repressor: at 30° O is repressed, at 39° and 42° O is expressed, or fully expressed. Gene O is constitutively expressed from p in p434′pR-O-timm. The column for plating at 30°, 39° and 42° yielded equivalent phage titers on 594 and the EOP was set to 1. Plaques ranged between 0.5–2 mm in diameter. Plaques formed were tiny. Plaques ranged from 0.3–1 mm diameter. nd is not done, since equivalent results were expected as seen for λcI72.

Dissecting IP sequence requirement(s)

The spacing interval between the t sequence and oriλ in p50 was modified by deletion or insertion (Fig. S3D) to learn if the spatial orientation between these two regions was important for IP. All the modified versions of p50, i.e., p51, p51kan, and p52, retained IP (Fig. S3C–D). We asked if transcription of oop from p participated in IP by inactivating the -10 region of p, replacing the sequence ATTAT with GCGCG in p27R to stringently assess a requirement for oop expression from a high copy oriλ plasmid. The resulting plasmid, p27Rp − (Fig. 3C), no longer expressed oop, as determined by the OOP antisense phenotype/cII inactivation assay (see Materials and Methods) and was defective for IP (Fig. 3D), suggesting that transcription from p is essential for IP. To distinguish whether the transcription of the downstream oop sequence, or just transcription initiation from the p promoter was required for IP, the coding sequence of oop was modified in plasmid p27R-R45OOP (Fig. 3C). Nucleotides 2–46 of oop were replaced with a randomly chosen sequence, edited to remove internal secondary structure formation. For maintaining the self-terminating stem-loop structure of t, the distal 31 nucleotides of oop were retained, as was the first base pair of the oop sequence, corresponding to 5′ pppG of OOP RNA. p27R-R45OOP was unable to serve as an antisense RNA to inactivate cII and it was defective for IP (Fig. 3D, columns 1–3). The results with plasmids p27Rp − and p27R-R45OOP suggest that transcription of the intact oop sequence is required for IP, rather than just transcription initiation from p.
Figure 3

Replication silencing of repλ phages requires oop, and iterons

(ITN) from λ. A. The non-excisable cryptic λ fragment (short arrow) inserted within the E. coli chromosome in strain Y836 [13], [35] remains repressed at 30° where the prophage repressor is active. Shifting cells to about 39° inactivates the CI857 repressor that prevents λ prophage transcription and replication initiation from oriλ. Multiple λ bidirectional replication initiation events from oriλ generate the onion-skin replication structure drawn at right. B. Map showing oop-oriλ region. The DNA sequence for oriλ, shown as a rectangle around ITN-AT within gene O has four repeated 18 bp iteron sequences (ITN1 to ITN4), each separated by short spacer, and joined by a 38 bp high AT-rich sequence. The genes cII and O are each shown truncated and are transcribed rightward from pR. The oop sequence, which overlaps cII is transcribed leftward from pO. C. Illustrated mutations within the λ DNA region in plasmids numbered 1–6 (Table 2). Plasmid p27R (shown as #1) carries with WT sequence from which other plasmids were derived. In each plasmid the rop gene was deleted to provide higher plasmid copy number per cell to test the stringency of introduced mutations. The “X” in #2 inactivates the p promoter for oop gene; the filled rectangle in #3 (mutation oopR45) substitutes random 45 bp for 45 bp within oop providing a 77nt RNA without internal secondary structure (Fig. S3B); and the gaps in #'s 4–6 are deletions (Table 2). D. Columns (left ‘a,’ to right ‘g’): Lane ‘a’ shows the plasmid number and common name (Table 2), with plasmid genotype indicated in part C. Lanes ‘b’ and ‘c’: EOP of repP22 and repλ phages on 594 host cells with indicated plasmid; ‘d’ summary of the inhibitory effect of a plasmid in 594 cells to the plating of repP22 or repλ phages, where NONE is essentially no inhibition of plating and FULL indicates that plaque formation was prevented by the presence of the plasmid. Lanes “e” through “g” indicate the results of a separate experiment to determine if plasmids #1–5, transformed into strain Y836, can suppress Replicative Killing, which occurs upon prophage induction when the Y836 cells are raised above 38°C. Prophage induction leads to replication initiation from oriλ within the chromosome, as shown in part A, which is very lethal to cell. Lane ‘e’ shows the level of cell survival upon shifting the cells to 42°C. The survival of Y836 cells that were diluted and spread on plates incubated at 42°C requires plasmid suppression / interference of replication initiation and cell killing upon de-repression of the prophage in Y836 cells. Two single colonies of each transformant of Y836 cells were inoculated into 20 ml TB +50 ug/ml ampicillin and grown overnight at 30°C. The following day the cultures were subcultured (2.5 ml overnight culture +17.5 ml TB and grown to mid-log (∼0.35 A575nm), whereupon, cells were diluted into buffer and spread on TB plates that were incubated for 24 hr at 30°C, and onto TB and TBamp50 plates that were incubated at 42°C for 24 hr. Survival to Replicative Killing was assessed by dividing the average cfu/ml at 42°C incubation (the cell titers on both TB and TBamp50 plates were equivalent) by average titer for cell dilutions incubated at 30°C. Lane ‘f’ is a summary of the plasmid's effect on Replicative Killing of induced Y836 cells, where NONE indicates the cells were killed upon induction, and FULL reflects high cell survival as determined by colony formation at 42°. The values in parentheses show standard error for at least two independent determinations. Lane “g” shows the level of each plasmid present in the cells at 30°C (noninduced), immediately prior to shifting cells to 42°C (see legend, Fig. 4). The duplicate cultures processed at time 0 were extracted for DNA using Qiagen DNAeasy Kit, estimating 1.0×108 cells per 0.1 A575nm and calculating the amount of cell culture needed for 2.0×109 cells per DNA preparation. All DNA samples were prepared in duplicate. The gel purified bands for the plasmid DNA present in the 0 time cultures was assessed by hybridization as described in Fig. 4.

Replication silencing of repλ phages requires oop, and iterons

(ITN) from λ. A. The non-excisable cryptic λ fragment (short arrow) inserted within the E. coli chromosome in strain Y836 [13], [35] remains repressed at 30° where the prophage repressor is active. Shifting cells to about 39° inactivates the CI857 repressor that prevents λ prophage transcription and replication initiation from oriλ. Multiple λ bidirectional replication initiation events from oriλ generate the onion-skin replication structure drawn at right. B. Map showing oop-oriλ region. The DNA sequence for oriλ, shown as a rectangle around ITN-AT within gene O has four repeated 18 bp iteron sequences (ITN1 to ITN4), each separated by short spacer, and joined by a 38 bp high AT-rich sequence. The genes cII and O are each shown truncated and are transcribed rightward from pR. The oop sequence, which overlaps cII is transcribed leftward from pO. C. Illustrated mutations within the λ DNA region in plasmids numbered 1–6 (Table 2). Plasmid p27R (shown as #1) carries with WT sequence from which other plasmids were derived. In each plasmid the rop gene was deleted to provide higher plasmid copy number per cell to test the stringency of introduced mutations. The “X” in #2 inactivates the p promoter for oop gene; the filled rectangle in #3 (mutation oopR45) substitutes random 45 bp for 45 bp within oop providing a 77nt RNA without internal secondary structure (Fig. S3B); and the gaps in #'s 4–6 are deletions (Table 2). D. Columns (left ‘a,’ to right ‘g’): Lane ‘a’ shows the plasmid number and common name (Table 2), with plasmid genotype indicated in part C. Lanes ‘b’ and ‘c’: EOP of repP22 and repλ phages on 594 host cells with indicated plasmid; ‘d’ summary of the inhibitory effect of a plasmid in 594 cells to the plating of repP22 or repλ phages, where NONE is essentially no inhibition of plating and FULL indicates that plaque formation was prevented by the presence of the plasmid. Lanes “e” through “g” indicate the results of a separate experiment to determine if plasmids #1–5, transformed into strain Y836, can suppress Replicative Killing, which occurs upon prophage induction when the Y836 cells are raised above 38°C. Prophage induction leads to replication initiation from oriλ within the chromosome, as shown in part A, which is very lethal to cell. Lane ‘e’ shows the level of cell survival upon shifting the cells to 42°C. The survival of Y836 cells that were diluted and spread on plates incubated at 42°C requires plasmid suppression / interference of replication initiation and cell killing upon de-repression of the prophage in Y836 cells. Two single colonies of each transformant of Y836 cells were inoculated into 20 ml TB +50 ug/ml ampicillin and grown overnight at 30°C. The following day the cultures were subcultured (2.5 ml overnight culture +17.5 ml TB and grown to mid-log (∼0.35 A575nm), whereupon, cells were diluted into buffer and spread on TB plates that were incubated for 24 hr at 30°C, and onto TB and TBamp50 plates that were incubated at 42°C for 24 hr. Survival to Replicative Killing was assessed by dividing the average cfu/ml at 42°C incubation (the cell titers on both TB and TBamp50 plates were equivalent) by average titer for cell dilutions incubated at 30°C. Lane ‘f’ is a summary of the plasmid's effect on Replicative Killing of induced Y836 cells, where NONE indicates the cells were killed upon induction, and FULL reflects high cell survival as determined by colony formation at 42°. The values in parentheses show standard error for at least two independent determinations. Lane “g” shows the level of each plasmid present in the cells at 30°C (noninduced), immediately prior to shifting cells to 42°C (see legend, Fig. 4). The duplicate cultures processed at time 0 were extracted for DNA using Qiagen DNAeasy Kit, estimating 1.0×108 cells per 0.1 A575nm and calculating the amount of cell culture needed for 2.0×109 cells per DNA preparation. All DNA samples were prepared in duplicate. The gel purified bands for the plasmid DNA present in the 0 time cultures was assessed by hybridization as described in Fig. 4. The oriλ sequence comprises bases 39034–39160 within gene O (Fig. 3B), with four 18 bp iteron (ITN1–4) sequences joined to a 38 bp high AT-rich sequence. The binding of O protein to oriλ is required for theta-mode replication initiation [15], [19]–[27]. A requirement for the ITN's and AT-rich region for IP was investigated using plasmids p27RΔITN1–4, p27RΔITN3–4, and p27RΔAT (Fig. 3C). The deletion of ITN1–4 or ITN3–4 nullified IP; whereas, the deletion of the AT-rich region was without influence on IP (Fig. 3D, columns a–c). In the cII inactivation assay for measuring synthesis of OOP RNA, clear plaques by λcI857(18,12)P22 were formed on 594 cells transformed with p27RΔITN1–4, p27TΔITN3–4, or p27RΔAT, indicating that each synthesized OOP RNA. Thus, transcription of the oop sequence from p and the presence of ITN's (particularly ITN3–4) are requirements for IP directed to repλ phage.

IP silences λ replication initiation

Lambda replicates in two stages. The early or bidirectional (theta) mode from oriλ starts within two minutes following thermal de-repression of a λcI[Ts]857 prophage [28]. The late or rolling circle (sigma) replication mode forms linear DNA concatemers, the preferred template for packaging λ DNA into phage heads. The sigma mode arises about 15 min after phage infection of cells [29]–[32]. Skalka et al. [31] stated that replication via the “early mode occurs only once or twice, after which rolling circle (late) replication predominates.” They suggested that a direct, internal control gene for the turn-off of early replication either “does not exist”, or “must not be expressed in the absence of replication” because early replication products accumulate (after infection or induction) when concatemer formation is destabilized in λ gam mutants, or under fec − conditions (involving both λ red and host recA mutations). The chromosome in strain Y836 (Table 1; Fig. 4A) has an engineered cryptic λ prophage deleted for recombination genes int-xis-exo-bet-gam-kil involved in general and site specific recombination [13] and for genes orf146 ( = orf) – Jb2, including genes required for cell lysis and phage morphogenesis [33], but it encodes the immλ and repλ regions. Transcription of O–P from p is prevented at 30° by the cI[Ts]857 encoded temperature sensitive repressor. Inactivating the CI repressor, by shifting cells grown at 30° to 42°, triggers oriλ-dependent bi-directional replication initiation from the trapped λ fragment. Initiated replication forks escape leftward and rightward beyond the λ fragment and into the E. coli chromosome. This event is lethal to the cell and was termed Replicative-Killing [7], i.e., RK+ phenotype [18], [34]. Survivor cells that escape Replicative-Killing (RK− mutants) arise within the RK+ starting cells and were found to possess mutations that prevented replication initiation from oriλ [13], [14], [33]–[35]. Transducing a dnaB mutation (GrpD55) that prevents λ replication initiation (but not E. coli DNA synthesis) into the RK+ Y836 cells can fully suppress Replicative-Killing without interfering with gene expression from the induced λ fragment [18]. We examined whether plasmids exhibiting the IP phenotype could suppress Replicative-Killing (Fig. 3D, rightward columns e-g). The viability of RK+ Y836 cells shifted from 30° to 42° was <0.00001. Similar results were seen when Y836 was transformed with p27R-R45OOP, p27RΔITN1–4, or to a lesser extent with p27Rp −, indicating that these three plasmids do not suppress the RK+ phenotype. Cells transformed with plasmids p27R and p27RΔAT suppressed Replicative-Killing at 42°, suggesting that they interfered with (silenced) theta-mode replication initiation from the chromosomal λ fragment.

Assay for prophage replication from oriλ.

This experiment was undertaken in parallel with the experiment shown in columns “e–g” of Fig. 3D. A. Map of λ fragment within Y836 cells. The thick solid line shows λ fragment within the E. coli chromosome (open boxes); the NdeI restriction sites within λ and chromosome are shown along with the DNA bands formed after cleavage; the λ region amplified to prepare a DNA probe is drawn. B. Map region of the λ DNA fragment cloned within plasmid p27R (2873 bp) (without indicating the small mutational changes within similar λ fragments in the other plasmids). C. Assay for replication initiation from oriλ after shifting Y836 culture cells from 30° to 42° to induce transcription and oriλ replication from the cryptic prophage. Cultures were grown to mid-log and aliquots were removed at time 0 as described in legend, Fig. 3. Thereupon, cultures were transiently swirled in a 60°C water bath and transferred to a 42°C shaking bath for one hour and aliquots were removed. Cell concentration of the 42°C aliquots was based upon the calculations for 30°C 0-time cultures, and DNA was prepared using Qiagen DNAeasy Kit from 2.0×109 cells. The concentration of extracted DNA was determined by spectrophotometer (A260nm x DNA dilution X 50 ng/ml). The Y836 cellular DNA (2.5 ug of ethanol precipitated and resuspended DNA) was digested 2 hrs with NdeI and digests were run on horizontal 0.7% agarose gel, followed by Southern transfer of DNA bands. The Southern blot bands for the 1774 bp chromosomal prophage fragments were each scanned 3X using GE Healthcare software program ImageQuant version 5.2 and the region under the peaks was integrated and averaged. The numbers below the bands compare the relative levels of 1774 bp fragment obtained for induced / noninduced sample pairs. Refer to Hayes et al. [18] for detailed hybridization methodology, and for comparing the effect of a cI + repressor expressed from a plasmid on prophage induction, the influence of host recombination defects on replication initiation from oriλ from the prophage in Y836 cells, and the inhibition of replication initiation from oriλ by host mutations. We examined if the IP-plasmids could block replication initiation from a thermally induced cI[Ts]857 λ fragment within the Y836 chromosome. Replication initiation arising from the oriλ region of the induced cryptic prophage was assessed by probing for a 1774 bp NdeI fragment (Fig. 4A–C) following Nde I digestion of the Y836 cell chromosome. The probe to the NdeI fragment overlapped with each of the λ fragments in the plasmids introduced into Y836, permitting an internal measure of plasmid copy increase. Theta-mode replication initiation increased by about 3-fold from oriλ when Y836 cells without a plasmid were shifted from 30° to 42° (Fig. 4C). The oop + oriλ+ plasmid p27R fully inhibited theta mode replication initiation, in full agreement with the data showing that this plasmid blocked Replicative-killing (Fig. 3C). Cells with p27RΔITN1–4, with a deletion of the four iterons (but not the AT-rich region) was not inhibitory; whereas, the converse plasmid p27RΔAT, modified to remove the high AT-rich sequence but containing ITN1–4, was fully inhibitory to theta-mode replication initiation from the prophage oriλ site. The intensity of the replication increase was not as robust as previously seen (Fig. 2 in [18]) where the probe was larger and could detect two λ prophage restriction fragments (i.e., 3675 bp oriλ band, and a 4250 bp band showing escape replication), possibly because of the high level of competition for the probe by the λ DNA within the plasmids. Two of the 1774 bp bands at 42°C for cells where oriλ replication initiation was inhibited decreased slightly compared to their 30°C counterparts. This may represent some level of DNA extraction variation, or it could be real and represent fragment destruction resulting from abortive oriλ replication initiation from the prophage in these strains.

Escape from IP

We previously showed [18] that marker rescue for immλ recombinants was below the level of detection for Y836 dnaB-GrpD55 host cells infected with imm434 phage deleted for λ genome regions NinL (int-red-gam recombination functions) and NinR (ren-ninA-ninI, including Orf and Rap) (Table 1 in [18]). The same result was seen for Y836 recA host cells infected with imm434 versions of NinR+ ΔNinL and ΔNinR ΔNinL phages (Table 2, lines 2–3 in [18]). The GrpD55 locus was suggested linked to dnaB [36], and Horbay [37] subsequently determined by sequence analysis that it represented two missense mutations within dnaB. The dnaB-GrpD55 mutation confers a temperature sensitive phenotype for λ plating but does not prevent E. coli replication, cell growth [36]. The EOP of λ on strain W3350 dnaB-GrpD55 was significantly reduced compared to W3350 (EOP set  = 1.0). The respective EOP's at 30°, 40° or 42° on the dnaB-GrpD55 host were 0.08, 0.01, <0.0001 (for λcI857); 0.2, 0.002, <0.0001 (for λimm434cI); and 0.4, 0.04, <0.0001(for λimm434ΔNinR), showing increasing temperature sensitivity for λ replication, while the E. coli dnaB-GrpD55 host was able to form effective cell lawns at the elevated temperatures. We define “free-loader” coefficient, as a measure of phage progeny for infections at multiplicity of infection (MOI) 5, per the phage progeny from infections at MOI 0.01 (see Discussion). The availability of λ recombination functions within an infected cell can influence the free-loader coefficient. W3350 dnaB-GrpD55 recA + cells were infected at MOI's of 5 or 0.01 with λ deleted for the NinL, NinR, or both recombination regions, then incubated for 90 minutes at 42° and plated for phage burst. Infections with phages λimm434NinL+NinR+, λimm434NinR+ΔNinL, λimm434ΔNinR NinL+, and λimm434 ΔNinLΔNinR yielded respective coefficients of 1065 (+/−18 std. error), 502 (+/− 31), 136 (+/−10), and 111 (+/− 27), suggesting that the λ NinR and NinL recombination functions can influence phage burst from multiply infected cells where the infecting phages are blocked for theta-mode oriλ-dependent replication initiation by the dnaB-GrpD55 mutation. This result supports our prior suggestion [18] that ori-specific theta-mode replication initiation, dependent upon P-DnaB interaction, can be bypassed in multiply infected cells, i.e., phage replication can likely be driven by intermediates derived via homologous recombination between co-infecting phage genomes. The results from Fig's 1, 2, 3 and 4 suggest that IP serves to block / silence replication initiation from oriλ. We examined whether IP could be bypassed, comparing the bursts from singly infected (low MOI, 0.01), or multiply infected (high MOI, 5) cells (Table 5). Infections of wild type host strains W3350 and 594 at either MOI's of 5 or 0.01 with repλ or repP22 phages produced essentially equivalent bursts. A similar result was seen for repP22 phage infections of W3350 dnaB-GrpD55 cells at either MOI 5 or 0.1. There was essentially no burst (background level) when the repλ phage infected W3350 dnaB-GrpD55 cells at an MOI of 0.01; however, the phage burst was equivalent to that on the W3350 cells when the W3350 dnaB-GrpD55 cells were multiply infected at an MOI of 5. Thus, while the altered DnaB protein [GrpD55 allele] interferes with the P-DnaB interaction required for theta-mode λ replication initiation, it can still apparently drive λ or E. coli DNA synthesis that is independent of P. Placing multiple copies of a recombination proficient λ genome within a cell appears to bypass the P-DnaB interaction at oriλ required for the theta-mode of λ replication initiation. Similarly, 594 cells with plasmid p27R (oop + oriλ+) prevented phage burst from cells infected at MOI 0.01. But when these same cells were infected at MOI 5, IP was suppressed (bypassed). 594 cells with p27Rp −, which is defective for IP, yielded an essentially similar repλ phage burst at MOI 0.01 as when 594 cells without the plasmid were infected. These results suggest that IP serves to silence / inhibit theta-mode oriλ replication initiation and that multiple copies of recombination-proficient λ genomes can, at some level, bypass this essential requirement for replication initiation from a single prophage or from one infecting λ genome.
Table 5

oriλ-dependent DNA replication inhibition is bypassed in multiply infected cells.

Host StrainBurst of infecting phage per cell at indicated MOI a
λcI857 [repλ]λcI857(18,12)P22 b [repP22]
MOI 5MOI 0.01MOI 5MOI 0.01
W335035.5+/−5.331.0+/−6.213.8+/−1.411.3+/−3.4
W3350 dnaBgrpD5531.6+/−16.31.34+/−0.719.2+/−7.317.1+/−3.2
59425.8+/−4.225.3+/−8.514.6+/−3.89.4+/−0.8
594[pBR322]22.4+/−4.826.0+/−12.39.0+/−1.05.7+/−0.1
594[oop + oriλ+]21.1+/−8.21.1+/−0.76.8+/−0.66.1+/−0.7
594[oop + pOoriλ+]27.3+/−7.219.8+/−6.610.9+/−0.46.9+/−2.2

Burst at 110 min after infecting cells. The results are expressed as phage burst (# phage particles released per infective center) +/− standard error. Each value represents the average of ≥2 separate trials.

See [78] for host requirements for growth of λ-P22 hybrid.

Suppression of Inhibition Phenotype (Sip) by λ mutants and hybrids

We looked for a target of IP by i) characterizing 10 independent (Sip) mutants of λcI857 (Fig. 5); and ii) by screening for IP-escape, testing λ mutants and hybrid phages (Fig.'s S4, S5). We first asked if insertion by homologous recombination (of the AmpR oop + oriλ+ plasmid into the infecting phage) was responsible for Sip (Fig. S6 and Supplemental Methods S1), and eliminated this possibility. The cI – P regions were sequenced for 10 independent Sip phage isolates, and for λcI857cro27 with a null mutation in cro, Fig. 5 [11], [28], [38]–[40]. Three sip mutations, Sip 1, 2, 7 arose at two sites in O to the left of the ITN sequences, of which mutations Sip 2 and 7 introduced different changes in the same codon by altering position 38822. Five other Sip mutations (3, 6, 7, 8, 9, and 10) introduced missense changes within cro. Another Sip mutation (Sip 4) altered the ribosomal binding (SD) site for cro and another (Sip 5) changed the base preceding the AUG for cro. One of the sip phage (Sip7) was mutated in both cro and O. By conventional logic, the Sip mutations in cro might function by reducing Cro down regulation of p and thus increase O expression, or the Sip mutations in O increase O expression or activity.
Figure 5

Sequences of Sip and cro27 mutations.

For an alternative interpretation of the effect of Sip mutations on gene expression from p refer to Fig. S7B. GeneBank Accession #'s for Sip mutants: 1 (DQ372057.1), 2 (DQ372058.1), 3 (DQ372059.1), 4 (DQ372060). Newer data for all Sip phages and for cro27 mutation in λcI857cro27 was submitted, BankIt1376628 : (12). Phage λcI[Ts]857cro27 was found to be WT between the end of cII and start of P, i.e., O +.

Alternatively, several of the Sip mutants conferred missense mutations in an 81 codon open reading frame, PreX; these included five Sip mutations (of which Sip6 eliminated the PreX start codon); plus the “se” mutations (described above) introduce missense changes into PreX (Fig. S7). PreX can only be expressed via high level establishment mode p mRNA synthesis (i.e., 20–100X level of pM-cI transcription [28], [39], [40]), requiring CII activation at p [3]. The p transcript is antisense to cro, and the possible PreX reading frame from it would overlap 13 codons at the N-terminal end of cI, all of oR/pR region, and 35 codons of cro, and would be expressed from the same reading frame as cro, but the opposite coding strand (Fig. S7). Since six of the λcI857-derived Sip mutants produced five missense changes in cro (two independent Sip mutations, 8 and 10, each changed base pair 38183 in cro), we examined if any Sip mutants exhibited the λcI857cro27 plating phenotype. Phage λcI857cro27 has the interesting property of forming plaques at 37–39°, but not at 30° or 42° [38], [40]–[42], and of exhibiting a phenotype within infected cells termed Cro lethality (See [40] for a discussion of Cro lethality concept relative to rexA-rexB expression, translational frameshift sites within [43], and possible effect upon [14] high levels of p expression (Fig. S7A,B) from an induced cro-defective λ lysogen or infecting phage.) Our isolate of λcI857cro27 carried a single G-A transition (Arg to Gln) at base 38153 in cro (Fig. 5), nullifying cro activity. Only the Sip7 phage shared a nearly similar plating phenotype with λcI857cro27 by forming faint plaques at an EOP of <10−3 at 30°, tiny-faint plaques at EOP 0.3 at 42°, and 1 mm clear plaques at 37 and 39°. Sip phages 1–6 and 8–10 formed 0.5–1.0 mm turbid plaques on 594 host cells at 30°, and about 1 mm clear plaques at 37°. Only the Sip 4 and 8 phages plated with slightly reduced EOP, i.e., by 3 or 13-fold, at 30° compared to 37°. Alternatively, we asked if λcI857cro27 can escape IP, i.e., if it shares properties with the λcI857Sip phages, and found that the cro27 allele did not confer a Sip phenotype (Table S1). Thus, simply inactivating Cro does not directly confer a Sip phenotype, and so the Sip mutations must have another effect. The inability of the repλ phage λcI857 to escape IP was not modulated by the CI repressor, reflected by equally IP-sensitive repλ phages λwt (cI +), and phenotypically CI− (lysogenization-defective) phages: λcI72 (cI –), and by phages with CI-defective phenotype that escape replicative inhibition, i.e., λoR/pR point mutations (λse mutants: 100a, 101b, and 109b (Table 1, Fig. S7C), and λcI90c17 (Table 1), where pR-independent transcription [44], [45] arises via the c17 insertion downstream from pR). The repλ phages λvir, λimm21cI and λimm434cI partially escaped IP, plating with EOP's of 0.1 or higher (Fig. S4A), but their plaque sizes were reduced. The sequence of λimm434cI was identical to λ throughout the cII-O interval (Fig. S5). λvir is mutated in both o and o at bases 37979 and 38007 [2], [34], respectively, although, it is unclear what other mutations it possesses. The λimm21 hybrid had base alterations within the cII-oop overlap (Fig. S5) and a silent TGC to TGT codon change at 39,033 (not shown), one base left of the ITN1 sequence in O. Burst at 110 min after infecting cells. The results are expressed as phage burst (# phage particles released per infective center) +/− standard error. Each value represents the average of ≥2 separate trials. See [78] for host requirements for growth of λ-P22 hybrid. Plaque size is a qualitative measure of phage development or burst, and we previously found that impeding λ replication significantly reduced normal plaque size [18]. Thorough examination revealed that the plaques formed by λimm434cI on 594[oop + oriλ+] cells were barely visible, i.e., 5% of their normal diameter on 594 host cells (Fig.S4C) and λimm21cI plaques were 35% their normal diameter. Plaques formed on 594[oriλ+] cells by the repλ phages (Fig. S4C) were reduced in plaque diameter by about half, in agreement with the observations that oriλ+ plasmids partially interfere with phage maturation. To help ascertain why the repλ phages λimm434cI, and to a greater extent λimm21cI, partially escaped IP, their oop-rep regions were sequenced (Fig. S5). While phage 434 has three base changes within the oop sequence, the λimm434cI hybrid sequence was equivalent to λ. The λimm21cI hybrid shared the same sequence as phage 21, with an expected altered sequence within cII left of oop, and differences within the oop / cII overlap region (Fig.'s S1, S5). The λ/P22 hybrid, i.e., λcI[Ts]857(18,12)P22 that was insensitive to IP, carried the λ version of cII, yet differed: by one base (37673) within oop, by one base (36689) just right of the common -10 sequence (ATTAGG) for the oop promoter p, and completely diverged rightward from the λ sequence at base -19 (38694) within p, so that the -35 region's for the p promoters for λ and for λ/P22 hybrid were distinct (Fig.S5) as were downstream λ genes O -P [2] and P22 genes orf48-18–12 [46] (Fig. S2). All of the repλ phages formed plaques with ∼120% larger diameters on 594[oop +] vs. 594 cells (Fig. S4C), suggesting that OOP RNA can stimulate repλ lytic growth. The C-terminal 55 nt including the stop codon for gene cII overlap the 3′-end of oop (Fig. S1). The last 17 amino acids of cII are not required for CII activity, but this region is necessary for CII regulation by OOP [5]. The infection of cII +-λ phages into cells with plasmids expressing OOP micro RNA, which is antisense to cII [47] (Fig. 2), creates a cII-defective phenotype [48] resulting in clear plaques at 30° even for the hybrid λcI857(18,12)P22. Even our cI + version of λimm21 gave turbid plaques on 594, but clear on 594[oop +] host cells, suggesting that the five base changes within the oop / cII overlap region do not prevent OOP RNA (made from oop + plasmid) from serving as an antisense RNA to cII expression from imm21. Clearly, infecting cII + phages into cells expressing OOP RNA creates a phenotypic cII-defective condition, characterized by no p transcription, no cro antisense RNA, and lytic phage growth. Thus, we did not consider it relevant to evaluate independent missense cII - phages, all of which map left of the cII/oop overlap [3]. In hundreds of cro + cII + prophage induction experiments, for example [4], [28], [39], [40], [49], no l-strand transcription attributable to p was ever detected (Hayes lab results). This result, coupled which with our current understanding of the role of OOP as an antisense regulator of cII expression, suggests that the synthesis of OOP RNA under the conditions described herein will prevent p transcription from infecting phage or induced prophage. But, an OOP block to p transcription is insufficient on its own to explain CI-independent IP, i.e., oop + Δoriλ plasmids were defective in IP. We examined the IP-sensitivity of a phage deleted for cII-oop. The interval between AUG for cII and second codon for O in phage λcIcII ( = Δoop) [50] was deleted (i.e., λ bp 38363–38688; we confirmed by sequencing two isolates). The deletion fused the retained -35 region of the oop promoter, p (leftward from bp –14 at 38689), with the sequence left of the second codon for cII (bp 38362), changing the -10 region for p from ATTATG to CATATG, which might still support p-dependent leftward transcription. The λcIcII phage partially escaped IP, forming pinprick-ghost plaques (impractical to quantitate/measure) on 594[oop + -oriλ+], considerably smaller than those of λimm434cI on the same host (Fig. S4C). The λcIcII phage was much more sensitive to copies of oriλ and formed very much smaller plaques than λimm434cI or λcI857 phages on 594[oriλ+] and 594[oop p -oriλ+] cell lawns; yet it was capable of forming large clear plaques at EOP of 1 on 594 and 594[oop +] cells. Further analysis is needed to explain the paradox that repλ phages retaining the cII-oop region are sensitive to IP (requiring OOP and oriλ) yet their development is not curtailed by the presence of competing oriλ plasmids; whereas, deleting cII-oop has the opposite effect.

Sequences of Sip and cro27 mutations.

For an alternative interpretation of the effect of Sip mutations on gene expression from p refer to Fig. S7B. GeneBank Accession #'s for Sip mutants: 1 (DQ372057.1), 2 (DQ372058.1), 3 (DQ372059.1), 4 (DQ372060). Newer data for all Sip phages and for cro27 mutation in λcI857cro27 was submitted, BankIt1376628 : (12). Phage λcI[Ts]857cro27 was found to be WT between the end of cII and start of P, i.e., O +.

Discussion

Replicative inhibition

We previously showed that the hybrid phage λcI857(18,12)P22, with the repλ region swapped by repP22, was extremely sensitive to CI-dependent replicative inhibition, and by comparison, λcI72, the λ se mutants, and λcI90c17 were respectively 4.6, 27–76, and 173 fold less sensitive [13]. This result illustrates that CI-dependent replicative inhibition does not directly target the rep region, but rather, transcriptional activation of rep. In contrast, the repP22 phage escaped CI-independent replicative inhibition; whereas, the repλ phages as λcI72, the λ se mutants, and λcI90 c17 were fully sensitive. Therefore, we would assert that the CI-dependent (blocking transcriptional activation of the rep region) and the CI-independent (IP directed theta mode replication silencing) forms of replicative inhibition are completely distinct, and that their mechanisms are likely different, even if they share the same end result.

Requirement for IP

We have provided additional understanding of the observation, termed here IP (Inhibition Phenotype), whereby host cells with plasmids containing the oop-oriλ region of the lambda genome inhibited phage plating. This region includes several cis-acting target sites, for example, the iteron sequences, ITN1–4, bound by O protein and sites for promoter, p, and terminator, t, for the 77nt OOP micro RNA (Fig's S1,2,3B,5)[51]. In summary: i) Plasmids containing the λ t through oriλ DNA sequence inhibited the development of repλ infecting, or an induced λcI857 prophage, and neither the oop nor oriλ regions, separately, could account for IP. ii) IP was independent of the activity of λ repressors CI and Cro, iii) A λ/P22 hybrid with repP22 was insensitive to plasmids containing the tλ and oriλ DNA sequences, suggesting that IP is directed to a repλ function. iv) Sequence analysis revealed that the λ/P22 hybrid contained immλ, an essentially intact (one base change) oop sequence, a hybrid p promoter with a λ -10 region and P22 –35 region, and the substitution of λ genes O-P with P22 genes orf48–18– 12 [37], [51]. v) OOP RNA synthesis from the oop + plasmids channeled both the λ/P22 and λimm21 phages into a lytic mode to form clear plaques, suggesting the level of OOP RNA made was sufficient to serve as an antisense regulator of cII expression from the p transcript(s). [5], [47]. vi) A dissection of the contributions to IP revealed that an oop + plasmid deleted for the AT rich region of oriλ was fully functional for IP, oop + plasmids deleted for ITN1–4 or ITN3–4 were defective for IP, and oriλ+-containing plasmids substituted for 45bp within oop, or inactivating the p promoter for oop transcription, were defective for IP.

Phage escape from IP

In summary: 1) Two types of full escape from oop + oriλ+ plasmid-dependent-IP were observed: i) substitution of O-P in λ by orf48-18−12 in the λ/P22 hybrid (Fig. S5) enabled the hybrid to escape IP, even though its cII expression was inactivated by OOP RNA; and ii) Sip mutations within or near cro or in O suppressed IP. 2) Some repλ phage partially escaped oop + oriλ+ plasmid-dependent IP, but phage development was retarded (as evidenced by reduced EOP and plaque size). 3) Phages that could escape CI-dependent replicative inhibition were unable to suppress IP. This result refutes a hypothesis that natural or mutational events that increase transcription from p, e.g., by limiting Cro or CI binding to o or introducing downstream promoters, will augment transcriptional activation of oriλ, and in turn promote theta-mode-oriλ-dependent replication initiation, and suppress IP. Another explanation is needed. Anderl and Klein [52] suggested that if the ratio of DNA:O protein is increased, theta-mode replication initiation will be inhibited due to titration of O protein, which suggests that plasmid-borne oriλ iteron sites could act as competitor origins, sequestering the O protein made by infecting repλ phages. The “handcuffing” analogy for dimer formation [25] between O proteins binding to the iteron sequences in several oriλ sites could serve as a model for blocking the formation / completion / processing of a preprimosomal complex. The minimum molar ratio [53] of O protein:oriλ (termed O-some [54] complex) that was required for strand unwinding was 20∶1. When additional oriλ regions are present, or if multiple interacting O-oriλ complexes are formed, it is unlikely that this molar ratio will be achieved. Our results suggest that handcuffing cannot account for IP, even if multiple oriλ targets bind excess O protein. Cells with multiple copies of two plasmids lacking oop sequence, but encoding an intact gene O/oriλ, did not reduce EOP, i.e., exhibit IP, whether or not O was expressed.

Theta-mode replication silencing by IP

The loading of DnaB onto ssDNA, formed by strand separation within the high-AT-rich region of oriλ, was suggested to mark the end of the initiation phase of λ theta mode DNA replication [55]. Previously, we confirmed that theta-mode oriλ-dependent prophage replication initiation, which requires P interaction with, and loading of, DnaB, was inhibited if the host carried the dnaB-GrpD55 mutation, yet there was no obvious influence of this allele on E. coli DNA propagation [18]. Herein, we observed that both theta-mode replication from oriλ, and its manifestation, i.e., the Replicative Killing of induced cells (dependent upon triggering theta-mode replication from a trapped, defective λ prophage) was prevented in cells with plasmids exhibiting IP. Both observations strongly suggest that theta-mode replication initiation is silenced, in trans, by the oop + oriλ+ plasmids. Blocks to theta-mode replication initiation from an infecting phage, by cellular oop + oriλ+ plasmid copies or by the chromosomal dnaB-GrpD55 mutation, could be bypassed by multiply infecting such cells with λ. This result is not without precedent. Freifelder et al. [56] infected nonpermissive cells at MOI's between 0.01 and 40 with λcI857Pam3 phages that were variously inactivated for integration or Red recombination functions. For their Int+ Red+ variant, they showed an increase in phage burst of 240-fold between MOI's of 0.01 (transmission coefficient 0.001) and 10 (transmission coefficient of 0.24), yet the λcI857Pam3 phage was unable to form plaques on nonpermissive cells; and in our hands the Pam3 mutation reverts at a frequency of <10−7. Freifelder et al. [56] concluded that if recombination is reduced, the ability to produce mature phage was markedly reduced. McMillin and Russo [57] reported that under conditions which block λ DNA duplication, unduplicated λ can mature, including molecules which have recombined in the host. Stahl et al. [58] extended this observation, coining the term “free-loader” phage to describe phage produced under replication-blocked conditions, whose synthesis depended upon bacterial and phage recombination systems. We borrowed this concept, using “free-loader coefficient” to describe the influence of phage recombination functions on λ progeny from infected dnaB-GrpD55 cells in which the infecting phage genome cannot initiate theta-mode replication. We showed that phage recombination functions from both NinL and NinR regions can influence by up to ten-fold the phage progeny released from multiply infected dnaB-GrpD55 host cells, supporting the Freifelder et al. [56] conclusion. Sclafani and Wechsler [59] showed that at low MOI, no λ particles were produced in cells lacking a functional dnaB product; yet at high MOI, a significant proportion of the cells can produce phage. Thus, the bypass of an oriλ replication block in multiply infected cells could depend upon a recombination-driven replication shunt, possibly analogous to the replisome invasion mechanism described by Poteete [60]. It is recognized that if a cell contains ≥2 circularized λ genomes, recombination between the monomers can produce an invading strand which could lead to rolling circle replication, independent of oriλ [61]. Presumably, recombination / replication intermediates can be formed that produce packageable, concatemeric DNA by the introduction of a nick into one of the DNA strands of a λ monomer, enabling rolling circle replication initiating from the 3′-OH end of the nick, or by recombination between homologous λ DNA segments. It was proposed that double-strand break repair recombination intermediates in E. coli are capable of initiating and undergoing DNA replication [62], [63]. It is possible that the circularized λ genomes produce linear multimers, formed by the rolling circle type of plasmid replication dependent on the RecF recombination pathway [64]–[67]. The potential to bypass theta-mode replication initiation via recombination suggests that there is no obligatory order / mechanism for triggering late mode λ replication from the early oriλ-dependent replication products. Alternatively, the extensive evidence for a shift from early to a late replication mode supports the possibility that some natural mechanism can inhibit early theta-mode replication initiation. Two events come to mind where theta-mode replication initiation is undesired and would best be silenced. Theta-mode bidirectional replication forks arising from a λ DNA copy that is integrating, or has integrated, into the host chromosome will kill the potential lysogen via the escape replication (Replicative Killing). The initiation of theta replication from linear concatemeric DNA might inhibit genomic DNA packaging into the phage head. Our results for plasmid based IP suggest that there is a natural mechanism for silencing theta-mode replication initiation, i.e. the buildup of λ genomes with oop + oriλ+ sequence.

Toward a mechanism for IP

There are a number of ways oop expression could influence transcriptional activation of oriλ: i) OOP antisense RNA binding the p transcript could promote degradation of the downstream cII-O-P transcript, in turn limiting transcriptional activation of oriλ and O-P expression. ii) Cells expressing OOP antisense RNA can nullify CII formation, eliminating p transcription and the (little appreciated) potential of this mRNA to permit a) high CI repressor buildup, b) hypothetical orf-preX expression, or c) high level p-promoted antisense RNA to cro expression, in turn, reducing Cro buildup and interference with transcription from p (Fig. S7). Since the repP22 phage λcI857(18,12)P22 was insensitive to IP, yet almost fully shared the same cI-p sequence as repλ phages, it seems unlikely that the contribution of oop to CI-independent IP simply involves OOP serving as an antisense RNA to the p mRNA, or events that increase transcription from p, but they might explain why cells with an oop + plasmid can stimulate phage maturation (i.e., support larger plaques). Overall, the results suggest that OOP RNA expression from an oop-oriλ DNA template increases the sensitivity of repλ genomes to competing oriλ sequences, with the outcome of silencing theta mode replication initiation from the oriλ sites. This is a new idea in search of an explanation. Some form of molecular coupling between oop expression and oriλ may serve to block the formation or completion of the preprimosomal complex. Several old observations remain a mystery regarding the regulation of oop expression. A low level of p transcription arises from a repressed prophage [4], which, if extrapolated would additively increase the level of OOP in cells with multiple oop + plasmids. This low level transcript was discovered because its expression increased about 40-fold between 5 to 12 minutes following the thermal induction of a cryptic λ prophage (as in Fig. 4) [4], [28]. The increase was linked to phage replication, since a prophage deleted for P showed no OOP increase [4], nor was there an increase from intact λ prophages in cells with Ts host dnaB or dnaG genes, or prophage with O, P, or oriλ mutations [49] which we have confirmed by sequence analysis. While one might explain this as a gene dosage effect, the level of induced oop expression was about the same from an induced defective prophage [49] as from an induced λcI857Sam7 prophage defective for cell lysis (Table S2), where we typically see between 30 -200+ fold increase in phage particles; or when λ was induced in cells with a Ts dnaE mutation blocking DNA fork progression [49]. This coupling between replication events at oriλ, and oop expression, still requires an explanation.

Materials and Methods

Reagents and media

Growth experiments were carried out using tryptone broth (TB; 10 g Bacto-tryptone and 5 g NaCl per liter), TB plates (TB with 11 g Bacto-agar per liter) and TB top agar (TB with 6.5 g Bacto-agar per liter). Ampicillin was added to a final concentration of 50 μg/ml where required. Ф80 buffer (0.1 M NaCl, 0.01 M Tris-HCl, pH 7.6) was utilized for cell culture and phage dilutions, TE (0.01 M Na2 EDTA, 0.01 M Tris-HCl pH 7.6) and TE* (TE but with 0.001 M Na2 EDTA) buffers were used for DNA storage and manipulation of DNA, respectively. TM buffer (0.01 M MgSO4, 0.01 M Tris-HCl, pH 7.6) was used in phage burst assays. TBE buffer (0.089 M Boric acid, 0.002 M Na2EDTA, 0.089 M Tris-HCl, pH 8) was used to make agarose gels and as running buffer during electrophoresis. Restriction enzymes and T4 DNA ligase were from New England Biolabs. Taq DNA polymerase was from Invitrogen and New England Biolabs. Oligonucleotides were from Sigma Aldrich and Integrated DNA Technologies, Inc. Plasmid DNA was isolated using Promega Wizard Plus SV Mini and Midi prep, or Qiagen miniprep kits. DNA was isolated from gels using the Qiagen gel extraction kit, and reaction fragments were purified using the Qiagen QIA quick PCR purification kit.

Bacteria, bacteriophage, and plasmids

Table 1 shows the E. coli K-12 and bacteriophage strains and Table 2 and Fig.'s 1, 3, S3 show the plasmids employed. All of the plasmids were derived from plasmid pCH1 [11] prepared by ligating the λ34500–41731 BamHI fragment into the unique BamHI site of pBR322. The λ sequences are as described by Daniels et al. [2]. The λ fragment orientation in pCH1: λ base pair 41731 was closest to the N-terminal end of the interrupted tet gene.

Plaque Assay

Repλ  = λcI857 and repP22  =  λcI 857(18,12)P22 infecting phages were plated on several plasmid-containing host cell strains to measure plasmid-mediated inhibition of phage plating. An aliquot (0.25 ml) of a fresh overnight cell culture was mixed with 3 ml of warm TB top agar and 0.1 ml of diluted repλ or repP22 phage lysate, and poured over TB or TB+Amp plates. Plates were incubated at 30° overnight and plaques counted. The results were expressed as EOP, i.e. phage titer on 594[test plasmid] / phage titer on plasmid free host 594 cells.

Prophage Induction Assay

The repλ and repP22 prophages were thermally induced in lysogenic cells transformed with plasmids containing various λ fragments. Lysogenic cells were grown at 30° in 20-ml TB (+/– Amp) in a shaking bath to A575 nm = 0.15. The cI[Ts]857 prophage in the cells was synchronously induced by swirling the culture flask in a 55–60°C water bath for 15 seconds and then transferring to a 42° shaking water bath to denature the repressor. The culture absorbance was monitored at 30 minute intervals over five hours. Each culture assay was repeated, the several results were averaged and the standard error determined.

Phage Burst

Host cells transformed with plasmids containing various λ fragments were infected with a repλ or a repP22 phage at a high or low MOI. The phage particles released per infected cell (i.e. phage burst) were measured for each infection. Protocol: 16–18 hour culture cells grown at 30° in TB (+/– Amp) were pelleted and resuspended in an equal volume of Φ80 buffer. A cell aliquot (0.1-ml) was mixed with 0.2-ml of ice cold 0.01 M MgCl2/CaCl2 plus an appropriate volume of sterile phage lysate needed for MOIs of 5 or 0.01. The cell-phage infection mix was held on ice for 15 min to permit phage attachment and then transferred (time zero for measuring infective centers) to a stationary 42° air incubator for 10 min to permit phage infection. The cell-phage mixture was pelleted and resuspended (2X) in Φ80 buffer and the third cell pellet was resuspended in 0.4 ml pre-warmed 42° TB. Half of the resuspended cells (0.2-ml) were inoculated to 20 ml TB (+/– Amp), incubated with shaking at 42°, and aliquots were removed after 65 and 110 min from the time of inoculation to determine phage titer. The second half (0.2-ml) of the washed cell-phage mixture (first held 15 min on ice and then at 42° for 10 min) was immediately pelleted. The supernatant was used to measure the unattached phage remaining after the attachment and infection steps, and the cell pellet was resuspended, diluted, and aliquots were mixed with sensitive cells, top agar, and overlayed on a TB agar plate. Each plaque that arose on the plate was from a potential infective center (an infected cell that has not yet lysed). The phage burst (number of phage released per number of infective centers) was determined for the 65 and 110 min infections, correcting for the phage particles that did not attach to cells.

OOP Phenotype/CII Inactivation Assay

The last 17 codons of cII are not required for CII activity, but are necessary for CII regulation by OOP [5]. The C-terminal 52 nucleotides plus the stop codon for gene cII overlap the 3′-end of oop. The expression of OOP antisense RNA from a plasmid prevents lambda CII expression [48], resulting in an otherwise cII + phage producing clear, rather than turbid, plaques. An aliquot (0.3 ml) of stationary phase cells being tested for OOP activity was mixed with 0.1 ml of diluted λcI857(18,12)P22 phage plus 3 ml of warm TB top agar and poured onto TB plates. The plates were incubated overnight at 30°. Plaque morphology was then determined as clear (OOP+) or turbid (OOP–).

Plasmid Sequence Modification

We supplied primers and DNA template to the service at National Research Council/Plant Biotechnology Institute, Saskatoon to confirm the λ-region sequences for the plasmids employed and to verify the mutations introduced into plasmid p27R. PCR mutagenesis was used to modify the t and oriλ plasmid DNA sequences using the SOEing technique [68]. p27Rp − (t – -oriλ+): For mutating the -10 region of the p promoter in p27R, two primers were made that contained the sequence 5′GCGCG3′ in place of the wt sequence 5′ATTAT3′ at λ bases 38684–λ38688. One primer contained the l-strand sequence λ bases 38671–38700 (LPo3) and the other contained the r-strand sequence λ bases 38700–38671 (RPo2) (Table 3). The p27R template was PCR amplified with the mutated primers and with primers LPo1 (5′ NdeI site and λ bases 38357–38372) and RPo4 (5′ EcoRI site and λ bases 39172–39153) in a two-step PCR technique. Both for this plasmid and for those described below, the final PCR product was digested with NdeI and EcoRI and ligated into the larger (∼2000 bp Amp + ColEI origin) fragment resulting from p27R NdeI and EcoRI digestion. p27R-R45OOP: Bases 2–46 of the oop gene coding sequence in p27R were mutated. Two primers were made to contain “random” bases (screened to eliminate secondary structures) replacing λ bases 38630–38674 of the wild type oop sequence. One primer contained the l-strand sequence (LROOP3) and the other contained the r-strand sequence (RROOP2) (Table 3). The p27R template was PCR amplified with the mutated primers and with primers LPo1 and RPo4 (Table 3). p27RΔITN1–4: Two hybrid primers were made to delete iterons (ITN) 1–4, each with sequences flanking the iterons. LΔITN1–4 contained the λ bases 39014–39033 fused to 39120–39144, while RΔITN1–4 contained the same sequence on the r-strand (Table 3). These two primers, in conjunction with LPo1 and RPo4, were used for deleting λ bases 39044–39119 (i.e. 87 nt of ITNS 1–4). p27RΔITN3–4: Two hybrid primers were made for deleting iterons 3 and 4 from p27R. LΔITN3–4 contained λ bases 39058–39077 fused to 39120–39144, while RΔITN3–4 contained the same sequence on the r-strand (Table 3). These two primers along with LPo1 and RPo4 were used to delete λ bases 39078–39119 (i.e. 41 nt comprising iterons 3 and 4). pHB27RΔAT: Primers LPo1 (5′ NdeI site and λ38357–38372) and RΔAT1 (5′ EcoRI site and λ39127–39113) were used to amplify the pHB27R λ DNA fragment. The resulting PCR fragment was digested with NdeI and EcoRI and cloned into the 2000 bp pBR322 fragment from pHB27R digested with NdeI and EcoRI. The plasmid pHB27RΔAT was shown to be deleted for λ bases 39,128–39172, removing the AT rich region of oriλ (Table 2).

Isolation and sequencing Sip mutants

λcI857 formed small plaques at a frequency of ≤10−6 on 594[oop-oriλ] cells. An individual plaque from ten separate isolations was transferred by a sterile toothpick to 10 ul buffer (10mM Tris-HCL, 10 mM MgCl2, pH 7.6) and spread using sterile paper strips onto a fresh agar overlay of these cells. This procedure was repeated (as many as 13 times) yet always produced plaques that were heterogeneous in size on the 594[oop-oriλ] cells. Each of the ten independent Sip phages were plated on 594 host cells (without plasmid) and a single plaque was used to prepare a phage lysate. Single plaques arising from these lysates were sequenced from gene cI into P (λ bases 37905–39191) using primers LMH29 (37905–37922: 5′-CTGCTCTTGTGTTAATGG), L22 (38517–38534: TGCTGCTTGCTGTTCTTG), RPG6 (38569–38552: CAATCGAGCCATGTCGTC), and R9+1 (39191-39175: TGGTCAGAGGATTCGCC).

Assay for replication initiation from induced cryptic λ prophage

The method is described in [18], only herein, chromosomal DNA was digested with NdeI, not BstEII. Aligned conserved sequence regions for 23 lambdoid phages. Sequence regions were searched using a 33 nt region of sequence similarity between HK620 and λ (“sequence 5” in [79]). The bases in red show greater than 90% sequence homology. The sequence of OOP spans positions -90 (terminator end) through -10 (5′end). The termination sequence for lambda gene cII, extending from the left, is at position -33. Position 1 is set as the ATG start for lambda gene O, for P22 orf48 homologue as hkaW, EC_CP1693_21), or a HK097 gp53 homologue orf54 (see Fig. S2) [80]. An annotated version of this data was provided in the review [51]. The sequences were obtained and aligned using EBI's implementation of the ClustalW alignment algorithm (http://www.ebi.ac.uk/clustalw/) in full alignment mode as well as a hierarchical clustering method implemented in the Multalin program on the IRNA servers (http://prodes.toulouse.inra.fr/multalin/multalin.html) using a DNA identity matrix and various penalties imposed on gap opening, none on extension. Sequences were obtained from the NCBI nucleotide database. Accession numbers and references are as follows. GI:215104; lambda; E. coli [81]. GI:14988; 434; E. coli [77]. GI:4539472; 21; E. coli [82]. GI:19911589; stx2I; E. coli O157:H7 Okayama O-27 [83]. GI:4585377; 933W; E. coli O157:H7, strain EDL933 [84]. GI:49523585; phi-4795; E. coli strain 4795/95 serotype O84:H4, unpublished. GI:7239813; H-19B; E. coli [85]. GI:9634119; HK022; E. coli [86]. GI:32128180; Stx2II; E. coli O157:H7 Morioka V526 [87]. GI:32128012; Stx1; E. coli O157:H7 Morioka V526 [87]. GI:5881592; VT2-Sa; E. coli O157:H7 [88]. GI:6901584; HK097; E. coli [86]. GI:23343450; Nil2; E. coli O157:H7 strain Nil653, unpublished. P22-pbi; S. enterica serovar typhimurium [46]. GI:8439576; P22; S. enterica serovar typhimurium [89]. GI:1143407; ES18; S. typhimurium [90]. GI:13517559; HK620; E. coli H strain 2158 [79]. GI:51773702; CP-1639; E. coli 1639/77 [91]. GI:24250761; ST64T; S. enterica serovar typhimurium [92]. GI:33334157; Sf6; Shigella flexneri [93]. GI:14800; Фphi-80; E. coli [94]. GI:46357884; ST104T; S. typhimurium DT104; phage 434 (GI:14988); phage 21 (GI:4539472); and phage P22 (AF527608.1; GI:21914413; AF217253.1), [95]. Sequence date from this laboratory are shown for: lambda  =  λcI857 (DQ372056), λimm434cI (DQ372053.1), λimm21cI (DQ372054.1 being revised), and P22-Lambda hybrid  =  λcI857(18,12)P22, representing λhy106 from Dr. S. Hilliker, (DQ372055.1, ); and are expanded and compared to sequences for 434, 21, and P22 in Fig. S5. (TIF) Click here for additional data file. Comparative analysis of lambdoid phage maps. The regions cII-like, oop, orf, O-like and P-like are with reference to lambda gene map, e.g., gene cI of P22 is equivalent to cII of lambda. The numbers in boxes indicate RNA length in nucleotides (nt) for oop RNA, or amino acids per proteins cII, Orf, O or P, without specifying the level of gene homology. Color coding relates the similarity of protein length to lambda (pink), P22 (yellow) or Phi 80, with other colors grouping variations based on gene/protein length. Locus identity was obtained using the conserved 33 bp high homology region sequence (Fig. S1) ACTGGATCaATCcACAGGAGTaATTATGaCAAA from the promoter and 5′ end of oop RNA and BLASTed using an expectation value of 1000 and parameters to remove gapping penalty, each containing the conserved sequence with minimum 90% homology: lambda (J02459), 434 (V00635), 21 (AJ237660), Stx2 (AP004402), 933W (AF125520), phi 4795 (AJ556162), H-19B (AF034975), HK022 (NC_002166), Stx2 II (AP005154), Stx 1 (AP005153), VT2-Sa (AP000363), HK097 (AF069529), Nil2 (AJ413274), P22 (AF217253), ES18 (X87420), HK620 (AF335538), CP-1639 (AJ304858), ST64T (AY052766), Sf6 (AF547987), Phi-80 (X13065), and ST104T (AB102868). Examples of the open reading frame left of the O-like protein sequence are orf48 in HK022 [80], and gene p43 in HK97, representing 162 nt (NC_002167). This figure was redrawn with modification from [51]. (TIF) Click here for additional data file. Influence of spacing between and λ on repλ-inhibition. Influence of spacing between oop and oriλ on repλ inhibition. A. Plasmid p50 substitutes E. coli DNA from the specialized transducing phage λspi156 for the “ice” sequence of λ (Table 2) and was made by cloning the 684 bp EcoRV-EcoRI fragment from λspi156Δnin5 [96] into the equivalent sites in pBR322 [69]. B. The stable predicted secondary structures of OOP RNA were obtained using the IDI SciTools OligoAnalyzer 3.0 website. C. EOP of repλ and repP22 phages on host cells with modified Δice oop + oriλ+ plasmids. The averaged data is shown. (Near identical results were seen for each of the plasmids transformed into E. coli strain W3350, where standard errors were negligible for the repλ phage, and ranged between <0.1 to 0.28 for the repP22 phage on the different transformed cells.) D. Plasmid modifications to p50: λ DNA fragments in which the DNA interval between oop and oriλ was varied by deletion or insertion (Table 2). (TIF) Click here for additional data file. Plating-sensitivity to cells exhibiting inhibition phenotype (IP) and relative plaque size on cell lawns. A. Variation in susceptibility of repλ phages to the IP. A 0.3 ml aliquot of fresh overnight stationary phase 594[p27R] cells (grown in TB+50 ug/ml Amp) were mixed with 0.1 ml of test phage and 3.0 ml of molten top agar and poured onto a TB plate. Plates were incubated overnight at 30°C and resulting pfu were counted. EOP was calculated as the titer on strain 594[p27R]/titer on 594. The results represent the average of at least two independent assays. Averaged EOP's and standard errors values were: λWT (wild type), 5.17 ×10−6 ±2.57×10−6; λcI72, 1.73×10−6±6.99×10−7; λimm434cI, 0.01±0.04; λimm21, 0.70±0.06; λvir, 0.41±0.06; λcI90 c17, 1.0×10−7±1.0×10−8; λoR mutants (λse100a, λse101B, λ109b) 1.15×10−6±2.21×10−7. Notes: 1) The downstream promoter in λcI90c17 was apparently not strong enough to suppress IP. 2) The plasmids employed in earlier studies [8], [10], [12] inhibited λvir, but each included cI repressor gene. We show (Table 4) that λvir was inhibited for plating at 30° in cells with multiple copies of the O/oriλ plasmid version with cI from immλ; whereas, Fig S4A shows λvir is only partially inhibited by cells with oop + oriλ+ plasmids without cI, thus, CI availability to bind oR can increase repλ phage sensitivity to IP. B. Portion of λ map showing region of DNA substitution for the imm21 and imm434 hybrid phages and the portion of λDNA present in plasmids transformed into strain 594. C. Strain 594 was grown overnight to stationary phase in TB [18]; alternatively, 594 transformed with one of the plasmids, shown in part B, was grown overnight in TB+Amp (50 ug/ml). The culture cells (0.25 ml) were mixed with 0.1 ml of phage lysate dilution plus 3 ml TB top agar [18], poured on TB agar plates, and incubated overnight at 30°C. Phage plaque sizes were determined using a tissue culture (inverted) microscope at 4× magnification with an eyepiece grid. Each grid interval was 0.045 mm at 4× magnification. Plaque diameters were measured as grid units, i.e., grids/plaque. Approximately 30 plaques were measured per assay phage on each of the host strains and the average plaque diameter and SE were determined. All assays for a given phage were performed in parallel on each of the host strains using same preparation of agar plates. (TIF) Click here for additional data file. Sequence determination for distal to interval for λ-hybrid 434, 21, and P22 phages employed. Hybrid phage sequences compared to λ. The highlighted/underlined bases differ from λ sequence; all data were from this laboratory except sequences for phages 434 and 21; sequence differences rightward from base 38698 are continued in Fig. S1). Phage λimm21, which retains the repλ sequence, had a silent TGC to TGT codon change (not shown in Fig.'s S5 or S1) at 39,033 (one base left of the ITN1 sequence in O). Lambda  =  λcI857 (DQ372056) is as in [2]; λimm434cI (DQ372053.1); λimm21cI (DQ372054.1, being revised); and P22-Lambda hybrid  =  λcI857(18,12)P22, representing λhy106 from Dr. S. Hilliker (DQ372055.1). The comparative partial sequences for non-hybrid phages 434, 21 and P22 were: phage 434 (GI:14988); phage 21 (GI:4539472), and phage P22 (AF527608.1; GI:21914413; AF217253.1). (TIF) Click here for additional data file. PCR assay for plasmid recombination into λ Sip phage within region of λ homology. PCR Amplification of λcI857 and SIP Phage Isolates 1–4, from Gene cI Through Gene P. Lanes: 1 & 11, DNA mass ladders from Invitrogen, 2–3, λcI857, 4–5, λcI857 Sip1, 6, λcI857 Sip2, 7–8, λcI857 Sip3, 9–10, λcI857 Sip4. The phages were amplified with primers LMH29 and RPG6 (Methods and Materials). Each PCR was done in duplicate. λcI857 produced the expected 1721 bp fragment. The SIP isolates yielded a 1721 bp fragment, indicating that the p27R plasmid was not integrated into the SIP phage genomes between genes cI and P. (TIF) Click here for additional data file. Sequenced Sip and Se mutations falling within orf-preX. A. Organization for transcription of gene cI from pM and pE. Transcription from pE is 30–100X the level of transcription from pM, [11], [28], [39], [40] and includes an open reading frame preX [14] of 81 codons. Three powerful translational frameshift sites exist within the cI-rexA-rexB operon [14], [43] that could influence gene expression from the pE promoter, two arise within the N-terminal end of cI and one within rexA 1. B. DNA sequence showing potential translation of preX and its overlap with genes / proteins CI and CRO. This figure shows an alternative interpretation for the position of some Sip mutations shown in Fig. 5, which also map within orf-preX. The previously described Se-mutations confer a cI - phenotype [13]. The mutations se100a and 101b arise in oR2 and oR1 between the -35 regions for promoters pM and pR, and se109b is representative of four other spontaneous se mutations, arising within oR1 and just left of the -10 region of pR. An alternative interpretation is that se100a, se101b and 109b, respectively, confer G56V, T54K and T46N changes in the putative 81 codon preX orf. (TIF) Click here for additional data file. EOP of λcI857cro27 on host strains. (DOCX) Click here for additional data file. Relative OOP RNA transcription after prophage induction. (DOCX) Click here for additional data file. IP influence on phage plating. Sip phage characterization. Test for plasmid integration. Do λSip phages encode AmpR marker? Plaque PCR of Sip phages. References. (DOC) Click here for additional data file.
  83 in total

1.  Spontaneous lambda OR mutations suppress inhibition of bacteriophage growth by nonimmune exclusion phenotype of defective lambda prophage.

Authors:  S Hayes; C Hayes
Journal:  J Virol       Date:  1986-06       Impact factor: 5.103

2.  Constitutive lambda DNA replication by lambda-C17, a regulatory mutant related to virulence.

Authors:  S Packman; W S Sly
Journal:  Virology       Date:  1968-04       Impact factor: 3.616

3.  Genetics of the left arm of the chromosome of bacteriophage lambda.

Authors:  J S Parkinson
Journal:  Genetics       Date:  1968-07       Impact factor: 4.562

4.  Regulation of repressor expression in lambda.

Authors:  H Eisen; P Brachet; L Pereira da Silva; F Jacob
Journal:  Proc Natl Acad Sci U S A       Date:  1970-07       Impact factor: 11.205

5.  DNA base sequence of the po promoter region of phage lamdba.

Authors:  G Scherer; G Hobom; H Kössel
Journal:  Nature       Date:  1977-01-13       Impact factor: 49.962

6.  A segment of the phage HK022 chromosome is a mosaic of other lambdoid chromosomes.

Authors:  J Oberto; S B Sloan; R A Weisberg
Journal:  Nucleic Acids Res       Date:  1994-02-11       Impact factor: 16.971

7.  Initiation of coliphage lambda replication, lit, oop RNA synthesis, and effect of gene dosage on transcription from promoters PL, PR, and PR.

Authors:  S Hayes
Journal:  Virology       Date:  1979-09       Impact factor: 3.616

8.  Functional properties of replication fork assemblies established by the bacteriophage lambda O and P replication proteins.

Authors:  K M Stephens; R McMacken
Journal:  J Biol Chem       Date:  1997-11-07       Impact factor: 5.157

9.  Involvement of DNA replication in phage lambda Red-mediated homologous recombination.

Authors:  Anthony R Poteete
Journal:  Mol Microbiol       Date:  2008-04       Impact factor: 3.501

10.  The relationship between function and DNA sequence in an intercistronic regulatory region in phage lambda.

Authors:  M Rosenberg; D Court; H Shimatake; C Brady; D L Wulff
Journal:  Nature       Date:  1978-03-30       Impact factor: 49.962

View more
  6 in total

Review 1.  Bacteriophage lambda: Early pioneer and still relevant.

Authors:  Sherwood R Casjens; Roger W Hendrix
Journal:  Virology       Date:  2015-03-03       Impact factor: 3.616

2.  Phage Lambda P protein: trans-activation, inhibition phenotypes and their suppression.

Authors:  Sidney Hayes; Craig Erker; Monique A Horbay; Kristen Marciniuk; Wen Wang; Connie Hayes
Journal:  Viruses       Date:  2013-02-06       Impact factor: 5.048

3.  A dual promoter system regulating λ DNA replication initiation.

Authors:  Paweł Olszewski; Anna Szambowska; Sylwia Barałska; Magdalena Narajczyk; Grzegorz Węgrzyn; Monika Glinkowska
Journal:  Nucleic Acids Res       Date:  2014-02-05       Impact factor: 16.971

4.  The Bacteriophage Lambda CII Phenotypes for Complementation, Cellular Toxicity and Replication Inhibition Are Suppressed in cII-oop Constructs Expressing the Small RNA OOP.

Authors:  Karthic Rajamanickam; Sidney Hayes
Journal:  Viruses       Date:  2018-03-07       Impact factor: 5.048

5.  Complementation Studies of Bacteriophage λ O Amber Mutants by Allelic Forms of O Expressed from Plasmid, and O-P Interaction Phenotypes.

Authors:  Sidney Hayes; Karthic Rajamanickam; Connie Hayes
Journal:  Antibiotics (Basel)       Date:  2018-04-05

6.  Lambda gpP-DnaB Helicase Sequestration and gpP-RpoB Associated Effects: On Screens for Auxotrophs, Selection for Rif(R), Toxicity, Mutagenicity, Plasmid Curing.

Authors:  Sidney Hayes; Wen Wang; Karthic Rajamanickam; Audrey Chu; Anirban Banerjee; Connie Hayes
Journal:  Viruses       Date:  2016-06-22       Impact factor: 5.048

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.