| Literature DB >> 29621200 |
Sidney Hayes1, Karthic Rajamanickam2, Connie Hayes3.
Abstract
λ genes O and P are required for replication initiation from the bacteriophage λ origin site, oriλ, located within gene O. Questions have persisted for years about whether O-defects can indeed be complemented in trans. We show the effect of original null mutations in O and the influence of four origin mutations (three are in-frame deletions and one is a point mutation) on complementation. This is the first demonstration that O proteins with internal deletions can complement for O activity, and that expression of the N-terminal portion of gene P can completely prevent O complementation. We show that O-P co-expression can limit the lethal effect of P on cell growth. We explore the influence of the contiguous small RNA OOP on O complementation andEntities:
Keywords: O and P initiator proteins; O complementation by oriλ-defective alleles; bacteriophage lambda (λ); bi-directional replication initiation from oriλ; influence of O:P interactions on cell growth and O activity; oriλ interaction site
Year: 2018 PMID: 29621200 PMCID: PMC6022878 DOI: 10.3390/antibiotics7020031
Source DB: PubMed Journal: Antibiotics (Basel) ISSN: 2079-6382
Figure 1Replicative Killing, RK+ phenotype and selection for RK− mutants. (A) Defective prophage strains were made where the int-kil or int-ral genes of λ were substituted with the bio275 or bio10 regions of specialized transducing phage to remove a phenotype termed “killing to the left”, dependent on kil [23]. The starting cells included the chlA deletion Δ434 that removed all of the late genes, i.e., cell lysis, head and tail for λ [11]. These constructs include (i) an active immλ region with gene cI[Ts]857 encoding a repressor that blocks transcription from promoters pL and pR along with the cro repressor just right of pR, and (ii) the repλ region that includes genes O and P and the oriλ target for replication initiation from the λ genome. The genome for strain Y836, shown, has the bio+ operon to the left of the λ fragment and Δ431deletion to the right; (B) As long as strain Y836 maintains CI repressor activity the cells can grow normally without gene expression from the repressed λ fragment; (C) When the cells are shifted to growth conditions where the CI[Ts] repressor loses its ability to block transcription from pL and pR the remaining λ genes become derepressed, the phage replication initiation genes O and P are expressed and rounds of replication initiation arise from oriλ. The λ replication forks extend bidirectionally into the adjacent regions of the E. coli genome, likely colliding with E. coli replication forks. The event is highly lethal to the cell because the λ fragment has no mechanism for excision from the genome and was termed Replicative Killing [18]; (D) When cells with a conditionally repressible defective λ prophage are shifted from growth at 30 °C to 42 °C the Replicative Killing, RK+, phenotype is triggered, resulting in cell death. Rare mutations that suppress the loss of λ replication control are selected as RK− clones capable of colony formation at 42 °C. These survivor CFU have lost the capacity for λ replication. This strategy is based on the PDS selection [15], where an intact prophage is made N-defective, so that expression of int-xis and late/cell lysis gene expression is limited without N-antitermination of pL and pR transcription upon prophage induction. There are many possibilities for RK− mutants; (E) Cells acquiring defects in host genes participating λ replication are termed RK− Hd−. For example, the GrpD55 mutation in dnaB is of this type, though not isolated as shown [24,25]; (F) A marker rescue recombination assay is used to determine if the immλ regions genes and target sites remain functional (i.e., FI+) when substituted for the imm434 region of a hybrid phage. The FI assay scores for the activity of the pR promoter, but in practice it is a good indication of whether the λ fragment in Y836 cells was partially or fully deleted. An example of the deletion endpoints of RK− FI− mutants from Y836 is shown [26,27,28]; (G) It was found that brief pretreatment RK+ of cells held at 30 °C with a mutagenic substance, prior to shifting them to 42 °C increases the frequency of RK− mutants. This assay, termed the RK Mutatest, proved very sensitive due to the rather large target potential for RK− mutants [29,30,31].
Collection of sequenced phage mutants in O and P.
| Collection Isolate | Mutated Base in λ, Mutation(s), Comment, Strain Source a |
|---|---|
| Phage lysates (#) | |
| Mutations in | |
| λ | 38797 G to T GAG to TAG), LT; 37 AA at N-terminal of |
| λ [Ts] | 38914 G to T (GAG to TAG), λ induced from AC 1966 slant R473, sc1,2; 76 AA from N-terminal of |
| λ | 39166 G to T (GAG to TAG), LT; 160 AA at N-terminal of |
| λ | 39301 A to T (AAG to TAG), λ induced from AC 1966 slant R377, sc1,2; 205 AA at N-terminal of |
| λ | 39301 A to T (AAG to TAG), LT |
| λ | 39570, C to G, (TAC to TAG), WD; 294 AA from N-terminal of |
| Mutations in | |
| λ | 39786 (CAG to TAG), WD |
| λ | 39894 (CAG to TAG), GG |
| Host b (prophage), strain # | |
| C600(λ[Ts] | 38914 G to T (GAG to TAG) AC 1966 slant R473 (both sc’s) |
| C600(λ | 39301 A to T (AAG to TAG), AC 1966 slant R377 (both sc’s) |
| C600(λ | 39301 G to T (GAG to TAG), WD |
| M72 | 12 bpΔ λ bases 39123–39134, WD |
| M72 | 15 bpΔ λ bases 39139–39153, WD |
| M72 | 24 bpΔ λ bases 39096–39119, WD |
| 594(λ | 39122 C to A (ACA to AAA), WD |
| Aberrant designations or with additional mutations, as received (lysate or strain #) | |
| λ | has nonsense mutation, but WT for |
| λ | has nonsense mutation, but WT for |
| λ | no mutation in |
| λ | has nonsense mutation, WT for |
| λ | 38914 G to T (GAG to TAG); 38713 T to C (TTC to TCC); LT-MMS99 |
| λ | 39511 C to T (CAG to TAG); 39182 C to T (TCC to TTC); and 39510 A to T (CAA to CAT); LT-MMS254 |
| 594(λ | 38914 G to T (GAG to TAG), really is |
| C600(λ | 39182 C to T (TCC to TTC); and 39510 A to T (CAA to CAT); and 39511 C to T (CAG to TAG), AC 1966 slant R573 |
a Known strain sources: AC, A. Campbell; LT, L. Thomason; GG, G. Gussin, WD, W. Dove; WS, W. Szybalski. Furth [37] reported the original sources of the Oam mutations as: 8, 29 and 125 from [35], 905 from P. Toothman and I. Herskowitz, 1005 from I. Herskowitz, and 205 [38]. “AA” = amino acid(s). b Host C600 is SupE; The Pm− hosts 594 and M72 are supo. c Transcription from pL and pR, the lack of replication arising from oriλ, and the absence of any increase in phage titer following prophage induction were reported for these strains in [39].
Figure 2RK− ilr mutations characterized within λ genes O-P. The minimal oriλ size was suggested to include a HIGH-AT-rich region to the right of four iteron sequences, ITN’s1-4 [43,44], which each contain an 18 bp inverted repeat of hyphenated symmetry, joined by adenine residues that can cause oriλ to assume a bent structure [45]. The mutants shown designated ori95, ori96 and ori98 were obtained from WD from prophage with r-mutants r-95, r-96, and r-98. Note that Denniston-Thompson, et al., [46] sequenced the r-mutants r-99, r-96 and r93 which represent Δ12 bp (39120–39131), Δ15 bp (39138–39152) and Δ24 bp (39092–39115) [42]. Our sequence localization for ori96 (r96) differs by one bp from that assigned in [42].
Figure 3Expression vector pcIpR-(O alleles)-timm. Expression of gene O or an allele occurs upon inactivation of the CI repressor by raising cells grown at 30 °C to 42 °C. Immediately following the 299 codons of O is an ochre stop codon, where the last base in TAA represents the first base of the ClaI restriction site ATCGAT.
Complementation of λ Oam mutants by alleleic forms of O expressed from plasmids.
| Host Strains and [Plasmid] # a | EOP of λ Phage with | ||
|---|---|---|---|
| λ | λ | λ | |
| Pm+
| 1.0 | 1.0 | 1.0 |
| Pm−
| 0 | 0 | 0 |
| Complementation by | |||
| O+ combinations | |||
| [O] e, p465 | 0 | 0.2 | 0.1 |
| [O-SPA] f, p472 | 0 | 1.0 | 0.6 |
| [oop-O] g, p677 | 0.05 | 0.1 | 0.1 |
| O null mutations h | |||
| [ | 0 | 0 | 0 |
| [ | 0 | 0 | 0 |
| [ | 0 | 0 | 0 |
| O-origin ( | |||
| [ | 0 | 0 | 0 |
| [ | 0.2 | 0.3 | 0.2 |
| [ | 0.3 | 1.0 | 0.3 |
| [ | 0.3 | 0.1 | 0.3 |
| O-P combinations j | |||
| [O-36P], p565 | 0 | 0.01 | 0 |
| [O-63P], p566 | 0 | 0 | 0 |
| [O-P], p569 | 0 | 0 | 0 |
| [oop-O-P] k p567, p568 | 0 | 0 | 0 |
| ilr 566a l | 0 | 0 | 0.002 |
| 0 | 0 | 0.001 | |
a All of the complementation studies were undertaken in strains 594[pcIpR-Ovariant-timm] or with 594 cells transduced for the λ fragment mutants (ilr566a, BiB11t) from the original RK+ strain Y836. The host strain 594 is designated as being nonpermissive, Pm− (supo), without an amber suppressor). The precise sequences for each of the allelic forms of O were amplified by PCR, cloned into plasmid pcIpR-(‥)-timm, between BamHI and ClaI sites (designated by the internal brackets), and the inserted O-variant fragments were each verified by DNA sequence analysis. Each plasmid includes an allele of O positioned as is gene cro in WT λ, just downstream of promoter pR and the consensus ribosomal binding site (RBS) for cro. The initiation of transcription from pR is regulated by the Ts CI857 λ repressor encoded on the plasmid via binding to the operator site, oR that overlaps pR. For cells grown at 30 °C the CI Ts repressor remains active, binds to oR and blocks transcription initiation from pR. When the cells are shifted to 39–42 °C the CI Ts repressor transitions from partially to fully-inactive, allowing transcription initiation from pR and the expression of the downstream O allele. b The EOP value for “0” was set to <0.001. Thus, the difference between “0” and 0.1 is more than 100-fold. The efficiency of plating (EOP) was assessed at 30, 39 and 42 °C on cell lines containing plasmids. At 30 °C the results were all 0, i.e., the EOP was <0.001. In every situation, the plating results obtained at 42 °C showed an equivalent, or somewhat higher EOP than at 39 °C. All EOP data were calculated as: titer of Oam phage on indicated host with plasmid containing O allele/titer of the same phage on the Pm+ SupE host at same temperature. The phage titer on the Pm+ SupE strain was set as EOP = 1.0. All values are rounded up and are relative so that standard error is not shown but represents ±10–20% of the values indicated. Each of the plating phage were sequenced throughout the oop-O-P-ren genes and shown to contain only the designated Oam mutation. c Sequence designations for the O mutations are shown in Table 1 with mutations introducing amber stop codons: Oam905 at 38797, Oam29 at 38914, and Oam205 at 39579. To have all phages include the cI857 mutation the lysate #1023 was used for Oam29 which includes a silent mutation at 38713 (Ser to Ser). The phage nonsense mutations in O truncate gene expression, producing polypeptides of the length shown in the heading of Table 2, each with the N-terminal end of the WT protein. d Permissive, Pm+, strain was TC600 SupE, where the efficiency for amber suppression (not complementation) was used as the baseline for full complementation. e Sequence for O (λ WT bases 38686–39582), representing 299 codons, plus an ochre stop codon was inserted to make plasmid pcIpR-O-timm. f Fusion construct represents WT O-(7 amino acid linker GGSGAPM)-69 amino acid SPA tag sequence-ochre stop codon. The SPA tag sequence at COOH end of O includes a calmodulin binding site, a TEV (tobacco etch virus) protease cleavage site and 3X FLAG sequence [47]. g Results approximate data for two plasmid constructs oop#1-O, representing λ WT bases 38559–39582, and oop#2-O, representing λ bases 38546–39582, each inserted between the BamHI and ClaI sites in pcIpR-(‥)-timm. h Replicative-Killing defective (RK−) mutants in gene O (see Figure 2) isolated as survivors from induced cryptic λ prophage strain Y836 as described in [11,48]. i Removed O fragments from replicator mutants of M72(λ Nam7am53 cI857 r95), M72(λ Nam7am53 cI857 r96), and M72(λ Nam7am53 cI857 r98) lysogens from Rambach [20] via WD. j Plasmids were described in [25]. Each plasmid includes the intact sequence of O (λ bases 38686–39582 plus the N-terminal portions of gene P followed by ochre stop codon: 38686–39687 = O-P36, 38686–39768 = O-P63, 38686–40280 = O-P. Note that O and P are in different reading frames. k Plasmids p567 oop#1-O-P and p568 oop#2-O-P include λ bases 38559–40280 and 38546–40280, respectively, cloned between the BamHI and ClaI sites in the pcIpR-(‥)-timm plasmid [25]. The oop-O-P line represents equivalent data for plasmids oop#1-O-P and oop#2-O-P. l The RK− ilr mutant 566a derived from strain Y836 was transduced using P1 with the marker nad57::Tn10 that was inserted contiguous to the chromosomal λ fragment. Then the TetR immλ region was transduced into strain 594. m The kan marker was introduced into gene P in strain Y836 by recombineering (=strain Bib11t) and the defective λ fragment was transduced into 594 cells as indicated for moving mutation 566a (see [25] for additional details).
Figure 4Influence of induced O, P gene expression on cell growth at 42 °C. All the strains were made by transforming hosts 594 or 594 dnaB-GrpD55 with pcIpR-(‥)-timm plasmids that included the cloned O, P DNA fragment, and selecting the transformants on LBAmp50 agar (medium composition is described in footnote to Table 3). The plasmid inserts in each CFU employed were verified by DNA sequence analysis. Cells were inoculated from overnight cultures grown up overnight in LBAmp50 broth and then 0.4 mL of culture was added to triplicate 20 mL fresh LB cultures that were incubated at 30 °C for ~30 min to reach an A575 = 0.1. Upon reaching an absorbance of 0.1 the cultures were transferred to a shaking 42 °C water bath. Aliquots were sampled every 30 min for 3 h. The average absorbance is shown, with a standard error for each culture time of less than 5% the averaged absorbance value.
Does O-P co-expression temper P-lethality and plasmid loss?
| Plasmid in 594 Host Cells | Cell Viability and (Plasmid Retention per CFU Assayed; %) at CFU Growth Temperature a | |||
|---|---|---|---|---|
| 30 °C | 37 °C | 39 °C | 42 °C | |
| Only | ||||
| [P] | 1.0 (35/35; 100%) | 0.01 (0/35; 0%) | 0.008 (0/35; 0%) | 0.07 (0/35; 0%) |
| 1.0 (35/35; 100%) | 1.0 (35/35; 100%) | 1.0 (35/35; 100%) | 0.98 (35/35; 100%) | |
| Only | ||||
| [O] | 1.0 (30/30; 100%) | 1.0 (30/30; 100%) | 1.0 (30/30; 100%) | 0.61 (29/30; 97%) |
| [O-P] | 1.0 (62/70; 89%) | 0.12 (0/70; 0%) | 0.12 (0/70; 0%) | 0.022 (0/36; 0%) |
| [oop#1-O-P] | 1.0 (120/120; 100%) | 0.20 (98/101; 97%) | 0.005 (115/120; 96%) | 0.002 (0/36; 0%) |
| [oop#2-O-P] | 1.0 (117/120; 98%) | 0.055 (76/154; 49%) | 0.048 (62/120; 52%) | 0.008 (0/36; 0%) |
| [O-36P] | 1.0 (30/30; 100%) | 0.79 (30/30; 100%) | 0.012 (1/30; 3%) | 0.0005 (0/36; 0%) |
| [O-63P] | 1.0 (30/30; 100%) | 0.90 (30/30; 100%) | 0.055 (14/40; 35%) | 0.0023 (0/36; 0%) |
a The 594 cultures with indicated plasmids were grown to stationary phase in LB (10 g Bacto-Tryptone, 10 g Bacto-Yeast Extract, 5 g NaCl per liter) plus 50 µg/mL ampicillin (=LBAmp50) for 48 h at 30 °C, diluted, spread on LB agar (includes the addition of 11 g/liter Bacto-Agar) plates (no ampicillin) that were incubated at 30, 37, 39, or 42 °C for 30 h and the average survivor titer for CFU per mL was determined for each plating temperature. Isolated survivor CFU were stabbed to LB and to LBAmp50 agar plates to estimate the proportion of CFU retaining the AmpR plasmid. We tried to assay all the CFU per plate to avoid colony size discrimination, and minimally 30 CFU. The cell viability results shown in each column entry were determined by dividing the cell titer obtained for each incubation by the cell titer at 30 °C, and each value represents the average of duplicate plasmid isolates for each single experiment, with plating variations of about 10%. The results in parentheses represent the sum of results for all the CFU’s assayed from isolates. These results represent independent determinations by KR to those reported in [25], where it was shown that 594[P] cells lost 100% of their plasmids when grown at 36 °C and higher, indicating that trace levels of P expression (where the CI[Ts] repressor still retains some ability to block pR-promoted transcription below about 38–39 °C) will cure cells of the plasmid.
Oligonucleotide primers employed for DNA sequence analysis and plasmid constructions.
| Name | λ Map Position | Sequence (5′ to 3′) a |
|---|---|---|
| L-37904+18 | 37904–37922 | GCTGCTCTTGTGTTAATGG |
| L-MH29 | 37905–37922 | CGTCCTCAAGCTGCTCTTGTGTTAATGG |
| L20 | 39465–39484 | ACTCCGCGATAAGTGGACCC |
| L-22 | 38517–38534 | TGCTGCTTGCTGTTCTTG |
| L-PG30 | 38530–38547 | TTGGAACTGAGAAGACAG |
| L-PG1 | 38784–38801 | AAATATGCTGCTTGAGGC |
| L-38985p20 | 38985–39005 | GCAGCAAGGCGGCATGTTTGG |
| L-MH32 | 39531–39550 | CACAGATCTATAGCAAACCAAAACTCGACCTGA |
| L-18 | 39980–39996 | TTGCCGGAAGCGAGGCC |
| L-21 | 40360–40377 | CGCAACAGTAACCAGCAT |
| R-PG2 | 40747–40764 | GGTTGCGTTCCTGAATGG |
| L-Bam-O | 38686–38718 | ATATGGATCCATGACAAATACAGCAAAAATACTCAACTTCGGC |
| L-Bam-P | 39582–39606 | ATATGGATCCATGAAAAACATCGCCGCACAGATGG |
| L-Bam-OOP#1 | 38559–38580 | ATATGGATCCTGGCTCGATTGGCGCGACAAGT |
| L-Bam-OOP#2 | 38546–38577 | ATATGGATCCGTTGACGACGACATGGCTCGAT |
| L-Bam-O | 38686–38718 | ATATGGATCCATGACAAATACAGCAAAAATACTCAACTTCGGC |
| L-Bam-P | 39582–39606 | ATATGGATCCATGAAAAACATCGCCGCACAGATGG |
| R-40769m22 | 40747–40769 | GCTGCGGTTGCGTTCCTGAATGG |
| R-MH33 | 40315–40295 | GCGACGTCCCCAGGTAATGAATAATTGC |
| R-17 | 40018–40002 | TAAGACTCCGCATCCGG |
| R-MH25 | 39626–39609 | CTGCTCACGGTCAAAGTT |
| R-39280m21 | 39259–39280 | CTGCGGCGGTCAGGTCTTCTGC |
| R9+1 | 39191–39175 | TGGTCAGAGGATTCGCC |
| R-PG6 | 38569–38552 | CAATCGAGCCATGTCGTC |
| R-1536-19 | pcIpR-()-timm | GAAGACAGTCATAAGTGCGG |
| R-ClaI-P | 40280–40259 | ATATATCGATTATACACTTGCTCCTTTCAGTCCG |
| R-ClaI-O | 39582–39559 | ATATATCGATTATAGATCCACCCCGTAAATCCAGTC |
| R-ClaI-36P | 39687–39662 | ATATATCGATTACCTGCTGTACCTGCGGCTTTTCGTCG |
| R-ClaI-63P | 39768–39746 | ATATATCGATTACTTCGTTCTGGTCACGGTTAGCC |
| R-AscI-O | 39582–39559 | ATATGGCGCGCCGCTGCCGCCTAGATCCACCCCGTAAATCCAGTC |
a The portion of primer sequences shown in smaller font size contain restrictions sites used for cloning into plasmids and are not included within λ map sequence shown.