Literature DB >> 22452820

Comparative analysis of Mycobacterium and related Actinomycetes yields insight into the evolution of Mycobacterium tuberculosis pathogenesis.

Abigail Manson McGuire1, Brian Weiner, Sang Tae Park, Ilan Wapinski, Sahadevan Raman, Gregory Dolganov, Matthew Peterson, Robert Riley, Jeremy Zucker, Thomas Abeel, Jared White, Peter Sisk, Christian Stolte, Mike Koehrsen, Robert T Yamamoto, Milena Iacobelli-Martinez, Matthew J Kidd, Andreia M Maer, Gary K Schoolnik, Aviv Regev, James Galagan.   

Abstract

BACKGROUND: The sequence of the pathogen Mycobacterium tuberculosis (Mtb) strain H37Rv has been available for over a decade, but the biology of the pathogen remains poorly understood. Genome sequences from other Mtb strains and closely related bacteria present an opportunity to apply the power of comparative genomics to understand the evolution of Mtb pathogenesis. We conducted a comparative analysis using 31 genomes from the Tuberculosis Database (TBDB.org), including 8 strains of Mtb and M. bovis, 11 additional Mycobacteria, 4 Corynebacteria, 2 Streptomyces, Rhodococcus jostii RHA1, Nocardia farcinia, Acidothermus cellulolyticus, Rhodobacter sphaeroides, Propionibacterium acnes, and Bifidobacterium longum.
RESULTS: Our results highlight the functional importance of lipid metabolism and its regulation, and reveal variation between the evolutionary profiles of genes implicated in saturated and unsaturated fatty acid metabolism. It also suggests that DNA repair and molybdopterin cofactors are important in pathogenic Mycobacteria. By analyzing sequence conservation and gene expression data, we identify nearly 400 conserved noncoding regions. These include 37 predicted promoter regulatory motifs, of which 14 correspond to previously validated motifs, as well as 50 potential noncoding RNAs, of which we experimentally confirm the expression of four.
CONCLUSIONS: Our analysis of protein evolution highlights gene families that are associated with the adaptation of environmental Mycobacteria to obligate pathogenesis. These families include fatty acid metabolism, DNA repair, and molybdopterin biosynthesis. Our analysis reinforces recent findings suggesting that small noncoding RNAs are more common in Mycobacteria than previously expected. Our data provide a foundation for understanding the genome and biology of Mtb in a comparative context, and are available online and through TBDB.org.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22452820      PMCID: PMC3388012          DOI: 10.1186/1471-2164-13-120

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Tuberculosis is still a major killer worldwide, causing an estimated 2-3 million deaths per year [1]. The sequence of the pathogen Mycobacterium tuberculosis (Mtb) strain H37Rv has been available for a decade [2,3], but the biology of the pathogen remains poorly understood. Available genome sequences from Mtb strains and other closely related Mycobacteria present an opportunity to bring the power of comparative genomics to the study of Mtb. We report here the results of a comparative analysis of 31 publicly available genomes (http://www.tbdb.org, Figure 1, Table 1). These include eight closely related members of the Mtb complex that can cause tuberculosis disease, (two M. bovis strains and six Mtb strains). Another 11 additional Mycobacteria range from obligate parasites to free-living soil bacteria: M. leprae and M. avium subsp. Paratuberculosis K10, the causative agents of leprosy and paratuberculosis respectively, are pathogenic and require hosts to survive; M. ulcerans, M. marinum, M. avium 104, and M. abscessus have the potential to be pathogenic but can survive outside the confines of a host; M. vanbaalenii, M. sp. KMS, M. sp. MCS, and M. gilvum are free-living soil bacteria which are known to degrade a variety of compounds including polycyclic aromatic hydrocarbons (PAH), and are useful in bioremediation efforts. Thus, the Mycobacteria included in our dataset span an ecological range from host-dependent pathogens to soil bacteria, allowing us to study multiple evolutionary transitions.
Figure 1

Phylogenetic Tree based on uniform SYNERGY orthogroups, scaled by phylogenetic distance. The labels A-C indicate the branches selected for further analysis in our dN/dS analysis (A: The branch leading to the Mtb cluster; B: The branch leading to the pathogenic Mycobacteria; C: The branch leading to the non-pathogenic, soil-dwelling Mycobacteria). See Methods for details on the phylogenetic tree construction.

Table 1

Summary of Organisms

OrganismPatho-genicHost requiredDescriptionReference
Mycobacterium tuberculosis H37RvYYCauses TB; Laboratory strain[2]

Mycobacterium tuberculosis H37RaYYCauses TB; Avirulent sister strain to H37Rv[4]

Mycobacterium tuberculosis F11 (ExPEC)YYCauses TB; isolated from TB patient in S. Africa[5]

Mycobacterium bovis BCG str. Pasteur 1173P2YYCauses bovine TB; attenuated vaccine strain[6]

Mycobacterium bovis AF2122/97YYCauses bovine TB[7]

Mycobacterium tuberculosis HaarlemYYCauses TB; MDR strain[5]

Mycobacterium tuberculosis CYYCauses TB; isolated in NY City[5]

Mycobacterium tuberculosis CDC1551YYCauses TB; highly contagious & virulent strain[8]

Mycobacterium ulcerans AGY99YCauses Buruli ulcer[9]

Mycobacterium marinumYFrom fish; Skin lesions in human[10]

Mycobacterium leprae TNYYCauses leprosy[11]

Mycobacterium avium 104YOpportunistic pathogen; can causeTB-type pulmonary infection[12]

Mycobacterium avium subsp. Paratuberculosis K-10YYCauses paratuberculosis; obligate pathogen of cattle[13]

Mycobacterium sp. MCSSoil bacteria; degrades PAH[14]

Mycobacterium sp. KMSSoil bacteria; degrades PAH[14]

Mycobacterium smegmatis MC2155YWidely used model for Mtb isolated from human smegma; causes soft tissue lesions[12]

Mycobacterium vanbaalenii PYR-1Soil bacteria; degrades PAH[14]

Mycobacterium gilvumSoil bacteria; Degrades PAH + wide variety of organic compounds[14]

Mycobacterium abscessusYSkin & soft tissue infections[15]

Rhodococcus jostii RHA1Soil bacteria important for biofuels research and bioremediation; degrades PCB + wide variety of organic compounds[16]

Nocardia farcinica IFM 10152YCauses nocardiosis[17]

Corynebacterium glutamicum ATCC 13032Produces amino acids (Glu)[18]

Corynebacterium efficiens YS-314Produces amino acids (Glu)[19]

Corynebacterium diphtheriae NCTC13129YCauses diphtheria[20]

Corynebacterium jeikeium K411YCauses nocosomial infections[21]

Streptomyces avermitilis MA-4680Soil bacteria;antibiotic-producing[22]

Streptomyces coelicolor A3(2)Soil bacteria;antibiotic producing[23]

Acidothermus cellulolyticus 11BHot springs of Yellowstone[24]

Rhodobacter sphaeroidesGram -, motile; photosyn.; fixes N2[14]

Propionibacterium Acnes KPA171202YCauses acne[25]

Bifidobacterium Longum NCC2705Digestive track commensal; yogurt[26]
Phylogenetic Tree based on uniform SYNERGY orthogroups, scaled by phylogenetic distance. The labels A-C indicate the branches selected for further analysis in our dN/dS analysis (A: The branch leading to the Mtb cluster; B: The branch leading to the pathogenic Mycobacteria; C: The branch leading to the non-pathogenic, soil-dwelling Mycobacteria). See Methods for details on the phylogenetic tree construction. Summary of Organisms To gain further insight into the Mycobacterium cluster, we also included a related Rhodococcus (also involved in bioremediation), a pathogenic Nocardia, four Corynebacteria (two pathogens and two that are commercially useful in amino acid production), two Streptomyces (antibiotic-producing soil bacteria), Acidothermus cellulolyticus (a thermophilic actinobacteria from the hot springs of Yellowstone), Propionibacterium acnes (causative agent of common acne), and Bifidobacterium longum (a digestive track commensal often found in yogurt). We extend this comparative analysis to other more distantly related Actinobacteria to yield additional insight into evolutionary trends. We examined protein evolution across these 31 organisms, both at the nucleotide level and at the level of protein families, including studying gene families associated with the transition from nonpathogenic soil-dwelling bacteria to obligate pathogens. Our results highlight the importance of lipid metabolism and its regulation, and reveal differences in the evolutionary profiles for genes implicated in saturated and unsaturated fatty acid metabolism. Our analysis also suggests that DNA repair and molybdopterin cofactors are expanded in pathogenic Mycobacteria and Mtb. We also identified highly conserved elements within noncoding regions using whole-genome multiple alignments and gene expression data. These conserved elements include 37 predicted conserved promoter regulatory motifs, of which 14 correspond to previously reported motifs. They also include approximately 50 predicted novel noncoding RNAs. Guided by our computational analysis, we tested and experimentally confirmed the expression of 4 novel small RNAs in Mtb. The results of our analyses are available on our website, and provide a foundation for understanding the genome and biology of Mtb in a comparative context.

Results and discussion

An orthogroup catalogue for Mycobacteria

We used SYNERGY [27,28] to reconstruct the phylogeny of proteins across all 31 organisms, define sets of orthologs ("orthogroups"), and construct a phylogenetic tree of the genomes (Figure 1). An orthogroup is defined as the set of genes descended from a single common ancestral gene in the last common ancestor of the species under consideration [28], containing both orthologs and possibly paralogs (Methods). At each node in the phylogenetic tree, we tabulated orthogroup appearances, duplications, and losses (Figure 2). Figure 2 gives an overview of the evolution of gene families within these species. Full listings of the events tabulated in Figure 2, as well as additional information about each orthogroup, can be found on the Supplementary Information website:
Figure 2

Summary of SYNERGY results: Number of gains, losses, and duplication at each node. For each node, the node number is marked in black; the total number of genes present at each node is indicated in red, and the numbers of gains, losses, and duplications are indicated in parenthesis in blue http://www.broadinstitute.org/ftp/pub/seq/msc/pub/SYNERGY/index.html.

Summary of SYNERGY results: Number of gains, losses, and duplication at each node. For each node, the node number is marked in black; the total number of genes present at each node is indicated in red, and the numbers of gains, losses, and duplications are indicated in parenthesis in blue http://www.broadinstitute.org/ftp/pub/seq/msc/pub/SYNERGY/index.html.

Tracing the evolution of biological processes

To examine the evolution of entire pathways and gene families, we categorized orthogroups according to GO (Gene Ontology) and GO Slim terms [29], PFAM domains [30], metabolic pathways, predicted regulons (sets of genes predicted to be regulated by a common regulatory protein), and groups of genes upregulated under certain lipids (Methods). We also looked for orthogroups undergoing positive selection by calculating the ratio of nonsynonymous to synonymous mutations (the dN/dS ratio). Figure 3 shows several examples of pathway or gene family profiles and the predicted evolutionary events associated with the gene family. The sort of graphic presented in Figure 3 is browsable for every pathway, PFAM, and GO term in our Supplementary Information website. Tables 2 and 3 show the PFAM and GO categories most expanded (with the most orthogroup members) in the Mtb clade relative to the non-pathogenic Mycobacteria, and Tables 4 and 5 show those most expanded in the Mycobacteria relative to the non-Mycobacteria.
Figure 3

Evolution of gene categories. This figure shows several examples of the evolution of metabolic pathways, PFAM domains, and GO term descriptors. Graphics similar to these can be found for each category in the supplementary information website at http://www.broadinstitute.org/ftp/pub/seq/msc/pub/SYNERGY/index.html. a) Fatty acid degradation metabolic pathway. b) PFAM group PF00823 (PPE genes). c) PFAM group PF00440 (tetR family transcription factors). d) GO term 0009405 (pathogenesis.)

Table 2

50 PFAM categories most expanded in the Mtb clade relative to the non-pathogenic, soil-dwelling Mycobacteria

PFAM namePFAM IDp-valueainter-to-intra-centroid difference
b PIN domainPF018504.20E-091.10E+01

GHMP kinases C terminalPF085441.00E-088.80E+00

DHHA1 domainPF022722.10E-086.80E+00

KGG Stress-induced bacterial acidophilic repeat motifPF106856.70E-086.20E+00

b Protein of unknown function (DUF1396) (lipoproteins within cell wall)PF071614.10E-079.20E+00

b Rv0623-like transcription factor (toxin-antitoxin-related)PF077049.30E-071.00E+01

Tetratricopeptide repeatPF077209.90E-078.60E+00

PA domainPF022251.00E-066.40E+00

c Patatin-like phospholipasePF017341.20E-069.20E+00

e Protein of unknown function (DUF1490)PF073711.20E-061.00E+01

4 FAD binding domainPF015651.30E-066.40E+00

Fumarate reductase/succinate dehydrog. flavoprotein C-term domainPF029101.50E-065.90E+00

FIST C domainPF104422.00E-061.20E+01

Corticotropin ACTH domainPF009762.30E-066.00E+00

c Beta-ketoacyl synthase, N-terminal domainPF001092.40E-065.00E+00

IlvB leader peptidePF080494.20E-063.50E+00

c Beta-ketoacyl synthase, C-terminal domainPF028014.50E-064.80E+00

c Acyl transferase domainPF006984.60E-065.20E+00

b PPE family (antigenic variability)PF008235.60E-061.00E+01

b Proteins of 100 residues with WXG (esx-related)PF060137.10E-067.90E+00

b Phd YefM (toxin-antitoxin-related)PF026047.70E-069.00E+00

PonericinPF074427.70E-068.70E+00

b Plasmid stabilization system protein (toxin-antitoxin-related)PF050169.90E-069.30E+00

Threonine leader peptidePF082541.10E-058.90E+00

Toxin 33 Waglerin familyPF081212.20E-053.20E+00

Phosphatidylethanolamine-binding proteinPF011612.20E-057.30E+00

b PemK-like protein (toxin-antitoxin-related)PF024523.10E-059.00E+00

Erythronolide synthase dockingPF089905.60E-057.30E+00

d Radical SAM superfamilyPF040555.80E-053.90E+00

d ThiS familyPF025976.60E-055.60E+00

b Pentapeptide repeats (8 copies)PF014691.20E-041.00E+01

RubredoxinPF003011.30E-043.80E+00

d Pterin 4 alpha carbinolamine dehydratasePF013291.50E-048.80E+00

Leucine rich repeat N-terminal domainPF014621.60E-041.00E+01

e Domain of unknown function (DUF1610)PF077542.10E-042.40E+00

SEC-C motifPF028102.30E-043.00E+00

d MoaC familyPF019672.60E-047.10E+00

Berberine and berberine likePF080312.70E-049.30E+00

Cytochrome B6-F complex subunit VI (PetL)PF051152.80E-049.40E+00

Region found in RelA/SpoT proteinsPF046073.00E-045.00E+00

Quinolinate phosphoribosyl transferase, C-terminal domainPF017293.30E-044.20E+00

Fumarate reductase subunit CPF023003.70E-041.00E+01

LHC Antenna complex alpha/beta subunitPF005565.00E-043.20E+00

RNPHF zinc fingerPF080805.10E-046.50E+00

Protein of unknown function (DUF1416)PF072105.20E-049.60E+00

PsbJPF017885.40E-043.70E+00

Bacterial transferase hexapeptide (three repeats)PF001325.50E-043.00E+00

N Chalcone and stilbene synthases, N-terminal domainPF001956.60E-048.40E+00

d MoaE proteinPF023918.00E-047.80E+00

b Protein of unknown function (DUF1066) (esx)PF063598.30E-041.10E+01

a Bonferroni-corrected p-value calculated from T-test

b pathogenicity or survival within the host

c Lipid metabolism

d Pterin cofactor biosynthesis

e unknown function

Table 3

The 50 GO terms most expanded in the Mtb clade relative to the non-pathogenic, soil-dwelling Mycobacteria

GO descriptorGO term IDp-valueainter-to-intra centroid difference
4-hydroxy-3-methylbut-2-en-1-yl diphosphate red. activityGO_00517454.80E-087.20E+00

dTMP biosynthetic processGO_00062317.30E-074.40E+00

response to cAMPGO_00515911.40E-061.20E+01

succinate dehydrogenase (ubiquinone) activityGO_00081771.70E-065.10E+00

iron ion transportGO_00068262.70E-064.70E+00

magnesium ion bindingGO_00002872.80E-061.70E+00

c fatty-acyl-CoA synthase activityGO_00043215.10E-066.50E+00

c acyltransferase activityGO_00084157.60E-063.60E+00

transferase activity, transferring alkyl or aryl (other than methyl) groupsGO_00167651.30E-052.60E+00

c tricarboxylic acid cycleGO_00060991.30E-053.40E+00

d Mo-molybdopterin cofactor biosynthetic processGO_00067771.40E-056.30E+00

integral to membraneGO_00160212.00E-052.00E+00

acid phosphatase activityGO_00039932.50E-053.20E+00

phosphatase activityGO_00167913.20E-054.10E+00

erythronolide synthase activityGO_00478794.20E-058.20E+00

d 4-alpha-hydroxytetrahydrobiopterin dehydratase activityGO_00081246.80E-056.20E+00

c lipid metabolic processGO_00066296.80E-054.70E+00

bacteriochlorophyll biosynthetic processGO_00304947.00E-051.30E+00

plasma membraneGO_00058867.10E-052.70E+00

d tetrahydrobiopterin biosynthetic processGO_00067291.10E-048.80E+00

c lipid biosynthetic processGO_00086101.20E-043.50E+00

phosphatidylcholine metabolic processGO_00464701.60E-049.50E+00

c geranyltranstransferase activityGO_00043371.60E-046.80E+00

cytoplasmGO_00057371.90E-041.40E+00

protein transportGO_00150311.90E-041.70E+00

guanosine tetraphosphate metabolic processGO_00159692.20E-045.00E+00

glyoxylate cycleGO_00060972.20E-044.30E+00

phosphoglycolate phosphatase activityGO_00089672.80E-044.30E+00

terpenoid biosynthetic processGO_00161143.90E-042.80E+00

sulfur metabolic processGO_00067904.10E-045.30E+00

4 iron, 4 sulfur cluster bindingGO_00515395.00E-042.90E+00

succinate dehydrogenase activityGO_00001045.70E-044.60E+00

b mycocerosate synthase activityGO_00501115.80E-044.10E+00

c phospholipid biosynthetic processGO_00086546.10E-042.30E+00

nucleoside metabolic processGO_00091166.30E-043.60E+00

c phosphopantetheine bindingGO_00311778.20E-043.00E+00

adenylate cyclase activityGO_00040168.30E-045.50E+00

D-arabinono-1,4-lactone oxidase activityGO_00038859.70E-048.40E+00

anaerobic respirationGO_00090619.90E-041.10E+01

nodulationGO_00098771.10E-037.10E+00

c prenyltransferase activityGO_00046591.10E-034.20E+00

c lysophospholipase activityGO_00046221.30E-038.50E+00

c acetyl-CoA carboxylase activityGO_00039891.30E-032.40E+00

histidinol-phosphatase activityGO_00044012.10E-036.50E+00

pyridine nucleotide biosynthetic processGO_00193632.30E-035.00E+00

NAD biosynthetic processGO_00094353.30E-031.30E+00

lactate fermentation to propionate and acetateGO_00196523.40E-033.40E+00

alkylglycerone-phosphate synthase activityGO_00086093.40E-037.10E+00

b cyclopropane-fatty-acyl-phospholipid synthase activityGO_00088254.00E-035.90E+00

methylcrotonoyl-CoA carboxylase activityGO_00044854.40E-033.00E+00

aBonferroni-corrected p-value calculated from T-test

b pathogenicity or survival within the host

c Lipid metabolism

d Cofactor biosynthesis

e unknown function

Table 4

The 50 PFAM categories most expanded in the Mycobacteria relative to the non- Mycobacteria

PFAM descriptorPFAM IDp-valueainter-to-intra centroid difference
e Protein of unknown function (DUF2599)PF107831.50E-108.80E+00

c CutinasePF010831.60E-101.50E+01

e Uncharacterized protein conserved in bacteria (DUF2236)PF099952.20E-101.60E+01

c Lpp-LpqN Probable lipoprotein LpqNPF107384.70E-101.30E+01

e Domain of unknown function (DUF385)PF040755.70E-101.30E+01

b Domain of unk function DUF140 (yrbE genes in mce operons)PF024051.60E-091.40E+01

Retinal pigment epithelial membrane proteinPF030558.50E-091.40E+01

e Domain of unknown function (DUF427)PF042481.40E-081.60E+01

ABC transporter transmembrane region 2 PF06472PF064721.80E-081.10E+01

b Peroxidase (katG-isoniazid resistance)PF001414.10E-081.20E+01

b mce related proteinPF024701.30E-071.30E+01

N O-methyltransferase N-terminusPF024091.70E-071.70E+01

Activator of Hsp90 ATPase homolog 1-like proteinPF083272.40E-071.10E+01

Coronavirus nonstructural protein NS1PF061453.00E-071.20E+01

e Predicted integral membrane protein (DUF2189)PF099553.10E-071.40E+01

e Uncharacterized protein family (UPF0089)PF030073.80E-071.50E+01

b Acetyltransf 2 N-acetyltransferase (inactivates isoniazid)PF007973.90E-071.70E+01

e Domain of unknown function (DUF1957)PF092105.50E-077.90E+00

KRAB boxPF013527.00E-071.70E+01

Prokaryotic acetaldehyde dehydrogenase, dimerisationPF092908.10E-079.00E+00

DmpG-like communication domainPF078369.50E-071.10E+01

Nuclear transport factor 2 (NTF2) domainPF021361.00E-061.30E+01

Wyosine base formationPF086081.10E-061.40E+01

AIG2-like familyPF060941.30E-061.80E+01

e Protein of unknown function (DUF867)PF059081.30E-061.50E+01

Phage-related minor tail proteinPF101452.10E-061.20E+01

c Fatty acid desaturasePF034052.30E-061.00E+01

PaaX-like proteinPF078482.80E-061.50E+01

Adenylate and Guanylate cyclase catalytic domainPF002113.70E-061.10E+01

Fibronectin-attachment protein (FAP)PF071743.80E-061.30E+01

Leucine Rich RepeatPF077235.50E-061.10E+01

2-nitropropane dioxygenasePF030605.70E-061.40E+01

c Fatty acid desaturasePF004877.90E-061.30E+01

e Protein of unknown function (DUF732)PF053059.10E-061.50E+01

c Enoyl-CoA hydratase/isomerase familyPF003789.70E-061.10E+01

arg-2/CPA1 leader peptidePF082521.00E-051.40E+01

c alpha/beta hydrolase fold (lipases)PF078591.10E-051.50E+01

Cytochrome P450PF000671.40E-051.20E+01

c Cyclopropane-fatty-acyl-phospholipid synthase PF02353PF023531.60E-051.20E+01

Isoprenylcysteine carboxyl methyltransferase (ICMT) familyPF041401.90E-051.50E+01

Hydratase/decarboxylasePF016892.50E-056.60E+00

PsbJPF017883.00E-059.40E+00

Linocin M18 bacteriocin proteinPF044543.40E-051.60E+01

Extensin-like protein repeatPF020954.00E-051.50E+01

5HT transporter Serotonin (5-HT) neurotransmitter transporter, N-terminusPF034914.00E-059.50E+00

e Protein of unknown function (DUF571)PF046004.20E-057.70E+00

Tryptophyllin-3 skin active peptidePF082484.90E-051.50E+01

AMP-binding enzymePF005018.10E-059.20E+00

e Bacterial protein of unknown function (DUF853)PF058729.90E-051.30E+01

c Acyl-ACP thioesterasePF016431.10E-041.10E+01

aBonferroni-corrected p-value calculated from T-test

b pathogenicity or survival within the host

c Lipid metabolism

d Cofactor biosynthesis

e unknown function

Table 5

The 50 GO terms most expanded in the Mycobacteria relative to the non- Mycobacteria

GO term descriptorGO term IDp-valueainter-to-intra-centroid difference
c sterol biosynthetic processGO:00161261.00E-101.80E+01

b regulation of apoptosisGO:00429811.10E-101.90E+01

c 3alpha,7alpha,12alpha-trihydroxy-5beta- cholest-24-enoyl-CoA hydratase activityGO:00339891.40E-101.70E+01

c linalool 8-monooxygenase activityGO:00500561.50E-101.70E+01

c sterol 14-demethylase activityGO:00083985.10E-091.60E+01

c cutinase activityGO:00505255.80E-091.60E+01

oxidoreductase activity, acting on NADH or NADPH, nitrogenous group as acceptorGO:00166571.80E-081.40E+01

c diacylglycerol O-acyltransferase activityGO:00041442.10E-081.70E+01

ligase activity, forming carbon-carbon bondsGO:00168856.10E-081.40E+01

indolylacetylinositol arabinosyltransferase activityGO:00504097.90E-081.20E+01

c 4-hydroxy-2-oxovalerate aldolase activityGO:00087011.00E-071.10E+01

arylamine N-acetyltransferase activityGO:00040602.80E-071.70E+01

c lipid transportGO:00068695.00E-071.70E+01

c lipid biosynthetic processGO:00086105.00E-078.50E+00

biphenyl-2,3-diol 1,2-dioxygenase activityGO:00185831.40E-069.50E+00

cis-stilbene-oxide hydrolase activityGO:00339611.50E-061.20E+01

c acyl-[acyl-carrier-protein] desaturase activityGO:00453001.70E-061.00E+01

5-carboxymethyl-2-hydroxymuconic-semialdehyde dehydrog activityGO:00184802.00E-061.20E+01

c fatty-acyl-CoA synthase activityGO:00043212.10E-061.20E+01

c steroid biosynthetic processGO:00066942.30E-061.20E+01

c propanoyl-CoA C-acyltransferase activityGO:00338142.50E-061.20E+01

extracellular matrix bindingGO:00508402.70E-061.30E+01

lipid glycosylationGO:00302596.70E-065.60E+00

d coenzyme F420-dependent N5, N10-methenyltetrahydromethanopterinreductase activityGO:00185376.90E-061.20E+01

C-terminal protein amino acid methylationGO:00064811.10E-051.10E+01

metabolic processGO:00081521.30E-054.60E+00

4-oxalocrotonate decarboxylase activityGO:00474371.70E-051.10E+01

oxidoreductase activityGO:00164911.80E-055.20E+00

oxidation reductionGO:00551141.90E-054.80E+00

defense response to bacteriumGO:00427422.40E-051.60E+01

b cyclopropane-fatty-acyl-phospholipid synthase activityGO:00088252.90E-059.80E+00

c 3-hydroxy-2-methylbutyryl-CoA dehyd. activityGO:00470153.40E-051.10E+01

nutrient reservoir activityGO:00457353.40E-059.30E+00

structural constituent of cell wallGO:00051993.60E-057.90E+00

2-nitropropane dioxygenase activityGO:00185804.10E-051.40E+01

adenylate cyclase activityGO:00040166.00E-059.50E+00

b beta-lactam antibiotic catabolic processGO:00306556.70E-051.40E+01

DNA primase activityGO:00038968.40E-051.10E+01

cyclic nucleotide biosynthetic processGO:00091908.50E-059.80E+00

iron ion transportGO:00068268.70E-051.20E+01

di-, tri-valent inorganic cation transmembrane transporter activityGO:00150829.00E-056.80E+00

phosphorus-oxygen lyase activityGO:00168491.60E-049.50E+00

limonene-1,2-epoxide hydrolase activityGO:00187441.60E-047.80E+00

c fatty acid metabolic processGO:00066311.70E-048.40E+00

sirohydrochlorin cobaltochelatase activityGO:00168521.80E-041.50E+01

intracellular signaling cascadeGO:00072422.00E-048.80E+00

c enoyl-CoA hydratase activityGO:00043002.30E-041.30E+01

di-, tri-valent inorganic cation transportGO:00156742.40E-046.20E+00

c acyl-CoA dehydrogenase activityGO:00039952.60E-049.10E+00

catechol O-methyltransferase activityGO:00162063.20E-041.50E+01

aBonferroni-corrected p-value calculated from T-test

b pathogenicity or survival within the host

c Lipid metabolism

d Cofactor biosynthesis

e unknown function

Evolution of gene categories. This figure shows several examples of the evolution of metabolic pathways, PFAM domains, and GO term descriptors. Graphics similar to these can be found for each category in the supplementary information website at http://www.broadinstitute.org/ftp/pub/seq/msc/pub/SYNERGY/index.html. a) Fatty acid degradation metabolic pathway. b) PFAM group PF00823 (PPE genes). c) PFAM group PF00440 (tetR family transcription factors). d) GO term 0009405 (pathogenesis.) 50 PFAM categories most expanded in the Mtb clade relative to the non-pathogenic, soil-dwelling Mycobacteria a Bonferroni-corrected p-value calculated from T-test b pathogenicity or survival within the host c Lipid metabolism d Pterin cofactor biosynthesis e unknown function The 50 GO terms most expanded in the Mtb clade relative to the non-pathogenic, soil-dwelling Mycobacteria aBonferroni-corrected p-value calculated from T-test b pathogenicity or survival within the host c Lipid metabolism d Cofactor biosynthesis e unknown function The 50 PFAM categories most expanded in the Mycobacteria relative to the non- Mycobacteria aBonferroni-corrected p-value calculated from T-test b pathogenicity or survival within the host c Lipid metabolism d Cofactor biosynthesis e unknown function The 50 GO terms most expanded in the Mycobacteria relative to the non- Mycobacteria aBonferroni-corrected p-value calculated from T-test b pathogenicity or survival within the host c Lipid metabolism d Cofactor biosynthesis e unknown function

Substantial expansion of known pathogenicity and lipid metabolism genes

Despite the smaller genome sizes present in the pathogenic Mycobacteria, and the resulting background of orthogroup loss in the evolution towards pathogens, we observe significant expansions in certain gene families in the pathogenic Mycobacteria and the Mtb complex relative to non-pathogenic relatives. We also observe evidence for selection in certain families on branches leading to the pathogenic Mycobacteria, the Mtb complex, and the soil-dwelling Mycobacteria. As expected, many genes known to be related to pathogenicity or antigenic variability are among the groups most expanded in the Mtb clade relative to soil dwelling Mycobacteria as well as being among the categories with the most variability in copy number in their category-level profiles overall, including toxin-antitoxin genes, genes containing PE (Pro-Glu) and PPE (Pro-Pro-Glu) domains, MCE (Mammalian Cell Entry) genes, genes involved in the synthesis of the mycolic acid coat, Esx genes, and gene involved in antibiotic resistance. Complete results for all groupings are available on our Supplementary Information website. Below we focus on specific additional families showing noteworthy expansions and trends. The single most significant trend in our analysis of protein family evolution is that genes related to lipid metabolism are greatly expanded across all Mycobacteria and related organisms, consistent with previous observations [2,31] (Table 5). Our analysis extends these previous observations by identifying the emergence of this expansion in lipid metabolism genes as occurring at the root node of the Mycobacteria and Rhodococcus (Figure 3).

Particular expansion of saturated fatty acid metabolism and lipid synthesis genes in pathogenic Mycobacteria

Genes predicted to be involved in the metabolism of saturated fatty acids are more expanded than those involved in the metabolism of unsaturated fatty acids. Using a compendium of microarray expression experiments (Methods), we compiled a list of genes upregulated in the presence of different fatty acid sources. We found that genes upregulated under unsaturated conditions have more uniform phylogenetic profiles, while those upregulated under saturated conditions, cholesterol or ceramide have expanded through duplications in pathogenic Mycobacteria (Figure 4). Saturated fatty acids and cholesterol are more prevalent in an animal host than in the soil, which contains mostly unsaturated fatty acid from plant inputs. Since it is believed that Mtb uses cholesterol as a carbon source within the host [32], this could reflect an adaptation to the host environment. Consistent with our observations in host-adapted Mycobacteria, Desulfovibrio desulfuricans intestinal strains contain a higher ratio of saturated to unsaturated fatty acids than soil strains of Desulfovibrio desulfuricans [33].
Figure 4

Evolution of genes upregulated when grown on saturated or unsaturated fatty acids. Genes upregulated by at least 1.5 standard deviations are indicated here. a) Genes expressed under palmitic acid but not oleic or linoleic (genes expressed in saturated fatty acid conditions). b) Genes expressed under linoleic or oleic acid but not palmitic (genes expressed under unsaturated fatty acid conditions). c) The ratio of the phylogenetic profiles for genes expressed under palmitic and linoleic acid, normalized by genome size.

Evolution of genes upregulated when grown on saturated or unsaturated fatty acids. Genes upregulated by at least 1.5 standard deviations are indicated here. a) Genes expressed under palmitic acid but not oleic or linoleic (genes expressed in saturated fatty acid conditions). b) Genes expressed under linoleic or oleic acid but not palmitic (genes expressed under unsaturated fatty acid conditions). c) The ratio of the phylogenetic profiles for genes expressed under palmitic and linoleic acid, normalized by genome size. Our analysis also reveals differences in evolutionary profiles between genes predicted to be involved in catabolism and anabolism of lipids. Both sets of genes are expanded in soil-dwelling and pathogenic Mycobacteria, but lipid synthesis genes are additionally expanded in pathogens relative to soil dwellers. General lipid synthesis genes are expanded across the Mycobacteria, but certain groups of lipid synthesis genes, including those related to cell wall synthesis, are further expanded in the Mtb complex (see Supplementary Information). In pathogenic Mycobacteria, the waxy mycolic acid coat helps evade the host immune system [34]. Consistent with this, we see categories related to mycolic acid synthesis showing up among the most non-uniform categories, highly expanded in the Mtb complex (see Supplementary Information). In contrast, some lipid degradation gene families are more expanded in the soil-dwelling Mycobacteria than in the pathogens (Supplementary Data). The soil-dwellers have the unusual ability to degrade a vast array of compounds, including diverse lipids.

Positive selection of lipid metabolism genes

In addition to gene family expansions, we observe evidence for selection on the coding sequence of lipid metabolism genes. In our dN/dS calculations, we observe enrichment for positive selection in lipid degradation genes on the branch leading to the pathogenic Mycobacteria (Additional file 1: Table S2). For example, Rv2524c, the multifunctional FAS-I polypeptide utilized during de novo fatty synthesis [35], has the second highest dN/dS value on this branch. Additional lipid metabolism genes with elevated dN/dS values include 15 genes predicted to be involved in the β-oxidation pathway of fatty acid degradation: seven fadE (acyl coA dehydrogenase) genes, three fadD (fatty acid CoA ligase) genes, two fadB (NADPH quinone oxidoreductase/3-hydroxybutyryl-CoA dehydrogenase) genes, one fadA (acetyl-CoA acyltransferase) gene, and two echA (enoyl-CoA hydratase) genes. Hence, we observe expansions of lipid biosynthesis genes, as well as observing evidence for positive selection acting on genes within the β-oxidation pathway. Both the lipid biosynthesis and lipid degradation pathways are specialized within the pathogenic Mycobacteria. This expansion could possibly benefit the pathogen in a manner to accommodate production and modification of cell wall lipids involved in manipulation of host immune response. The lipid degradation is particularly beneficial for the long term survival of the pathogen metabolizing host lipids encountered during infection.

Coordinated evolution of lipid metabolism genes and the regulator KstR

KstR is a transcription factor known to be involved in lipid and cholesterol degradation [36,37]. It has been recently shown that Mtb uses cholesterol as a carbon source within the host [32]. Strikingly, KstR exhibits an evolutionary history that parallels the expansion of lipid metabolism genes in the Mycobacteria, and displays a singular conservation in its regulatory binding sites. KstR appears to have evolved at the last common ancestor of the Mycobacteria and Rhodococcus. In all Mycobacteria analyzed (except M. leprae), Rhodococcus, and Nocardia there is one highly conserved ortholog of the KstR gene. However, in organisms more distantly related to Mtb, the KstR gene is not present in a single copy. Rather, 2-3 paralogs of KstR are present in these more distantly related organisms, as well as the environmental Mycobacteria, including M. ulcerans, M. avium 104, M. sp. MCS, M. sp. KMS, and M. vanbaalenii (Additional file 2: Figure S1). Remarkably, these paralogs of KstR are all absent in the pathogenic Mycobacteria. Thus, coincident with the expansion in lipid metabolism genes described above, the KstR gene appears to have emerged through gene duplication within the existing gene family of tetR-like transcriptional regulators at the last common ancestor of Mycobacteria and Rhodococcus. All other members of this gene family were subsequently lost in the Mtb complex, while the KstR protein was maintained and underwent limited sequence divergence. There is another homolog to KstR found in Mtb H37Rv (Rv3557c) that has previously been reported to also be involved in cholesterol metabolism, named KstR2 [38]. However, KstR is much more similar to the other members of the Mycobacterial tetR family discussed above than it is to KstR2. KstR2 is categorized into a separate orthogroup (orthogroup 32655) and is more distantly related to KstR. The high sequence conservation of the KstR transcription factor is mirrored in the conservation of KstR binding sites across numerous promoters. KstR binding sites are known to be highly conserved across the Mycobacteria, out to Rhodococcus and Nocardia [36]. These sites are conserved in both sequence and position within their respective promoters. In our analysis, both in searches using known transcription factor binding motifs, as well as in our de novo motif searches, a subset of KstR binding sites are the most conserved transcription factor motifs observed. They are also among the most conserved of any noncoding sequence we identified. The conservation of the KstR gene and binding sites, the emergence of KstR at the ancestor of Rhodococcus and the Mycobacteria, and the loss of KstR paralogs within the pathogenic Mycobacteria, suggests that this transcription factor and its evolving regulon have played an important role in the expansion of lipid metabolism and its adaptation to pathogenicity in Mtb.

Positive selection of DNA repair genes

Mtb, as well as non-tuberculous Mycobacteria, differ from other bacteria in several key respects of DNA repair [39-42]. Within the host, Mtb must combat damage to its DNA from macrophage-generated reactive oxygen and nitrogen intermediates. The mechanisms by which this is accomplished are not fully understood [43,44]. Although genes implicated in DNA repair have not expanded in the Mtb lineage, we note that the set of genes showing positive selection on the Mtb lineage in our dN/dS analysis is enriched for genes involved in the COG category for DNA replication, recombination, and repair (Additional file 1: Table S2). Several of the genes in this set with highest dN/dS values are known DNA repair genes (including recA, recB, and dnaE2), and several additional genes are helicases (dnaB, helZ, and gyrB). Interestingly, we observe that recA has the highest dN/dS score of all the genes in Mtb on the branch leading to the Mtb complex, and recB also has a very high score. Mycobacteria lack a mutSL-based mismatch repair (MMR) system [42], and it is believed that recA may be involved in compensating pathways. dnaE2 (DNA polymerase III) also has one of the highest dN/dS values on the branch leading to Mtb, and both dnaE1 (DNA polymerase III) and dnaE2 show evidence of selection on the branch leading to the pathogenic Mycobacteria. In Mtb, damage-induced base-substitution mutagenesis is dependent on dnaE2. Loss of dnaE2 activity renders Mtb hypersensitive to DNA damage, eliminates induced mutagenesis, attenuates virulence, and reduces the frequency of drug resistance in vivo [39,45]. dnaE1 provides essential, high-fidelity replicative polymerase function [39], and is expressed in response to DNA damage, along with dnaE2 and recA [39,45]. We also observe positive selection for dinX (DNA polymerase IV) on the branch leading to the pathogenic Mycobacteria (branch-site model) in our dN/dS analysis (see Supplementary Information website). Most organisms use specialized DNA polymerases that are able to catalyze translesion synthesis (TLS) across sites of damage, including the dinB group of Y family polymerases. There are two dinB-family polymerases in Mtb (dinX and dinP). Unlike in other bacteria, dinX and dinP expression are not dependent on recA, the SOS response, or the presence of DNA damage, and could therefore serve a novel yet uncharacterized role in Mtb [46-49].

Expansion of pterin cofactors

Genes involved in the first steps of pterin cofactor (a component of the molybdenum cofactor) biosynthesis are known to be expanded in the Mtb complex [50]. Molybdenum cofactor-requiring enzymes (such as xanthine oxidase and aldehyde oxidase) could have physiological functions in the metabolism of reactive oxygen species during stress response [51]. Molybdenum cofactor is an efficient catalyst in oxygen-transfer reactions, can be used in anaerobic respiration, and can catalyze redox reactions in carbon, nitrogen, and sulfur metabolism. Recently, genes related to molybdenum cofactor protein synthesis have been shown to be upregulated under conditions of stress in Mtb [52]. Molybdenum cofactor biosynthesis has been previously linked to pathogenesis. The regulator of the moa1 locus, MoaR1, was identified as having a SNP in M. bovis BCG, but not in virulent M. bovis or Mtb [53]. In addition, moa3 is present with varying frequency in the RD1 region, which is absent in M. bovis BCG, of pathogenic strains [54]. In agreement with previous observations of expansions of molybdopterin biosynthesis genes, we observe five protein domains related to pterin cofactor biosynthesis among the top protein domains expanded in the Mtb complex compared to the non-pathogenic Mycobacteria (Table 2, -"d"). Among the top GO terms expanded in the Mtb clade relative to the soil dwellers (Table 3), there are also several groups involved in pterin and molybdopterin biosynthesis. Some of these gene copies (the moa1 locus) are believed to have been acquired by lateral gene transfer on the branch leading to the Mtb complex [10,50]. We also observe evidence for selection on molybdenum-related genes in our dN/dS data. On the branch leading to the pathogenic Mycobacteria, several orthogroups with high log likelihood scores when testing for selection are related to molybdenum (see Supplementary Information website). The orthogroup containing BisC (biotin sulfoxide reductase, a molybdoenzyme), as well as the orthogroup containing ModA (an ABC-family molybdate transporter), are among those with the highest dN/dS values on the branch leading to the pathogens. MoaB2 is one of the highest-scoring genes on all three branches tested.

Expansions of genes of unknown function in Mtb clade

There are also many categories of unknown function that are greatly expanded in the Mtb clade relative to the non-pathogenic Mycobacteria (Tables 2 and 3, red). For example, Rv0918 (in the Pfam group of unknown function PF08681) was found in a genetic screen that facilitates isolation of mutants defective in arresting the maturation of phagosomes [55], helping Mtb to survive within host cells. PF07161 contains four lipoproteins (LprF, LprG, LprA, LppX). LprG and LppX were found to be in vivo essential genes by TraSH analysis [56].

Detection of conserved noncoding sequences

Sequence conservation - or phylogenetic footprinting - provides a powerful approach for identifying potential functional noncoding sequences, and has been used in a variety of eukaryotic and prokaryotic organisms to identify protein coding genes, noncoding RNAs, and regulatory elements [57,58]. For optimal power, the organisms being analyzed must be sufficiently distant such that non-functional elements have diverged, but not so distant such that functional elements have evolved or re-arranged. Organisms within the Mtb complex are all highly similar at the sequence level, and thus by themselves do not allow for effective phylogenetic footprinting. By leveraging the evolutionary similarity of the most distantly related Mycobacteria and Actinomycetes, we gained additional power to allow us to detect functional sequences under purifying selection, albeit only those shared by at least a majority of Mycobacteria. We used this approach to predict two classes of conserved noncoding sequences: small noncoding RNAs and transcription factor binding motifs.

Novel putative conserved small noncoding RNAs in Mycobacteria

Small noncoding RNAs (sRNAs) have been shown to play a role in regulating gene expression in numerous bacterial species [59], including Streptococcus [60,61]. Yet only recently were sRNAs reported in Mycobacteria [60,62]. Using a combination of direct isolation of small RNAs, and validation by Northern blotting and 5' and 3' RACE transcript mapping, Arnvig and Young [62] first described nine sRNAs in Mtb. Subsequently, DiChiara et al. [63] describe 34 small RNAs in M. bovis BCG, of which many were conserved in both Mtb and M. smegmatis. To build on these results, we used a combination of comparative genomics, RNA-seq, and experimental validation by Northern blotting to identify additional sRNAs conserved among the Mycobacteria (Methods). Our computational results provide evidence for 50 conserved small RNAs in Mtb that have not been previously reported. It is likely that additional conserved regions are expressed under other diverse conditions. Figure 5a shows the expression and conservation map for one of our predicted RNAs in the GenomeView Browser [64]. Table 6 shows a listing of the top 12 candidate RNAs. To verify a subset of these candidate small RNAs, we used Northern blot analysis on four of the top predicted regions (Methods). The results (Figure 5b) show signals corresponding to small RNAs from each of four candidates (Table 6, labeled 1, 2, 3, and 9). All transcripts were near the expected size, or slightly larger. Full-length gels are provided in Additional file 3: Figure S2. Consistent with previous work, the majority of small RNAs were seen as more than one size transcript [62]. This suggests that small RNAs might be generated by processing of larger transcripts. In the RNA-seq data, there are longer "tails" extending outside of the main peak that corresponds to the RNA prediction--different length RNAs could be responsible for the additional bands of higher mass.
Figure 5

New predicted RNAs. a) An example of a new predicted RNA. This is the RNA2 in Table 6. This figure shows a screenshot from the GenomeView Browser [64]. The light blue bars show the coding regions (Rv1230c and Rv1231); the tan bar shows the conserved region predicted by Gumby [65]; and the green bar shows the region predicted to fold by Evofold [66]. The yellow and green plots in the center show the RNA-seq data. Green signifies reads from the negative strand, and yellow shows the total reads (positive and negative strands). The multiple alignment is shown on the bottom (darker grey signifies a higher degree of conservation; red signifies no alignment at that position). You can see that this predicted RNA region is conserved through M. avium. The rulers at the top show the gene structure. Small red squares show where stop codons are present all six reading frames, indicating that this intergenic region is unlikely to be a protein-coding region missed in the annotation. b) Northern blots validating four of the new, predicted small RNAs (RNA1, RNA2, RNA3, and RNA9 in Table 6).

Table 6

Top 12 predicted RNAs, ranked by their RPKM score

Conserved region in Mtb H37Rv1Region in M. Smegmatis3
idstartOrient-ation5length# readsRPKMEvo-fold?2Genes flanking the intergenic regionStartStop# readsRPKM

RNA141612987--+58101369526YRv1435c (secreted protein)Rv1436 (GAPDH)756567756626100626

RNA241374224---4656730071YRv1230c (membrane prot.)Rv1231c (membrane prot.)---

RNA341393055---851119251YRv1248c (sucA)Rv1249c (membrane prot.)51471105147242173489

RNA4483829-++49552139YRv0403c (membrane prot. mmpS1)Rv0404 (fadD30)---

RNA51200514-++93812055YRv1075c (exported protein)Rv1076 (lipase lipU)536340053634741050

RNA6987053-++921746767YRv0887c (cons. Hypo. prot)Rv0888 (hyp. Exported prot.)---

RNA71810184+++445179280YRv1610 (cons. membrane protein)Rv1611 (trpC)329699632970342912804

RNA83587635-++56836917NRv3210c (cons. hypo. prot.)Rv3211 (rhlE)20095752009665625

RNA944224925--+4150224405NRv3778c (aminotransf.)Rv3779 (membrane prot.)6420618642067436237

RNA10659351+++39581829YRv0567 (methyltransferase)Rv0568 (cyp135B1)---

RNA111794708-++4837518231YRv1593c (cons. hypo. prot)Rv1594 (nadA)3277552327759970548

RNA122447526---743329684YRv2185c (cons. hypo. prot)Rv2186c (cons. hypo. prot)43350864335137111802

1Conserved intergenic regions determined by Gumby.

2Indicates whether this region is predicted to fold by Evofold.

3Region in M. smegmatis that aligns with the conserved region in Mtb, and its corresponding RPKM value.

4Tested experimentally

5Orientation relative to neighboring genes. The first and last characters give the strands of the flanking genes; the middle character gives the strand for the predicted RNA.

New predicted RNAs. a) An example of a new predicted RNA. This is the RNA2 in Table 6. This figure shows a screenshot from the GenomeView Browser [64]. The light blue bars show the coding regions (Rv1230c and Rv1231); the tan bar shows the conserved region predicted by Gumby [65]; and the green bar shows the region predicted to fold by Evofold [66]. The yellow and green plots in the center show the RNA-seq data. Green signifies reads from the negative strand, and yellow shows the total reads (positive and negative strands). The multiple alignment is shown on the bottom (darker grey signifies a higher degree of conservation; red signifies no alignment at that position). You can see that this predicted RNA region is conserved through M. avium. The rulers at the top show the gene structure. Small red squares show where stop codons are present all six reading frames, indicating that this intergenic region is unlikely to be a protein-coding region missed in the annotation. b) Northern blots validating four of the new, predicted small RNAs (RNA1, RNA2, RNA3, and RNA9 in Table 6). Top 12 predicted RNAs, ranked by their RPKM score 1Conserved intergenic regions determined by Gumby. 2Indicates whether this region is predicted to fold by Evofold. 3Region in M. smegmatis that aligns with the conserved region in Mtb, and its corresponding RPKM value. 4Tested experimentally 5Orientation relative to neighboring genes. The first and last characters give the strands of the flanking genes; the middle character gives the strand for the predicted RNA.

Conserved cis-regulatory motifs in Mycobacteria

Few transcription factor binding motifs have been identified in Mtb. Transcription factors for which binding motifs have been identified include KstR [36], DosR [67], IdeR [68], ZurB [69], Crp [70], CsoR [71], FurA [72], MprAB [73], and Acr [74]. Because of the limited knowledge of transcriptional regulation in Mtb, we searched for additional motifs computationally. We combined comparative sequence analysis with microarray data to identify a large number of motifs conserved in Mycobacteria. We clustered microarray data contained in the TB database [75] and searched for upstream regulatory motifs shared in the upstream regions of the resulting clusters using AlignACE (Methods). Because of significant noise in the results, we used a set of stringent filters, including a requirement that candidate motifs be highly conserved. 37 motif instances passed our stringent filters (Table 7, Methods). 14 of the top 37 (38%) motif instances correspond to cases of known Mtb motifs (several known Mtb motifs were found more than once, in different clusters, or in clusters with different size parameters). In contrast, none of the top motifs showed similarity only to known E. coli or Corynebacteria motifs. Within these top motifs, we were able to identify four of the nine known Mtb motifs (DosR, IdeR, KstR, and ZurB).
Table 7

Motifs passing our set of stringent filters, ranked by their degree of conservation

kaCluster #MotifMAP scorebSpecificitycKnowndPalind-romicityeConser-vationfMotif Logog
10071165.61.8E-29KstR0.9346

250179188.64.8E-26KstR0.7143

5035187.41.8E-19KstR0.7940

200182194.25.7E-28KstR0.8036

10073231.31.5E-32IdeR0.8530

100491516.32.8E-18KstR0.7129

250112125.52.1E-25DosR0.7621

10080115.02.2E-140.9221

5029115.02.2E-140.9221X

50233121.76.7E-240.7118

20047647.21.2E-150.7516

25087122.11.5E-13ZurB0.9416

2006116.32.0E-12IdeR0.7016

2001841912.14.7E-130.7516

2501231814.53.7E-110.8216

250224126.96.2E-24DosR0.7315

20046319.81.6E-120.7815

10052512.43.8E-150.7114

2001206215.32.0E-140.7414

20071916.62.3E-160.7514

200195125.47.2E-26DosR0.7614

5048168.86.4E-35DosR0.8613

10074166.93.6E-34DosR0.8813

50231226.85.0E-220.7313

25089146.6364.0E-200.7512

10081846.42.3E-160.7112

2509265.73.7E-17DosR0.7312

10052919.71.5E-180.7611

20091147.14.7E-200.7010

50364334.84.6E-300.7210

10042415.32.8E-170.7010

2008098.54.0E-130.7210

5043715.78.7E-120.7210

50362148.55.3E-120.7110

20026177.52.1E-120.709

506616.31.2E-110.739

50114313.71.4E-110.7214

ak indicates the value of k in the k-means clustering process (50, 100, 200, or 250)

bMAP score indicates the AlignACE MAP score [76]

cSpecificity score [77]

dCompareACE score ≥ 0.7 to the alignment for this known motif

eCompareACE score to its reverse complement

fnumber of ScanACE hits in the genome that are conserved in ≥ 8 genomes

gsequence logo [78]

Motifs passing our set of stringent filters, ranked by their degree of conservation ak indicates the value of k in the k-means clustering process (50, 100, 200, or 250) bMAP score indicates the AlignACE MAP score [76] cSpecificity score [77] dCompareACE score ≥ 0.7 to the alignment for this known motif eCompareACE score to its reverse complement fnumber of ScanACE hits in the genome that are conserved in ≥ 8 genomes gsequence logo [78] As described above, the KstR motif shows a much stronger signal, in terms of both conservation and information content, than any of the other motifs (top of the ranked conservation list, Table 7). Based on the distribution of highly conserved predicted motif instances for KstR across the genome, we predict a more general role for KstR in lipid metabolism. We see KstR motif instances near many other lipid genes not related to cholesterol degradation, in support of the view that KstR is a more general lipid regulator controlling a large regulon [36]. One of the most interesting new motif candidates that shows up in our analysis is a conserved palindromic motif, consisting of a highly conserved TAC... GTA separated by 6 bp of less well conserved sequence (marked with an X in Table 7) that is found in clusters of 2-3 closely spaced sites upstream of several genes related to fatty acid metabolism (Figure 6). There is a cluster of 3 evenly spaced sites upstream of Rv3229c (linoeyl-coA desaturase), a cluster of 2 sites upstream of the adjacent Rv3230c (oxidoreductase), and a cluster of 3 sites upstream of Rv2524c (fatty acid synthase). This is the second highest-scoring new motif identified (Table 7). This motif shows up as one of the top motifs associated with the clusters of genes upregulated under saturated fatty acid conditions (specifically palmitate).
Figure 6

New predicted motif with binding sites upstream of fatty acid-related genes. a) Motif logo. b) Conserved binding site locations for this new motif are marked with red x's. Red lines indicate orthologous relationships between genes in Mtb H37Rv, M. avium 104, and M. smegmatis.

New predicted motif with binding sites upstream of fatty acid-related genes. a) Motif logo. b) Conserved binding site locations for this new motif are marked with red x's. Red lines indicate orthologous relationships between genes in Mtb H37Rv, M. avium 104, and M. smegmatis.

Conclusion

To better understand Mtb, we performed a comparative analysis of 31 organisms from the Tuberculosis Database. We studied the evolution of protein families and metabolic pathways, looked for proteins with evidence of selection, and searched for new noncoding RNAs and transcription factor binding site motifs. The most striking features of our analysis are related to lipid metabolism and its regulation. In addition to observing a general expansion of lipid metabolism genes in the Mycobacteria and Rhodococcus, we observe increased expansions of genes related to saturated fatty acid metabolism in the pathogenic Mycobacteria compared to the soil-dwelling Mycobacteria. We also note differences in evolutionary profiles for catabolic and anabolic lipid metabolism genes, and evidence for positive selection in lipid metabolism genes. The cis-regulatory elements bound by the KstR protein, a known regulator of lipid/cholesterol metabolism, are among the strongest, most highly conserved noncoding signals across the Mycobacteria. Both KstR and its binding sites are highly conserved, appearing at the last common ancestor between Rhodococcus and the Mycobacteria. Within our set of organisms, we examine the evolution of pathogenicity, moving from the soil-dwelling Mycobacteria up to the intracellular parasites of the Mtb complex. We see expansions of many known gene families related to pathogenicity (PE/PPE genes, antibiotic resistance genes, genes involved in the synthesis of the mycolic acid coat, MCE genes, and Esx genes). By similarity of phylogenetic profiles, we can predict likely candidates for novel gene families related to pathogenicity. For example, we see similar expansions in gene families related to biosynthesis of molybdopterin. We further observe evidence of positive selection on molybdenum-related genes, providing further support for the importance of molybdenum in these pathogens. On the branch leading to the pathogenic Mycobacteria, we also observe evidence for positive selection in genes related to replication, recombination, and repair. It is possible that these DNA repair-related processes give the pathogenic Mycobacteria an advantage when dealing with the assault on its DNA by macrophage-generated reactive oxygen and nitrogen intermediates. Our whole-genome alignments, coupled with RNA-seq and microarray data, allowed us to predict novel noncoding features, including small RNAs (four of which we have validated experimentally), and potential transcription factor binding sites. The main forces driving genome evolution in prokaryotes include gene genesis, lateral gene transfer, and gene loss. Our analysis of protein evolution using SYNERGY does not examine whether orthogroups appearing have arisen by lateral gene transfer or by gene genesis involving duplication and divergence from other orthogroups. A detailed comparison to categorize these orthogroup appearances according to lateral or vertical gene transfer is beyond the scope of this study, but other studies indicate that lateral gene transfer has played a significant role in Mycobacterial evolution and the evolution of pathogenesis [79-83]. A recent paper suggests that the Mycobacterial genome has been shaped by a biphasic process involving gene acquisition (including lateral gene transfer) and duplications followed by gene loss [79]. Other studies report numerous genes, including a large number involved in lipid metabolism, that have been acquired by horizontal gene transfer at different phylogenetic strata and have led to the emergence of pathogenesis in Mtb [80,81]. Previous studies indicate a possible more ancient lateral gene transfer of fatty acid biosynthesis genes from α-proteobacteria to actinobacteria [84]. However, genetic studies show that the Mtb complex and pathogenic Mycobacteria do not exchange genetic material frequently [85,86], so there is limited lateral gene transfer within the Mtb complex. We are currently performing high-throughput Chromatin Immunoprecipitation (ChIP)-Seq experiments in several different Mycobacteria, including Mtb, M. smegmatis, and M. vanbaalenii[87]. We plan to integrate the information obtained from our comparative analysis with data coming from these high-throughput experiments, as well as other 'omic datasets, using a systems biology approach. This will enable construction of gene regulatory networks for Mtb, and examination of their evolution across species.

Methods

Genome sequences

The 31 organisms used in our analysis are described in Table 1. These genome sequences are all contained in the TB database (TBDB) [75]. The three unpublished sequences generated at the Broad Institute (M. tuberculosis F11, M. tuberculosis Haarlem, and M. tuberculosis C) are high-quality genome sequences. M. tuberculosis F11 and M. tuberculosis Haarlem are finished, and M. tuberculosis C has 6.7× coverage and 4 scaffolds. The Broad Institute sequencing read pipeline interacts with the sample management system to ensure the read is associated with the correct sample. Vector identification, length checks and quality clipping were performed on all reads. Contamination checks and organism checks were also performed using a kmer-based algorithm that can compare sequence to a profile from any organism.

Defining protein families and constructing phylogenetic trees

The SYNERGY algorithm [27,28] was applied to the 31 genomes in Table 1. SYNERGY organizes groups of genes across organisms into orthogroups, or groups of orthologs and paralogs, which consist of all the genes descended from a single ancestral gene in the species' last common ancestor. SYNERGY also associates orthogroups with a gene tree, from which we can derive an "extended phylogenetic profile", showing the gene copy number in each extant organism and at each ancestral node. Importantly, by reconciling an organism tree with each gene tree, SYNERGY provides an evolutionary scenario for each gene tree predicting where all losses, gains, and duplications occurred in its evolution. These lists of losses, gains, and duplications contain actual evolutionary events, as well as artifacts caused by genes that could not be properly categorized by SYNERGY. However, we observe that SYNERGY is effective at properly categorizing genes into orthogroups, and the SYNERGY orthogroups were very useful in our analysis. Analysis of the 31 genomes resulted in a total of 32,505 orthogroups, including those containing single genes from only a single genome (below). There were 177 "uniform" (1:1:1:1...) orthogroups representative of some of the most conserved and indispensible housekeeping genes. Additional file 4: Figure S3 summarizes the SYNERGY orthogroups. We started running SYNERGY using an initial phylogenetic tree generated using orthologs based on bidirectional best BLAST hits. The list of uniform orthogroups from the first SYNERGY run was used to construct a refined phylogenetic tree. SYNERGY was then re-run using the refined phylogenetic trees. To generate our final phylogenetic tree, the final set of 177 31-way orthologs (31-way uniform orthogroups from the SYNERGY analysis) were aligned according to their nucleotide sequences with CLUSTALW [88] and concatenated, distances were computed with Phylip's DNADIST algorithm [89], and Phylip's FITCH algorithm was used to create the tree. Because of the similarity of the genomes within the Mtb complex, we were not able to resolve the phylogeny using only these 177 proteins that are uniform across all 31 organisms. In order to better resolve the tree within the Mtb cluster, we computed a separate tree using 1747 orthogroups that are uniform across the Mtb cluster and M. ulcerans, which we used as an outgroup. Using this expanded gene set, we were able to resolve the tree for the Mtb cluster. Bootstrap analysis was performed to validate tree topologies. Phylip's SEQBOOT was used to create 1000 bootstrap input replicates for each tree. Phylip's CONSENSE was used to obtain a bootstrap tree (Additional file 5: Figure S4)

Metabolic pathways and functional groups

EFICAZ [90] was used to assign EC numbers for proteins in all 31 organisms. Metabolic pathways were constructed in Biocyc [91,92]. An orthogroup was considered to be part of a metabolic pathway if any of its component genes had been identified as part of that pathway using this pipeline. We obtained the Gene Ontology (GO) [29] and GO Slim terms for each of the 31 organisms using BLAST2GO [93]. PFAM assignments [30] were taken from http://www.tbdb.org[75]. An orthogroup was associated with a GO, GO Slim, or PFAM descriptor if greater than half of its protein members were associated with that descriptor. For each node in the phylogenetic tree, we tabulated orthogroups lost, gained, or duplicated. Using GO terms, GO Slim terms, and PFAM domain groupings with less than 500 members, we calculated over-representations within losses, gains, and duplications each of these groupings at each node using the hypergeometric test. A complete summary of gains, losses, and duplications for all nodes in the phylogenetic tree is available on our supplementary information website.

Phylogenetic profiles

Extended phylogenetic profiles for each category (metabolic pathways, GO terms, GO Slim terms and PFAM categories) were obtained from SYNERGY output by summing the phylogenetic profiles from their component orthogroups. We define a category-level phylogenetic profile as the sum of its component orthogroup-level phylogenetic profiles. The evolution of each of these categories can be quickly visualized on our website. Since genes with the same phylogenetic profile can be linked functionally [94], the webpage for each category contains a link to other categories with similar phylogenetic profiles (Methods). Categories with the most similar profiles were obtained by calculating Euclidean distances to all other profiles. Instances of expanded or missing pathways across the 31 organisms will have non-uniform pathway-level phylogenetic profiles. Thus we tabulated the number of genes in each genome for each category, and automatically searched for gene categories whose copy number (normalized for genome size) had the most non-uniform distribution across the 31 organisms in order to identify the most significant examples of expansions or losses. To identify categories with bimodal properties (such as a categories with a loss or a large expansion on only certain branches of the phylogenetic tree), we clustered each profile into two groups and looked for the pathways with the greatest separation between the two clusters. We used k-means (k = 2) to cluster the profile vectors, and compared the intra- and inter-cluster point-to-centroid distances to find the clusters with the greatest separation. We ranked categories by this separation to find bimodal categories. We further select those that have at least five organisms in the smallest of the two clusters, and an average of at least five genes per genome. P-values are calculated from a T-test between the values for the two groups, with Bonferroni correction applied. In our Supplementary Information website we list those categories with p < 0.05, ranked by the difference between their inter- to intra-centroid distances. When we select the metabolic pathways, PFAM domains, and GO terms with the most non-uniform category-level phylogenetic profiles overall, we find that many of the top categories are lipid metabolism-related categories expanded in the Mycobacteria. We also measured the similarity between evolutionary profiles to find the PFAM categories and GO terms with the biggest difference between pre-defined sets of organisms. For example, we compared both the Mtb complex and a group consisting of other pathogenic Mycobacteria to the set of soil-dwelling Mycobacteria in order to examine the evolution of soil-dwelling, free-living Mycobacteria into more pathogenic Mycobacteria that require a host to survive. We used the following categories: 1. All Mycobacteria (excluding M. leprae because of its massive gene loss). 2. All non-Mycobacteria in our set (excluding Nocardia and Rhodococcus because of their similarity to Mycobacteria) 3. Mtb complex (8 organisms) 4. Other pathogenic Mycobacteria (M. ulcerans, M. avium 104, M. avium K10, M. marinum). 5. Soil-dwelling Mycobacteria that do not require a host (M. sp. MCS, M sp. KMS, M. smegmatis, M. vanbaalenii, M. abscessus, M. gilvum). 6. R. jostii RHA1 and N. farcinia We calculated differences between two sets of organisms exactly as we calculated distances between clusters (above). However, rather than using different clusters of organisms determined by k-means clustering, we used these pre-defined clusters of organisms. We looked at distances between the following sets of organisms: 1-2, 3-4, 3-5, 3-6, 4-5, 4-6, 5-6. For each PFAM domain or GO term represented in at least two organisms in these pairings, we calculated p-values for the differences between the profile values by T-test (Bonferroni-corrected by the number of PFAM domains represented in that set of organisms) and computed inter-and intra-centroid distances (as described in the above paragraph). We compiled lists of those that are most expanded and a list of those most contracted across these pairings. On our website we have included complete lists of PFAM categories, including those that do not make the strict Bonferroni-corrected p-value cutoff. Many potentially interesting expansions do not make the overly conservative Bonferroni-corrected p-value cutoff [95,96].

Motif discovery

Using a compendium of 946 microarray experiments from the TB database [75], we used several different clustering methods to generate predicted regulons. We searched the upstream regions of these regulons for shared transcriptional regulatory motifs. We clustered microarray data by hierarchical and k-means clustering. Because real regulons can be of varying sizes, we performed k-means with k = 50, 100, 200, and 250, then used all the resulting clusters for further analysis. We found that the clusters obtained from hierarchical clustering were not very useful because their size distribution did not approximate that of real regulons as well as those from k-means; therefore we did not analyze clusters from hierarchical clustering further. We used AlignACE [97] to search the upstream regions of the genes in these clusters for motifs. We used the methods for operon prediction, selecting upstream regions, and applying AlignACE to prokaryotic genomes as described in McGuire et al. [77]. Briefly, because of the presence of operons in prokaryotes, we must choose the upstream region of the operon head rather than the region immediately upstream of the gene of interest. Since it is more important to include the correct region than to erroneously include extra incorrect regions, we use a loose operon definition and include sequences for several different possibilities if there is any ambiguity. We look upstream of our gene of interest and select all intergenic sequences until we encounter either a divergent intergenic region or an intergenic region longer than 300 bp. Motifs of interest were selected by applying a set of filters: specificity score [77], quality of alignment (AlignACE MAP score) [97], palindromicity [77], and conservation. To determine the degree of conservation, a search matrix was constructed for each motif. Each of the other genomes was searched with this search matrix using CompareACE, and N-way conserved sites were identified. N-way conserved hits are hits identified upstream of orthologous genes in N genomes, where orthology is defined by membership in the same SYNERGY orthogroup. To select interesting motifs we required specificity score < 1e-10, palindromicity > 0.7, MAP score > 5, and at least 8 sites conserved in 8 genomes. Motifs were compared to a library of search matrices for 9 known Mtb motifs (Acr, Crp, CsoR, DosR, FurA, IdeR, KstR, MprAB, and ZurB), as well as a library of 55 E. coli motifs [98] and 22 Corynebacterial motifs [99]. Comparison of motifs was done using CompareACE [76].

Defining groups based on expression under different lipids

We separated the experiments in our compendium of Mtb H37Rv microarray experiments into separate conditions based on what nutrients were present in their growth conditions (focusing on different lipid conditions, because of the observed importance of lipid metabolism in these organisms). The following categories were used (the number of experiments in each category is shown in parentheses): Palmitic acid (168), Oleic acid (102), Arachidonic and Eicosatetraynoic acids (76), Linoleic acid (41), Eicosatetraynoic acid (13), Ceramide (4), Nordihydroguaiaretic (3), Cholesterol (2), Glucose (1), KstR knockout (1), KstR knockout with cholesterol added (1). Within each experiment, we extracted a list of genes upregulated 1.5 and 2 standard deviations above the mean. For each category, we considered a gene to be upregulated if it was upregulated in more than 50% of the experiments making up that category. We then searched for genes that were only upregulated under certain conditions or sets of conditions. We looked at the evolution of these sets of Mtb H37Rv genes by taking the other members of their orthogroups across all 31 other organisms. Evolution of these groups can be visualized in our supplementary information http://www.broadinstitute.org/ftp/pub/seq/msc/pub/SYNERGY/index.html.

dN/dS Analysis

We used PAML to calculate dN/dS values according to several different evolutionary models [100,101]. Since orthogroups contain paralogs as well as orthologs, we used the gene trees output from SYNERGY when running PAML. Some orthogroups may contain single-copy orthologs in only two closely related organisms, whereas others could contain paralogs in all 31 organisms. For the basic model, we used the following parameters: model = 0 and getSE = 1 (to calculate standard errors). This simple evolutionary model gives one value of dN/dS for each orthogroup, averaged over all lineages as well as all positions in the gene [102]. While this model does not reflect the evolutionary history that has taken place, it is nevertheless a very blunt yet efficient tool for observing selection. To gain insight into the evolution of the three major clades of the phylogenetic tree we also used a "branch model" where a different dN/dS value is allowed on a "foreground" branch (but dN/dS is averaged along positions in the protein) [103,104]. This was done in PAML by using "Model = 2". We compared this model to the basic model using a log-likelihood χ2 test with d.o.f. = 1. For each of the three foreground branches, we used a Bonferroni correction equal to the number of orthogroups present at the branch. We ran this separately for three different "foreground" branches on the phylogenetic tree (labeled in Figure 1): A) The branch leading to the Mtb complex; B) The branch leading to pathogenic Mycobacteria; and C) The branch leading to soil-dwelling, non-pathogenic Mycobacteria. The log-likelihood model that we use here compares this branch model to the simple model with a single value of dN/dS described above, and tests whether the model allowing dN/dS to differ on the foreground branch fits the data better than the basic model. Branch-site models allow dN/dS to vary across branches of the tree and among sites in the protein. We also used the branch-site model of Zhang and Nielsen [100] using Model = 2, NSsites = 2, and fix_blength = 2. We used the model = 0 calculations to determine branch lengths for the branch-site model calculations to save computational time. We compared the results for a subset of the orthogroups with and without fixed tree lengths and determined there was little difference in the results). We chose the same three sets of branches (A-C) that we used for the branch model described above. We compared this model to the corresponding null model using a log-likelihood χ2 test with d.o.f. = 1 [100]. For each of the three foreground branches, we used a Bonferroni correction equal to the number of orthogroups present at the branch. The branch-site model was the most informative. We calculated the functional group over-representations separately for each functional group dataset. These datasets included 21 COG categories, 168 KEGG categories, 749 metabolic pathways, and 7 additional Mycobacteria-specific groupings (PE genes, PPE genes, toxin-antitoxin genes, DosR regulon, esx genes, Rv0474 regulon, and the KstR regulon). We multiplied the hypergeometric p-values by a Bonferroni correction equal to the number of categories or tests performed.

Generating multi-genome alignments

We constructed whole-genome alignments of all 31 organisms, as well as subsets including only Mycobacterial organisms, and organisms within the Mtb complex. These alignments can be downloaded from our website. Our whole genome multiple alignments reveal unannotated stretches of conservation in noncoding regions including transcription factor binding sites in promoter regions, noncoding RNAs, and mis-annotated proteins. To generate whole-genome multiple alignments, we first aligned the reference genome to each target genome in a pairwise manner. The process of pairwise whole-genome alignment consists of using PatternHunter [105] to identify anchors of local alignment, grouping collinear anchors separated by a limited distance into chains, filtering out smaller chains that shadow larger ones, and finally using LAGAN [106] to globally align the entire chain. Once all genomes have been aligned to the reference, we then identified intervals of the reference that map tightly to a single interval of some or all of the target genomes, and we consider these the endpoints of blocks of multiple alignment. These blocks are generally smaller than any precursor pairwise alignment, because a rearrangement or loss of detectable similarity in any genome will truncate the block for all member genomes. We then ran the multiple aligner MLAGAN on each block. Finally, to facilitate searches for constrained regions of the reference, we projected the blocks onto the reference genome, effectively unwinding all genome rearrangements in the target genomes relative to the reference. We visualized the alignments in the GenomeView browser [64].

Selecting conserved regions within the alignments

We used Gumby [65] to select conserved regions in our multiple alignments using a value of p < 0.5. In a multiple alignment of all 19 Mycobacterial genomes, we identified 4697 regions of conservation overlapping coding genes in the reference annotation, and 394 regions in intergenic regions. We also used the method of Ruzzo and Tompa [107] to identify conserved regions. Scores were normalized to the background inferred from the 3 rd-base frequencies. For all H37Rv coding sequences, all bases in the third position were extracted from the 31-way multiple alignment. These were concatenated in a new multiple alignment only containing third bases. From this new multiple alignment we calculated the baseline conservation which is used to normalize the conservation scores for the regular alignment. Both sets of highly conserved regions can be viewed as alignment tracks for the GenomeView browser [64], downloadable on our website.

Predicting RNAs

We predicted regions likely to form RNAs within the conserved intergenic regions of our multiple alignment of 19 Mycobacteria, using Evofold [66]. We divided the intergenic region into 240-bp segments, tiled by 80 bp, to run Evofold. Looking within intergenic regions, we identified 536 regions with Evofold (regions greater than 5 bp in length with length-normalized folding potential score > 0.2). We examined these 536 regions, as well as the 394 conserved intergenic regions found by Gumby, to see if any of these showed significant expression in our log-phase Mtb RNA-seq data. We calculated RPKM [108] values for each of these regions. We examined the regions with RPKM value ≥200 and a number of RNA-seq reads ≥ 20. We eliminated an additional 35 regions which corresponded to known RNAs from the Mtb annotation, or RNAs similar to those found in M. bovis and Streptococcus [60-63], including 26 tRNAs, 2 riboswitches, and 3 found in other organisms. To select intergenic regions with high levels of expression that do not correspond to UTRs, we also calculated RPKM values for the 100 bp regions of the flanking genes closest to the intergenic regions. We selected those intergenic regions with the highest ratio of the RPKM value of the region of interest (within the intergenic region) to the RPKM of the start/stop of the flanking genes. We also looked for regions with a gap in expression between the gene and the region of interest. This will eliminate many regions that merely correspond to UTRs, and select for regions that are disproportionately expressed within the intergenic region only. We found this method to be most useful for selecting regions of interest, and successfully enriched our top hits for previously known small RNAs. The top 50 predicted RNAs can be viewed as a track in the GenomeView browser (see Supplementary Information). We further examined log-phase RNA-seq data from M. smegmatis to confirm that many of the orthologous regions also show expression in M. smegmatis.

Strain, media, and culture conditions for RNA-seq

Mycobacterium tuberculosis H37Rv and M. smegmatis were grown at 37°c in 7H9 media supplemented with 10% ADC (Becton Dickinson), 0.2% glycerol and 0.05% Tween 80. For log phase, cells were grown to OD540 0.2. Roller bottles were used for culturing M. tuberculosis, and shaker flasks for M. smegmatis.

RNA isolation from in vitro cultures for RNA-seq

Bacterial pellet from log-phase cultures of M. tuberculosis and M. smegmatis were resuspended in TRIzol reagent (Invitrogen) and immediately transferred to 2 ml screw-cap tubes containing 0.1 mm zirconia/silica beads (BioSpec Products). M. tuberculosis cells were lysed using a FastPrep-24 bead-beater (MP Biomedicals) 3 times for 30 seconds each at speed 6. M. smegmatis cells were lysed using MagNalyser (Roche). Samples were kept on ice for 1 min between pulses. The TRIzol extracted RNA was treated twice with DNAse and further purified using RNAeasy kit (Qiagen).

Directional mRNA-seq libraries for RNA-seq

We generated mRNA-seq libraries for sequencing on Illumina's GA Sequencer (San Diego, CA). 2 μg purified RNA was depleted of ribosomal RNA using Ambion's MICROBExpress Kit (Austin, TX) as per manufacture's recommended protocol. The enriched mRNA was used to prepare libraries using Illumina's Directional mRNA-seq Library Prep v1.0 protocol. Briefly, 100 ng mRNA was fragmented with cations and heat, end-repaired, adapted by sequential ligation of unique 5-prime and 3-prime adapters, reverse transcribed, PCR amplified, and purified using Agencourt's AMPure Beads (Beverly, MA). The libraries were visualized on an Agilent 2100 Bioanalyzer (Santa Clara, CA) and found to have the expected average fragment length of ~250 bp.

RNA isolation and Northern Blotting

Total RNA was isolated from Mtb as described previously [109] with minor modifications. Briefly, log-phase cells were pelleted, resuspended in TRIzol (Invitrogen), and transferred to Lysing Matrix B tube (QBiogene). The cells were lysed using MagNalyser (Roche), and RNA extracted with Trizol reagent as instructed by the manufacturer. RNA was treated with Turbo DNase (Ambion) for 30 minutes at 37°C twice and purified further using TRIzol solution and 100% Ethanol. Total RNA was separated on 10% TBE-Urea acrylamide gels (Bio-Rad) and electroblotted onto Hybond N + membranes (GE Healthcare). After UV cross-linking the membranes were pre-hybridized and hybridized with labeled probes at 48°C as per the DIG manual (Roche). Probe sequences are CGATGGTCGAAAAGGAACTCGATACGGCTATGCGGTTCT (RNA1), AGTTCACGAAACGAAGAAAGAAGCTAAGAAGACATAGGTT (RNA2), GACTGCCAGCAGGCGCCGCGCAATGCGCTTGCAGGACTTC (RNA3), and GGGTGACATGGCTCAGGGAAGCCCGGGCGGGCTGGGACGT (RNA9). After hybridization the membranes were washed twice using a low stringency buffer (2× SSC, 0.1% SDS), and a high stringency buffer (0.1× SSC, 0.1% SDS), for 15 and 5 minutes at 48°C, respectively. The membranes were processed with DIG detection system (Roche) and exposed to X-ray film.

Abbreviations

Mtb: Mycobacterium tuberculosis; PAH: Polycyclic aromatic hydrocarbons; GO: Gene Ontology; MMR: Mismatch repair.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

AMM performed the analysis and drafted and finalized the manuscript. BW and RR were involved in many aspects of the comparative analysis. STP and SR performed the experimental validation. IW and AR performed the SYNERGY analysis. GD, GKS, RTY, MIM, MJK, and A. Maer provided the M. tuberculosis RNA-seq data. TA provided the GenomeView browser. JZ performed the Eficaz and metabolic pathway analyses. JW, PS, and MK constructed multiple alignments. CS worked on the web page. MP worked on motif discovery and network reconstruction. JEG initiated and supervised the study, and revised the manuscript. All authors read and approved the final manuscript.

Additional file 1

Supplementary Results [110-130]. Click here for file

Additional file 2

Additional related tetR family regulators (2-3 copies in each environmental Mycobacterium). Click here for file

Additional file 3

Northern Blots for small RNAs in . Click here for file

Additional file 4

Genomes contained in orthogroups. Click here for file

Additional file 5

Phylogenetic tree showing bootstrap results. Click here for file
  122 in total

1.  Assigning protein functions by comparative genome analysis: protein phylogenetic profiles.

Authors:  M Pellegrini; E M Marcotte; M J Thompson; D Eisenberg; T O Yeates
Journal:  Proc Natl Acad Sci U S A       Date:  1999-04-13       Impact factor: 11.205

2.  The complete genome sequence of Mycobacterium avium subspecies paratuberculosis.

Authors:  Lingling Li; John P Bannantine; Qing Zhang; Alongkorn Amonsin; Barbara J May; David Alt; Nilanjana Banerji; Sagarika Kanjilal; Vivek Kapur
Journal:  Proc Natl Acad Sci U S A       Date:  2005-08-22       Impact factor: 11.205

3.  EFICAz: a comprehensive approach for accurate genome-scale enzyme function inference.

Authors:  Weidong Tian; Adrian K Arakaki; Jeffrey Skolnick
Journal:  Nucleic Acids Res       Date:  2004-12-01       Impact factor: 16.971

4.  Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora.

Authors:  Andreas Tauch; Olaf Kaiser; Torsten Hain; Alexander Goesmann; Bernd Weisshaar; Andreas Albersmeier; Thomas Bekel; Nicole Bischoff; Iris Brune; Trinad Chakraborty; Jörn Kalinowski; Folker Meyer; Oliver Rupp; Susanne Schneiker; Prisca Viehoever; Alfred Pühler
Journal:  J Bacteriol       Date:  2005-07       Impact factor: 3.490

Review 5.  Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis.

Authors:  Kuni Takayama; Cindy Wang; Gurdyal S Besra
Journal:  Clin Microbiol Rev       Date:  2005-01       Impact factor: 26.132

6.  Mutation in mce operons attenuates Mycobacterium tuberculosis virulence.

Authors:  Andrea Gioffré; Eduardo Infante; Diana Aguilar; María De la Paz Santangelo; Laura Klepp; Ariel Amadio; Virginia Meikle; Ignacio Etchechoury; María Isabel Romano; Angel Cataldi; Rogelio Pando Hernández; Fabiana Bigi
Journal:  Microbes Infect       Date:  2005-02-01       Impact factor: 2.700

7.  Characterization of Mycobacterium tuberculosis Rv3676 (CRPMt), a cyclic AMP receptor protein-like DNA binding protein.

Authors:  Guangchun Bai; Lee Ann McCue; Kathleen A McDonough
Journal:  J Bacteriol       Date:  2005-11       Impact factor: 3.490

8.  Computational prediction and experimental verification of novel IdeR binding sites in the upstream sequences of Mycobacterium tuberculosis open reading frames.

Authors:  Prachee Prakash; Sailu Yellaboina; Akash Ranjan; Seyed E Hasnain
Journal:  Bioinformatics       Date:  2005-03-03       Impact factor: 6.937

9.  Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.

Authors:  Ana Conesa; Stefan Götz; Juan Miguel García-Gómez; Javier Terol; Manuel Talón; Montserrat Robles
Journal:  Bioinformatics       Date:  2005-08-04       Impact factor: 6.937

10.  Expansion of the BioCyc collection of pathway/genome databases to 160 genomes.

Authors:  Peter D Karp; Christos A Ouzounis; Caroline Moore-Kochlacs; Leon Goldovsky; Pallavi Kaipa; Dag Ahrén; Sophia Tsoka; Nikos Darzentas; Victor Kunin; Núria López-Bigas
Journal:  Nucleic Acids Res       Date:  2005-10-24       Impact factor: 16.971

View more
  34 in total

Review 1.  Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis.

Authors:  Matthew F Wipperman; Nicole S Sampson; Suzanne T Thomas
Journal:  Crit Rev Biochem Mol Biol       Date:  2014-03-10       Impact factor: 8.250

2.  bis-Molybdopterin guanine dinucleotide is required for persistence of Mycobacterium tuberculosis in guinea pigs.

Authors:  Monique J Williams; Crystal A Shanley; Andrew Zilavy; Blas Peixoto; Claudia Manca; Gilla Kaplan; Ian M Orme; Valerie Mizrahi; Bavesh D Kana
Journal:  Infect Immun       Date:  2014-11-17       Impact factor: 3.441

3.  Stepwise pathogenic evolution of Mycobacterium abscessus.

Authors:  Josephine M Bryant; Karen P Brown; Sophie Burbaud; Isobel Everall; Juan M Belardinelli; Daniela Rodriguez-Rincon; Dorothy M Grogono; Chelsea M Peterson; Deepshikha Verma; Ieuan E Evans; Christopher Ruis; Aaron Weimann; Divya Arora; Sony Malhotra; Bridget Bannerman; Charlotte Passemar; Kerra Templeton; Gordon MacGregor; Kasim Jiwa; Andrew J Fisher; Tom L Blundell; Diane J Ordway; Mary Jackson; Julian Parkhill; R Andres Floto
Journal:  Science       Date:  2021-04-30       Impact factor: 47.728

Review 4.  Mycobacterium tuberculosis metabolism.

Authors:  Digby F Warner
Journal:  Cold Spring Harb Perspect Med       Date:  2014-12-11       Impact factor: 6.915

5.  Vanadium in groundwater aquifers increases the risk of MAC pulmonary infection in O'ahu, Hawai'i.

Authors:  Ettie M Lipner; Joshua P French; Stephen Nelson; Joseph O Falkinham Iii; Rachel A Mercaldo; Rebekah A Blakney; Yihe G Daida; Timothy B Frankland; Kyle P Messier; Jennifer R Honda; Stacey Honda; D Rebecca Prevots
Journal:  Environ Epidemiol       Date:  2022-09-02

6.  Role of C-terminal domain of Mycobacterium tuberculosis PE6 (Rv0335c) protein in host mitochondrial stress and macrophage apoptosis.

Authors:  Parul Bhatt; Sadhna Sharma; Monika Sharma
Journal:  Apoptosis       Date:  2022-10-18       Impact factor: 5.561

Review 7.  Use of siRNA molecular beacons to detect and attenuate mycobacterial infection in macrophages.

Authors:  Remo George; Renata Cavalcante; Celso Carvalho; Elyana Marques; Jonathan B Waugh; M Tino Unlap
Journal:  World J Exp Med       Date:  2015-08-20

8.  Mycobacterium tuberculosis is protected from NADPH oxidase and LC3-associated phagocytosis by the LCP protein CpsA.

Authors:  Stefan Köster; Sandeep Upadhyay; Pallavi Chandra; Kadamba Papavinasasundaram; Guozhe Yang; Amir Hassan; Steven J Grigsby; Ekansh Mittal; Heidi S Park; Victoria Jones; Fong-Fu Hsu; Mary Jackson; Christopher M Sassetti; Jennifer A Philips
Journal:  Proc Natl Acad Sci U S A       Date:  2017-09-27       Impact factor: 11.205

9.  Nontuberculous Mycobacteria Infection Risk and Trace Metals in Surface Water: A Population-based Ecologic Epidemiologic Study in Oregon.

Authors:  Ettie M Lipner; Joshua P French; Joseph O Falkinham; James L Crooks; Rachel A Mercaldo; Emily Henkle; D Rebecca Prevots
Journal:  Ann Am Thorac Soc       Date:  2022-04

10.  Nontuberculous mycobacterial infection and environmental molybdenum in persons with cystic fibrosis: a case-control study in Colorado.

Authors:  Jerry A Nick; D Rebecca Prevots; Ettie M Lipner; James L Crooks; Joshua French; Michael Strong
Journal:  J Expo Sci Environ Epidemiol       Date:  2021-07-03       Impact factor: 5.563

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.