Literature DB >> 22384365

Genome evolution in the eremothecium clade of the Saccharomyces complex revealed by comparative genomics.

Jürgen Wendland1, Andrea Walther.   

Abstract

We used comparative genomics to elucidate the genome evolution within the pre-whole-genome duplication genus Eremothecium. To this end, we sequenced and assembled the complete genome of Eremothecium cymbalariae, a filamentous ascomycete representing the Eremothecium type strain. Genome annotation indicated 4712 gene models and 143 tRNAs. We compared the E. cymbalariae genome with that of its relative, the riboflavin overproducer Ashbya (Eremothecium) gossypii, and the reconstructed yeast ancestor. Decisive changes in the Eremothecium lineage leading to the evolution of the A. gossypii genome include the reduction from eight to seven chromosomes, the downsizing of the genome by removal of 10% or 900 kb of DNA, mostly in intergenic regions, the loss of a TY3-Gypsy-type transposable element, the re-arrangement of mating-type loci, and a massive increase of its GC content. Key species-specific events are the loss of MNN1-family of mannosyltransferases required to add the terminal fourth and fifth α-1,3-linked mannose residue to O-linked glycans and genes of the Ehrlich pathway in E. cymbalariae and the loss of ZMM-family of meiosis-specific proteins and acquisition of riboflavin overproduction in A. gossypii. This reveals that within the Saccharomyces complex genome, evolution is not only based on genome duplication with subsequent gene deletions and chromosomal rearrangements but also on fungi associated with specific environments (e.g. involving fungal-insect interactions as in Eremothecium), which have encountered challenges that may be reflected both in genome streamlining and their biosynthetic potential.

Entities:  

Keywords:  GC content; ancestral gene order; genome evolution; mating type locus; whole-genome sequencing

Year:  2011        PMID: 22384365      PMCID: PMC3276169          DOI: 10.1534/g3.111.001032

Source DB:  PubMed          Journal:  G3 (Bethesda)        ISSN: 2160-1836            Impact factor:   3.154


Studying yeast genomes provides crucial insight into the evolution of these genomes on the molecular level. One large class known as hemiascomycetes contains the budding yeasts with Saccharomyces cerevisiae, which was the first eukaryotic species whose genome was sequenced (Goffeau 1996). This endeavor has been followed by sequencing efforts using next-generation sequencing methodology, which provided a wealth of information, particularly for species in the Saccharomyces complex (Dujon ; Cuomo and Birren 2010). Compilation of large amounts of sequence data can be used to generate a compendium of genes shared by a common ancestor prior to the breakup of lineages. Ideally, such an ancestral genome can be established for any well-established node in a phylogenetic tree. One such effort using 11 yeast species provided a reconstructed genome of an ancestor of the yeast lineage just prior to the whole-genome duplication (Gordon ). With reference to such an ancestor, one can infer events that must have occurred in the respective lineages that led to the current species’ genomes. This may provide significant insight in understanding the biology of these species in terms of adaptive evolution and the acquisition of species-specific traits. Given the relative ease in molecular genetic manipulation of most fungi in the Saccharomyces complex, this wealth of novel information may direct our roads of research to study the functional relevance of alterations detected by comparative genomics (Rusche and Rine 2010). The genus Eremothecium has been assigned to clade 12 of the Saccharomyces complex (Kurtzman and Robnett 2003). With Ashbya gossypii, this genus contains an industrially important species for the production of riboflavin (vitamin B2). The molecular biology involved in riboflavin production has been studied for many years in A. gossypii. This led to the identification of pathways required for providing GTP as a central precursor for riboflavin biogenesis (Förster ; Jimenez ; Mateos ). In addition, interest in Ashbya was spurred by the unusual filamentous growth mode within the Saccharomyces complex (Wendland and Philippsen 2001). Current hypotheses favor the notion that an Eremothecium ancestor has gained the potential to generate true hyphae instead of employing pseudohyphal growth (Schmitz and Philippsen 2011). Therefore, studying the Eremothecium genus in more detail may provide us with molecular insight on which steps may have been involved to establish filamentous growth in this genus. E. cymbalariae, Eremothecium ashbyi, and A. gossypii are filamentous fungi that share a rare growth mode that includes dichotomous tip branching. Eremothecium ashbyi and A. gossypii are both flavinogenic species in terms of their ability to overproduce and secrete riboflavin, whereas E. cymbalariae is not an overproducer (Sengupta and Chandra 2011). Furthermore, the 8.7 Mb A. gossypii genome provided compelling evidence for whole-genome duplication in the S. cerevisiae lineage. This could be established based on the 2:1 mapping of S. cerevisiae loci to blocks of A. gossypii genes (Dietrich ). Similar 2:1 assignments have subsequently been reported for other unduplicated yeast genomes as well (Dujon ; Kellis ). Using evolutionary genomics, we sought to close the gap between whole-genome duplication in one branch of the Saccharomyces lineage giving rise to a modern 12 Mb genome of S. cerevisiae and A. gossypii with one of the smallest genomes of a free living eukaryote in another. To this end, we determined the complete genome sequence of E. cymbalariae and annotated the predicted gene models. In a comparative approach, we elucidated the relationship of E. cymbalariae with the reconstructed yeast ancestor established by the Wolfe group and the A. gossypii genome (Dietrich ; Gordon ).

Materials and Methods

Strains and media

Eremothecium cymbalariae strain DBVPG #7215 was sequenced. E. cymbalariae is the type strain of the genus Eremothecium and was identified by Borzi in 1888 (Borzi 1888). Cells were grown using complete media (1% yeast extract, 1% peptone, 2% dextrose).

Sequencing strategy

E. cymbalariae genomic DNA was prepared according to Guthrie and Fink (1991). Instead of enzymatic digestion of the cell wall, grinding in liquid nitrogen was chosen. The DNA was prepared for next-generation sequencing at LGC Genomics (Berlin, Germany). Sequencing generated 1,000,000 reads on a 454 Roche GS FLX Titanium Sequencer. With an average of 400 bases per read, a total of ∼400 Mb of high-quality sequence data corresponding to a 40× coverage of the E. cymbalariae genome was produced. Primary assembly of the genome data resulted in 209 contigs, the largest of which was >500 kb. The average contig size was 45 kb. Next, a fosmid library with a standard insert size of 30 kb was generated based on the pCC2FOS vector (Epicenter Biotechnologies, Madison, WI). From this library, paired-end reads of 750 fosmids were generated. Mapping these reads to the original contigs resulted in the generation of 35 supercontigs or scaffolds. Gaps within these scaffolds were closed by primer walking on the fosmid clones. Remaining gaps between supercontigs were closed by generating and sequencing PCR products. Gap closure was completed in parallel with genome annotation to make use of syntenic relationships between the E. cymbalariae genome and the genome of A. gossypii or S. cerevisiae, or by inferring reciprocal translocations. This procedure yielded eight contigs corresponding to the eight chromosomes of E. cymbalariae.

Annotation of the E. cymbalariae genome

The eight chromosomes of the E. cymbalariae genome were annotated and submitted to the EMBL/GenBank Data Libraries with accession numbers CP002497–CP002504. The mitochondrial genome has not been retrieved. Available fragments of the mitochondrial genome did not assemble the full mitochondrial genome at his stage. There is one region on CHR4 in the E. cymbalariae genome that carries the rDNA repeats (supporting information, Figure S3). The E. cymbalariae genome was compared with the A. gossypii and S. cerevisiae genomes available from AGD (Ashbya Genome Database, http://agd.vital-it.ch/index.html) and SGD (Saccharomyces Genome Database, http://www.yeastgenome.org) using local BLAST tools (available at http://blast.ncbi.nlm.nih.gov). Using top-ranked hits, this produced a draft annotation of the E. cymbalariae genome. Fine annotation of the E. cymbalariae genome used syntenic relationships to A. gossypii and S. cerevisiae, as well as conservation of gene order with the reconstructed ancestral yeast genome. E. cymbalariae ORFs that did not occur in either of the genomes used for comparison were searched against the nonredundant dataset of NCBI. There are, however, 44 hypothetical ORFs for which no homolog could be identified. The identification of introns was mainly based on their conservation within homologous genes. The current annotation was reinvestigated intensively to provide an as correct as possible initial characterization of the E. cymbalariae genome. Identification of as Ecym_2083a was based on synteny. However, this gene contains an intron, and the weak similarity of EcymSpo16 with its A. gossypii homolog made us miss this gene during the extensive annotation period; it was found only by specifically searching for this ZMM-family protein in E. cymbalariae. This clarifies how inevitable changes and the annotation of newly identified genes within the current nomenclature will be dealt with. EcymSPO16/Ecym_2083a can be found on CHR2 between the genes Ecym_2083 and Ecym_2084.

Results/Discussion

Sequencing of E. cymbalariae

E. cymbalariae was isolated and first described in 1888 by Borzi as a novel and very interesting fungus because of its systematic position (Borzi 1888). The genus name refers to the characteristic sporangia formed scarcely and in a solitary fashion at the tip of aerial hyphae. Eremothecium species today are grouped into clade 12 of the Saccharomyces complex according to Kurtzman and Robnett (2003) (Figure 1A). Both E. cymbalariae and A. gossypii are filamentous fungi that branch dichotomously at hyphal tips and thus can easily be distinguished from the dimorphic representatives in this genus, Holleya sinecauda and E. coryli (Schade ; Gastmann ). However, E. cymbalariae generates a fluffy aerial mycelium unique in this genus and in contrast to synnemata formed by A. gossypii. Additionally, E. cymbalariae mycelia are white, indicating a lack of riboflavin overproduction obvious from the yellow-colored A. gossypii mycelium (Figure 1B). E. cymbalariae forms only scarce sporangia, whereas A. gossypii produces abundant sporangia and spores. E. cymbalariae and A. gossypii spores differ in size and shape (Figure 1C). Whereas E. cymbalariae spores are on average 13 µm long and can be readily separated from each other, A. gossypii spores are more than twice as long and clump together via terminal filaments (Figure 1C). This has hampered efforts to set up mutagenic screens with A. gossypii because of the inability to isolate single spores. Interestingly, spore morphology of A. gossypii resembles that of the dimorphic relative E. coryli (Gastmann ).
Figure 1 

Comparison of Eremothecium cymbalariae with Ashbya gossypii. (A) Phylogenetic tree of selected species from the Saccharomyces complex based on 18S rDNA. The dot indicates the whole-genome duplication (WGD). Clade assignments are according to Kurtzman and Robnett (2003). (B) Fluffy aerial mycelial growth of E. cymbalariae compared with compact mycelial growth of the riboflavin overproducer A. gossypii (wrinkles indicate areas of strong hyphal adhesion). (C) Morphology of spores of A. gossypii (top) and E. cymbalariae (bottom). (D) Distribution of amino acid identities of all E. cymbalariae protein coding genes compared with the A. gossypii protein set. (E) Venn diagram indicating the distribution of homologous vs. non-homologous genes in both genomes. Genes occurring either in A. gossypii or E. cymbalariae may share homologs in S. cerevisiae or other yeasts as indicated.

Comparison of Eremothecium cymbalariae with Ashbya gossypii. (A) Phylogenetic tree of selected species from the Saccharomyces complex based on 18S rDNA. The dot indicates the whole-genome duplication (WGD). Clade assignments are according to Kurtzman and Robnett (2003). (B) Fluffy aerial mycelial growth of E. cymbalariae compared with compact mycelial growth of the riboflavin overproducer A. gossypii (wrinkles indicate areas of strong hyphal adhesion). (C) Morphology of spores of A. gossypii (top) and E. cymbalariae (bottom). (D) Distribution of amino acid identities of all E. cymbalariae protein coding genes compared with the A. gossypii protein set. (E) Venn diagram indicating the distribution of homologous vs. non-homologous genes in both genomes. Genes occurring either in A. gossypii or E. cymbalariae may share homologs in S. cerevisiae or other yeasts as indicated. We sequenced the E. cymbalariae genome with up to 40× coverage, and on the basis of the 9.7 Mb complete genome sequence, we annotated 4712 genes, which is very similar to the 4718 genes of A. gossypii and the 4824 genes of Schizosaccharomyces pombe (Dietrich , Wood ). Details of the sequencing of the E. cymbalariae genome (accession numbers CP002497–CP002504) and supporting information are available in Materials and Methods and Table S1. The conservation of protein sequences between syntenic homologs of E. cymbalariae and A. gossypii varies considerably, ranging from 20 to 100%. Highly conserved genes include, for example, ribosomal proteins (Figure 1D). On average, there is a 60% identity between E. cymbalariae and A. gossypii proteins. This was surprising, as it indicates quite some evolutionary distance. This divergence is in a range of the S. cerevisiae and Kluyveromyces lactis species pair. For comparison, in Saccharomyces sensu stricto species, the level of protein identity is >85% (Cliften ). Especially the set of Eremothecium proteins that share only a low level of sequence identity may be informative of rapidly evolving proteins or processes that may warrant further study. On the other hand, 97% of all protein-encoding genes of E. cymbalariae share a homolog in A. gossypii. This leaves about 150 genes in each of the genomes not shared between E. cymbalariae and A. gossypii (Figure 1E). In the initial annotation of the Ashbya genome, ∼250 genes were found that do not have a homolog in S. cerevisiae. Comparing this set with the E. cymbalariae gene set indicates that most of these so-called NOHBYs (no homology in baker’s yeast) actually share a homolog in both Eremothecium species.

Mapping centromeric loci to E. cymbalariae chromosomes

We mapped the completed genome of E. cymbalariae to eight contigs corresponding to eight chromosomes, in contrast to only seven chromosomes in A. gossypii. Using syntenic gene arrangements between E. cymbalariae and A. gossypii, we were able to identify seven E. cymbalariae centromeres, which were designated CEN1 to CEN7, and the corresponding chromosomes, CHR1 to CHR7, respectively. This differs from the annotation in A. gossypii, which numbered the chromosomes according to size, with CHR1 being the smallest. E. cymbalariae CEN8 was identified based on synteny to S. cerevisiae centromere loci on CHRX and CHRXII (Figure 2). The arrangement of the E. cymbalariae CEN8 locus indicates that in A. gossypii both chromosomal arms of the ancestral CHR8 were translocated to two positions on other A. gossypii chromsomes, i.e. the telomeres of A. gossypii chromosomes I and III, with concomitant loss of CEN8 but without any loss of genes. This mechanism of reduction in chromosome numbers is contrasted by all other cases in the Saccharomyces complex, in which telomere-to-telomere fusion of two chromosomes with subsequent loss of one of the centromeres was suggested to be predominant (Gordon ). Deviations from the number of eight chromosomes of the yeast ancestor have been found in pre–whole-genome duplication yeasts, e.g. Kluyveromyces lactis (six chromosomes) and Zygosaccharomyces rouxii (seven chromosomes). In post-WGD species, there are also deviations from 16 chromosomes, such as in Candida glabrata and Naumovia castellii (Dujon ; Gordon , 2011; Souciet ). This indicates that chromosome reduction was not the speciation event that distinguished the Eremothecium lineage from the other pre-WGD clades of the Saccharomyces complex, as eight ancestral chromosomes can still be found in E. cymbalariae, although a reduction to seven chromosomes in the genome of the A. gossypii ancestor could have separated this lineage from E. cymbalariae.
Figure 2 

Chromosome assignment for all E. cymbalariae chromosomes based on synteny. Chromosomes 1 to 7 were assigned based on conserved centromere regions between E. cymbalariae and A. gossypii. A. gossypii systematic nomenclature is used. Arrows indicate transcriptional orientation of genes. Arrows for centromeres indicate orientation of Centromeric DNA Elements (CDEI-CDEII-CDEIII). E. cymbalariae centromeric region of CHR4 contains two genes that are homologous to S. cerevisiae genes but are absent in A. gossypii. CEN8 was identified based on synteny to S. cerevisiae genes at centromere loci CHRX and CHRXII. CEN8 has been eliminated in A. gossypii, and the chromosomal arms have been translocated to CHR1 and CHR3, respectively.

Chromosome assignment for all E. cymbalariae chromosomes based on synteny. Chromosomes 1 to 7 were assigned based on conserved centromere regions between E. cymbalariae and A. gossypii. A. gossypii systematic nomenclature is used. Arrows indicate transcriptional orientation of genes. Arrows for centromeres indicate orientation of Centromeric DNA Elements (CDEI-CDEII-CDEIII). E. cymbalariae centromeric region of CHR4 contains two genes that are homologous to S. cerevisiae genes but are absent in A. gossypii. CEN8 was identified based on synteny to S. cerevisiae genes at centromere loci CHRX and CHRXII. CEN8 has been eliminated in A. gossypii, and the chromosomal arms have been translocated to CHR1 and CHR3, respectively. Point-like centromeres appeared already in the common ancestor of pre- and post-WGD species. Thus, centromeric DNA elements, CDEI, CDEII, and CDEIII are found to be highly conserved in the Saccharomyces complex (Gordon ). There is strong conservation between E. cymbalariae and A. gossypii centromeres, as could be expected of two closely related species. In particular, the CDEII region is ∼160 bp and thus twice as large as in S. cerevisiae (Figure S1).

Comparison of telomere repeats in Eremothecium

We identified 9 out of 16 telomeres of the E. cymbalariae genome. Thus, the E. cymbalariae genome currently lacks sequences at 7 chromosomal ends. With the available sequence information, we could determine the telomere repeat of E. cymbalariae as a 24 bp repeat sequence. It is characterized by tandem duplications of the sequence (CACACCGCTGAGAGACCCGTACAC)n. This repeat sequence differs from the telomere repeat of A. gossypii by a single base (Figure 3A). The only nontelomere copy of these repeats is in the putative EcymTLC1 gene, which represents the RNA template component of telomerase. We identified this feature based on synteny to the ancestral TLC1 locus and also via comparison with S. cerevisiae and A. gossypii (Figure 3B).
Figure 3 

Identification of telomere repeats in E. cymbalariae. (A) Based on the identification of 9 out of 16 telomeres, the E. cymbalariae telomere repeat structure could be inferred. The 24 bp repeat of E. cymbalariae differs at a single position from the telomere repeat of A. gossypii. (B) In S. cerevisiae, the RNA component of telomerase is encoded by TLC1. This feature is located between YBR035C and YBR036C on CHRII. The E. cymbalariae and A. gossypii TLC1 genes are found at syntenic positions. E. cymbalariae TLC1 is located on CHR6 and additionally shares a gene with the deduced ancestor that is not found in A. gossypii or S. cerevisiae.

Identification of telomere repeats in E. cymbalariae. (A) Based on the identification of 9 out of 16 telomeres, the E. cymbalariae telomere repeat structure could be inferred. The 24 bp repeat of E. cymbalariae differs at a single position from the telomere repeat of A. gossypii. (B) In S. cerevisiae, the RNA component of telomerase is encoded by TLC1. This feature is located between YBR035C and YBR036C on CHRII. The E. cymbalariae and A. gossypii TLC1 genes are found at syntenic positions. E. cymbalariae TLC1 is located on CHR6 and additionally shares a gene with the deduced ancestor that is not found in A. gossypii or S. cerevisiae. Even though our assembled sequence does not reach into telomere repeats, in seven cases a comparison with the reconstructed ancestor indicates that the terminal genes in this reconstructed ancestral genome were identified also in E. cymbalariae. Thus, even though the reconstruction of the ancestral genome is preliminary due to the more frequent recombination events at telomere loci, we believe that based on our high sequence coverage we may not have missed a large number of genes. E. cymbalariae, like A. gossypii, does not harbor repetitive sequence elements such as S. cerevisiae Y′ elements at subtelomere regions. In other fungal model systems, such as Magnaporthe oryzae and Ustilago maydis, telomere-linked helicase gene families have been described, which are encoded by genes bearing similarity to the helicase genes of Y′ elements (Farman 2007). In S. cerevisiae, these subtelomeric regions are hotspots of variation (Louis and Vershinin 2005). S. cerevisiae has accumulated several gene families at telomere regions. Particularly, genes of the SUC (invertase), MAL (maltose utilization), MEL (melibiose utilization), and FLO (flocculation) families, which are important for the fermentative life style of yeast, are clustered at telomeres (Teunissen and Steensma 1995). Dispersal of these genes among different S. cerevisiae telomeres has been facilitated by rearrangements at chromosome ends. In the A. gossypii genome, several duplicated genes can be found at telomere loci [e.g. JEN1 on the right arm of chromosome I (TEL1R) and the left arm of chromosome II (TEL2L), OPT2 on TEL3L and TEL4L], and tandem duplications of telomere-associated genes can be found (e.g. a OAF1 triplication near TEL4R or the distribution of mating-type loci at TEL4R and TEL5R) (Table S3B and see below). This provides evidence for sequence amplification by chromosomal rearrangements in A. gossypii, which we did not observe in E. cymbalariae.

CHR1 harbors three mating-type cassettes in E. cymbalariae

We currently lack understanding of a sexual cycle in A. gossypii. A. gossypii produces spores that carry a single haploid nucleus. This feature is particularly useful in isolating homokaryotic mutants. Spores can germinate into a mycelium that can produce spores itself without requiring a mating partner. Thus A. gossypii may be homothallic (Wendland and Walther 2005). The A. gossypii strain that was sequenced was found to harbor three identical mating-type cassettes containing MATa information. In S. cerevisiae, mating type is determined by the expression of MAT or MATα mating-type genes residing at the MAT locus (Figure 4). The active mating-type locus is on CHRIII of S. cerevisiae. At the telomeres of CHRIII, silent mating-type cassettes HMLα and HMRa are located. These loci can serve as templates for mating-type switching induced by -mediated DSB formation at the MAT locus (Haber 1998). In the A. gossypii and E. cymbalariae genome [as in other preduplication genomes, with the potential exception of K. lactis (Fabre )], there is no homolog of the Ho-endonuclease. We found that E. cymbalariae harbors a conserved array of mating-type loci on CHR1 as found in S. cerevisiae CHRIII and in K. lactis (Figure 4). E. cymbalariae MAT encodes two genes, MATa1 and MAT2, whereas MATα encodes MATα1 and MATα2. The genes flanking the MAT loci are conserved between E. cymbalariae and A. gossypii. We recently analyzed several components of the mating pheromone signal transduction cascade in A. gossypii and showed that deletion of, for example, AgSTE2 and AgSTE3 does not inhibit sporulation. Deletion of the downstream transcription factor AgSTE12, on the other hand, resulted in increased sporulation. We also noted differences in genes encoding the A. gossypii α-factor pheromone. In S. cerevisiae and E. cymbalariae, there are two genes each encoding pre-proproteins containing several repeats of the mature respective α-factors. In A. gossypii, one of the homologous MFα genes does not contain a mature α-factor peptide, whereas the second gene harbors only a single peptide (Wendland ). Thus, there are striking differences between E. cymbalariae and A. gossypii concerning the organization of mating-type loci and in the genes involved in pheromone signaling (see also below). This actually makes E. cymbalariae an interesting model to investigate sexual reproduction in the filamentous Eremothecium species (e.g. concerning mating-type switching, pheromone signaling, and meiosis).
Figure 4 

Comparative organization of mating-type loci and conserved flanking genes in Saccharomycetes. MATa loci are boxed in gray, MATα loci in yellow. E. cymbalariae shares the chromosomal arrangement of a MAT locus and two cassettes (HMLα and HMRa) with S. cerevisiae and K. lactis. Genes flanking the mating-type loci are conserved between E. cymbalariae and A. gossypii. Both species have lost three genes (S. cerevisiae homologs of YJL206c, YJL207c, and SLA2) found at the K. lactis MAT locus. MATa on A. gossypii CHR6 is in a region of block synteny with the E. cymbalariae MATα on CHR1. Both telomeres of A. gossypii CHR6 are known and do not harbor additional mating-type cassettes.

Comparative organization of mating-type loci and conserved flanking genes in Saccharomycetes. MATa loci are boxed in gray, MATα loci in yellow. E. cymbalariae shares the chromosomal arrangement of a MAT locus and two cassettes (HMLα and HMRa) with S. cerevisiae and K. lactis. Genes flanking the mating-type loci are conserved between E. cymbalariae and A. gossypii. Both species have lost three genes (S. cerevisiae homologs of YJL206c, YJL207c, and SLA2) found at the K. lactis MAT locus. MATa on A. gossypii CHR6 is in a region of block synteny with the E. cymbalariae MATα on CHR1. Both telomeres of A. gossypii CHR6 are known and do not harbor additional mating-type cassettes.

Analysis of GC content in Eremothecium species

A unique feature of the A. gossypii genome within the Saccharomyces complex is its high GC content of 52% (Dietrich ). In contrast, we found that the GC content of E. cymbalariae with only 40% is similar to that of S. cerevisiae (38.3%) and other hemiascomycetous yeasts. Generally, the GC content around centromere regions (and at some telomeres) is lower than average in both E. cymbalariae and A. gossypii (Figure S2). A decrease in GC around centromere loci was noted also for other species. This may facilitate the identification of centromeres in species that do not have conserved point-like centromere structure (Gordon ). It was also noted that directional mutational pressure could result in evolutionary changes of GC content (Sueoka 1988). Recently it was suggested that gene conversion (i.e. the repair of double-strand breaks, DSB) is GC-biased in many eukaryotes including mammals (Duret and Galtier 2009; Galtier, ; Marais 2003). Interestingly, in the yeast Lachancea kluyveri, the 1 Mb left arm of chromosome C shows a significantly higher GC content (52.9%) compared with the rest of the genome (40.4%), which may have been caused by an ancient hybridization event or by progressive GC content increase similar to a GC-biased repair. It was also noted that this arm is delayed in replication compared with the rest of the genome (Payen ) We analyzed GC profile in E. cymbalariae and A. gossypii using a chromosome scale sliding window approach (GC profile available at http://tubic.tju.edu.cn/GC-Profile/; Gao and Zhang, 2006). For all chromosomes of both species, we could establish a GC-poor trough at centromere loci (one example for each species is shown in Figure S3). These regions of reduced GC content include at least 15 kb around the centromeres. Other areas with reduced GC content can be found at telomeres. Interestingly, in A. gossypii we found another GC coldspot on CHR4 between 827451 and 847198. This region contains 10 genes in A. gossypii that are in a syntenic block conserved between the reconstructed ancestor, E. cymbalariae, and A. gossypii. The functions of homologs of these genes have been analyzed in S. cerevisiae: six of these genes are essential; two are involved in cell cycle progression and sporulation; one in endocytosis; and for one, the function is unknown (Table S2). The homologous E. cymbalariae region also has a decreased GC content of 38.3% compared with 40.4% for the whole CHR8. This may suggest that GC coldspots mark regions of chromosomes harboring important genetic elements that may be adversely affected by GC-biased recombination. Conversely, this suggests that GC hotspots may pinpoint regions of frequent recombination, which may have altered genes in those loci in a species-specific manner. More refined functional analyses of such regions, therefore, seem warranted.

Comparison of Eremothecium genomes

The genome of E. cymbalariae is 9.7 Mb and thus ∼900 kb larger than that of A. gossypii (excluding rDNA repeats; see Figure S3 and Table 1). This size difference is not based on a difference in gene number, as both Eremothecium species have about 4720 genes each. Gene density in E. cymbalariae is similar to that in S. cerevisiae with 2 kb/gene. The A. gossypii genome is more compact and gene density is <1.9 kb/gene. The size reduction of about 10% in the A. gossypii genome is due largely (>80%) to the streamlining of inter-ORF regions and far less to the extent of shortening ORFs.
Table 1 

Comparison of E. cymbalariae and A. gossypii genomes

E. cymbalariaeA. gossypii
Chromosomes87
Genome size without rDNA9671 kb8765 kb
Genes47114726
Gene density2.05 kb/gene1.86 kb/gene
Gene coding DNA7118 kb6970 kb
Gene coding DNA73.62%79.52%
Introns232226
tRNAs143192
GC content40,3%51,8%
TY3 transposon1
We found one copy of a TY3-Gypsy transposon in E. cymbalariae, which does not occur in A. gossypii. There are remnants of a potential TY3 transposon on Ashbya CHRI and CHRIII and AGL264w may resemble a bacterial transposase (Dietrich ). Sites of transposon excision (LTRs or sigma elements) are found throughout the E. cymbalariae genome, suggesting that this transposon has been active (Table S1). Almost all E. cymbalariae genes that share homologs in A. gossypii or the reconstructed yeast ancestor are arranged in syntenic blocks. Orphan genes in both species are often associated with tRNAs or may be remnants of recombination or transposition events. We adopted a systematic nomenclature for the E. cymbalariae genome that assigns each gene the species identifier “Ecym,” which is separated by an underscore from a four-digit number indicating the chromosomal location and assigning an ORF number. ORFs are numbered consecutively starting from the left telomere. Thus, Ecym_1001 designates the first ORF on chromosome 1 next to the left telomere, and similarly, Ecym_1541 will indicate the 541st ORF (last ORF) on CHR1 counted from the left telomere. In this way, we annotated the complete genome. We took into account neither the position of the centromere on a chromosome nor the transcriptional orientation of an ORF. The identification of introns in E. cymbalariae was mainly based on their conservation within homologous genes. The intron splice rules for E. cymbalariae (5′-GT…TACTAAC…AG-3′) are conserved with those of A. gossypii and S. cerevisiae (Dietrich , Spingola ). This led to the identification and annotation of 232 usually small putative introns. The average intron size is 173 bp. Most of the introns are located near the 5′ end of ORFs, as was also found in A. gossypii and S. cerevisiae. This small number of introns is in line with those observed in other fungi of the Saccharomyces complex. There are only a small number of genes in which putative introns differ between E. cymbalariae and A. gossypii. These occasions, therefore, indicate intron loss in the species without introns. With more and more genomes and transcriptomes available, a comprehensive map of ancestral introns can be compiled in the future. To identify tRNA genes, tRNAscan was used (available at http://lowelab.ucsc.edu/ tRNAscan-SE/; Schattner ). This resulted in the annotation of 143 tRNA genes. This number is comparable to the 275 tRNAs in the S. cerevisiae genome when taking the WGD into account. A. gossypii, on the other hand, has 192 annotated tRNAs. This suggests an increase in tRNA genes in A. gossypii. Only four sets of tandemly duplicated tRNAs are present in the A. gossypii genome. Comparisons of blocks of syntenic gene arrangement between A. gossypii and S. cerevisiae have indicated that endpoints of synteny clusters are often marked by tRNAs (Dietrich ). This suggests that recombination via tRNAs as the only major source of repetitive elements in the A. gossypii genome resulted in the amplification of tRNA genes in Ashbya. Similarly, genome evolution can be driven by transposon-mediated recombination (Garfinkel 2005; Mieczkowski ). In E. cymbalariae, the primary insertion site of its TY3 transposon is next to tRNA genes, as was described for S. cerevisiae (Chalker and Sandmeyer 1992). This makes it difficult to distinguish between TY-mediated and tRNA-mediated genome evolution in E. cymbalariae.

Genome evolution in pre-WGD species

In A. gossypii, 21 loci contain tandem duplications of two to four genes (Dietrich ). This limited amount of duplication does not allow for large-scale subfunctionalization. Yet, for the tandem duplication of the RHO1 gene, it could be shown that changing a single position in the switch I region allows for a different regulation of these Rho proteins (Köhli ). In comparison, we found only eight of these tandem duplications to be conserved in E. cymbalariae (Table S3A). Several tandem duplicated A. gossypii genes are located at telomeres and are either not present or not duplicated in E. cymbalariae. This suggests species-specific changes and variability at telomeric positions in A. gossypii, which we have not found in E. cymbalariae. We investigated the synteny relationships between the E. cymbalariae genome to both the yeast ancestor and A. gossypii (Figure 5). The E. cymbalariae genome can be mapped to the ancestor with 252 blocks of synteny and to A. gossypii with 229 blocks, with an average block length of 36.8 kb and 40.8 kb, respectively (Table 2). In contrast, the A. gossypii genome was previously mapped to 271 blocks with the yeast ancestor (Gordon ). Half of the E. cymbalariae genome size is represented in 40 blocks in the yeast ancestor and in only 38 blocks in A. gossypii. The largest blocks of synteny map to E. cymbalariae CHR2: 397 kb shared with the yeast ancestor and 340 kb with A. gossypii. There is also a large block of synteny flanking the conserved position of the rDNA repeats on E. cymbalariae CHR4, encompassing 251 kb in the yeast ancestor and 236 kb in A. gossypii (in addition to the rDNA repeats). Conservation of blocks is greater between Eremothecium species at centromeric loci. Yet, the large number of synteny blocks indicates an unexpectedly divergent genome evolution in both Eremothecium species. Once the genomes of other Eremothecium species become available, especially from the branch containing the dimorphic representatives, it may be possible to reconstruct an ancestral genome for the Eremothecium clade. For example, CHR6 of the reconstructed yeast ancestor is distributed to only seven blocks in the E. cymbalariae genome, two each on CHR2, CHR3, and CHR6, and one telomeric locus on CHR7. This allows the recapitulation of the evolution of this ancestral chromosome in E. cymbalariae by inferring only four inversions and translocations (three reciprocal and one telomeric) each.
Figure 5 

Genomic block synteny between the E. cymbalariae genome and A. gossypii and the reconstructed yeast ancestor. The colored blocks indicate regions of the reconstructed ancestral yeast genome (upper row) or the A. gossypii genome (bottom row). Colors correspond to the eight CHRs of the yeast ancestor and to the seven CHRs of A. gossypii, respectively. Scale indicates lengths of the E. cymbalariae chromosomes (bp); the dot corresponds to the centromere region of each chromosome; and the star indicates the rDNA locus. The rDNA locus in A. gossypii is ∼400 kb (Wendland et al., 1999). The additional DNA at the rDNA locus will make CHR4 the largest chromosome in E. cymbalariae.

Table 2 

Number of syntenic blocks of the E. cymbalariae genome shared with the reconstructed ancestor and A. gossypii

E. cymbalariae ChromosomeNumber of Blocks in the Ancestral GenomeNumber of Blocks in the A. gossypii Genome
CHR12623
CHR23838
CHR32428
CHR44238
CHR53835
CHR63222
CHR72922
CHR82323
Total252229
Average block length36.8 kb40.8 kb
Genomic block synteny between the E. cymbalariae genome and A. gossypii and the reconstructed yeast ancestor. The colored blocks indicate regions of the reconstructed ancestral yeast genome (upper row) or the A. gossypii genome (bottom row). Colors correspond to the eight CHRs of the yeast ancestor and to the seven CHRs of A. gossypii, respectively. Scale indicates lengths of the E. cymbalariae chromosomes (bp); the dot corresponds to the centromere region of each chromosome; and the star indicates the rDNA locus. The rDNA locus in A. gossypii is ∼400 kb (Wendland et al., 1999). The additional DNA at the rDNA locus will make CHR4 the largest chromosome in E. cymbalariae.

Comparative genomics reveals species-specific evolutionary changes

Comparison of the E. cymbalariae and A. gossypii gene sets revealed that each species harbors around 150 genes that are absent in the other. Further analysis of these subsets of genes indicated that 86 A. gossypii genes absent in E. cymbalariae have homologs in S. cerevisiae and that 104 E. cymbalariae genes absent in A. gossypii share homologs in either S. cerevisiae or other related yeasts (Figure 1D, Table S4, and Table S5). The remaining genes are species-specific genes that were annotated based on their ORF lengths above cutoff. In E. cymbalariae, these genes contain ORFs from 300 to 450 bp in length. Lack of certain genes in an Eremothecium genome thus can be used to deduce species-specific evolutionary steps. These findings may then spur further functional analyses in either A. gossypii or E. cymbalariae to identify corresponding phenotypes in mutants in which such a gene has been deleted. Three major differences involving the lack of pathways of genes between E. cymbalariae and A. gossypii were found. First, E. cymbalariae harbors a set of eight genes, termed ZMM proteins (, , , , and ), which in S. cerevisiae were shown to facilitate meiotic crossovers (Lynn ). A. gossypii has lost most of these genes and has retained only a homolog. This loss of ZMM family members in A. gossypii is puzzling. Combined with our recent analysis on the pheromone signaling cascade, this observation lets us question the existence of a sexual cycle (particularly one requiring mating and meiosis) in A. gossypii (Wendland ). On the other hand, with E. cymbalariae we now have an Eremothecium model in which we can analyze processes of mating-type switching, the role of MATa/α for cell-type–specific gene expression, the role of pheromone signaling, and meiosis and sporulation. Second, the E. cymbalariae genome does not encode a member of the gene family of α-1,3-mannosyltransferases. This family of five genes is present in both S. cerevisiae and A. gossypii and is required for adding the fourth and fifth mannose residue to a linear chain of O-glycosylated proteins (Romero ; Lussier et al., 1999). Cell-cell adhesion via flocculins in S. cerevisiae requires binding of mannose residues (Goossens and Willaert, ; Bauer ; Verstrepen and Klis 2006). Remarkably, the mycelium of E. cymbalariae and particularly the aerial hyphae show a penetrant lack of cell-cell adhesion, in contrast to the strong adhesion of A. gossypii hyphae. Therefore, E. cymbalariae may be a promising fungal model system to study adhesion, particularly with respect to the role of individual flocculation genes in protein-protein–mediated cell adhesion. Third, in the E. cymbalariae genome we found a lack of genes belonging to the Ehrlich pathway of fusel acids/fusel alcohol production from amino acids. Key genes of this pathway include the transcriptional activator Aro80 and two downstream target genes and driving the first two steps of transamination and decarboxylation of amino acids to produce fusel aldehydes. Conversion of these aldehydes into either fusel acids or fusel alcohols is mediated by ALD and ADH gene families encoding aldehyde dehydrogenases or alcohol dehydrogenases, respectively (Hazelwood ). The , , and genes are not encoded in the E. cymbalariae genome. In addition, the gene, which encodes an alternative decarboxylase, the aldo-keto reductase , and , which encodes an ABC transporter involved in the export of fusel acids, are absent in E. cymbalariae. A. gossypii encodes all of these genes, with the exception of . Fusel alcohol production has an impact on morphogenesis in S. cerevisiae as, for example, isoamyl alcohol, phenylethanol, and tryptophol can induce pseudohyphal growth and stimulate flocculation (Kern ; Chen and Fink, 2006,). Deletion of , , or renders S. cerevisiae cells defective in haploid invasive growth and diploid pseudohyphal formation. These compounds, therefore, can act as quorum-sensing molecules. Similar systems are utilized in other yeast species. In Candida albicans, for example, farnesol leads to the inhibition of filamentation at high cell densities (Hornby ). Analysis of the flavor profiles of A. gossypii and E. cymbalariae are currently underway. A. gossypii produces far more aromatic compounds than E. cymbalariae, evident from a very fruity flavor. A. gossypii may produce these compounds to attract insects as part of its dispersal strategy. E. cymbalariae is rather unimpressive in terms of flavor production. Interestingly, lack of Ehrlich pathway genes can also be observed in Kluyveromyces waltii, which lacks, for example, the transcription factor according to the Yeast Gene Order Browser information (Byrne and Wolfe 2005).

Perspectives

Our study demonstrates the power of comparative genomics to elucidate the evolutionary history of closely related species. The genome of E. cymbalariae harbors several features in common with the reconstructed yeast ancestor that have been lost in A. gossypii. In particular, we found the presence of eight chromosomes, similar gene densities, and an overall low GC content. Furthermore, in E. cymbalariae as in other yeasts, a mating-type locus and a cassette organization including silent cassettes at both telomeres can be found on one dedicated chromosome. In addition, we found a TY3 transposon and ZMM family genes required for meiotic crossovers in E. cymbalariae, which are absent from A. gossypii. With these characteristics, E. cymbalariae marks a missing link in the evolution from a yeast ancestor to A. gossypii. Several Eremothecium-specific traits were discovered in addition to the filamentous growth mode, including the telomeric repeats and conserved flanks at mating-type loci. We speculate that the E. cymbalariae–specific loss of α-1,3-mannosyltransferases and of key Ehrlich pathway genes may contribute to the lack of cell-cell adhesion observed in this fungal species. On the other hand, specific evolutionary steps in A. gossypii, which have yet to be uncovered, have turned this species into an oversporulator in comparison with E. cymbalariae and into an overproducer of riboflavin. Both features are linked, as riboflavin production is increased at the end of the growth phase concomitantly with sporulation (Stahmann ). Comparative genomics is a very powerful tool to reveal specific features of closely related species not only in, for example, the Saccharomyces complex but also in other systems as demonstrated for the Ustilago maydis/Sporisorium reilianum species pair (Schirawski ).
  53 in total

1.  Physiological consequence of disruption of the VMA1 gene in the riboflavin overproducer Ashbya gossypii.

Authors:  C Förster; M A Santos; S Ruffert; R Krämer; J L Revuelta
Journal:  J Biol Chem       Date:  1999-04-02       Impact factor: 5.157

2.  Quorum sensing in the dimorphic fungus Candida albicans is mediated by farnesol.

Authors:  J M Hornby; E C Jensen; A D Lisec; J J Tasto; B Jahnke; R Shoemaker; P Dussault; K W Nickerson
Journal:  Appl Environ Microbiol       Date:  2001-07       Impact factor: 4.792

3.  Pathogenicity determinants in smut fungi revealed by genome comparison.

Authors:  Jan Schirawski; Gertrud Mannhaupt; Karin Münch; Thomas Brefort; Kerstin Schipper; Gunther Doehlemann; Maurizio Di Stasio; Nicole Rössel; Artemio Mendoza-Mendoza; Doris Pester; Olaf Müller; Britta Winterberg; Elmar Meyer; Hassan Ghareeb; Theresa Wollenberg; Martin Münsterkötter; Philip Wong; Mathias Walter; Eva Stukenbrock; Ulrich Güldener; Regine Kahmann
Journal:  Science       Date:  2010-12-10       Impact factor: 47.728

4.  Compact organization of rRNA genes in the filamentous fungus Ashbya gossypii.

Authors:  J Wendland; R Pöhlmann; F Dietrich; S Steiner; C Mohr; P Philippsen
Journal:  Curr Genet       Date:  1999-07       Impact factor: 3.886

5.  Genome-wide bioinformatic and molecular analysis of introns in Saccharomyces cerevisiae.

Authors:  M Spingola; L Grate; D Haussler; M Ares
Journal:  RNA       Date:  1999-02       Impact factor: 4.942

Review 6.  Life with 6000 genes.

Authors:  A Goffeau; B G Barrell; H Bussey; R W Davis; B Dujon; H Feldmann; F Galibert; J D Hoheisel; C Jacq; M Johnston; E J Louis; H W Mewes; Y Murakami; P Philippsen; H Tettelin; S G Oliver
Journal:  Science       Date:  1996-10-25       Impact factor: 47.728

7.  The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome.

Authors:  Fred S Dietrich; Sylvia Voegeli; Sophie Brachat; Anita Lerch; Krista Gates; Sabine Steiner; Christine Mohr; Rainer Pöhlmann; Philippe Luedi; Sangdun Choi; Rod A Wing; Albert Flavier; Thomas D Gaffney; Peter Philippsen
Journal:  Science       Date:  2004-03-04       Impact factor: 47.728

Review 8.  The KTR and MNN1 mannosyltransferase families of Saccharomyces cerevisiae.

Authors:  M Lussier; A M Sdicu; H Bussey
Journal:  Biochim Biophys Acta       Date:  1999-01-06

Review 9.  Biased gene conversion and the evolution of mammalian genomic landscapes.

Authors:  Laurent Duret; Nicolas Galtier
Journal:  Annu Rev Genomics Hum Genet       Date:  2009       Impact factor: 8.929

10.  Comparative genomics of protoploid Saccharomycetaceae.

Authors:  Jean-Luc Souciet; Bernard Dujon; Claude Gaillardin; Mark Johnston; Philippe V Baret; Paul Cliften; David J Sherman; Jean Weissenbach; Eric Westhof; Patrick Wincker; Claire Jubin; Julie Poulain; Valérie Barbe; Béatrice Ségurens; François Artiguenave; Véronique Anthouard; Benoit Vacherie; Marie-Eve Val; Robert S Fulton; Patrick Minx; Richard Wilson; Pascal Durrens; Géraldine Jean; Christian Marck; Tiphaine Martin; Macha Nikolski; Thomas Rolland; Marie-Line Seret; Serge Casarégola; Laurence Despons; Cécile Fairhead; Gilles Fischer; Ingrid Lafontaine; Véronique Leh; Marc Lemaire; Jacky de Montigny; Cécile Neuvéglise; Agnès Thierry; Isabelle Blanc-Lenfle; Claudine Bleykasten; Julie Diffels; Emilie Fritsch; Lionel Frangeul; Adrien Goëffon; Nicolas Jauniaux; Rym Kachouri-Lafond; Célia Payen; Serge Potier; Lenka Pribylova; Christophe Ozanne; Guy-Franck Richard; Christine Sacerdot; Marie-Laure Straub; Emmanuel Talla
Journal:  Genome Res       Date:  2009-06-12       Impact factor: 9.043

View more
  20 in total

1.  Molecular determinants of sporulation in Ashbya gossypii.

Authors:  Lisa Wasserstrom; Klaus B Lengeler; Andrea Walther; Jürgen Wendland
Journal:  Genetics       Date:  2013-07-05       Impact factor: 4.562

2.  Complete genome sequences from three genetically distinct strains reveal high intraspecies genetic diversity in the microsporidian Encephalitozoon cuniculi.

Authors:  Jean-François Pombert; Jinshan Xu; David R Smith; David Heiman; Sarah Young; Christina A Cuomo; Louis M Weiss; Patrick J Keeling
Journal:  Eukaryot Cell       Date:  2013-01-04

Review 3.  Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina).

Authors:  Bernard A Dujon; Edward J Louis
Journal:  Genetics       Date:  2017-06       Impact factor: 4.562

4.  Developmental Growth Control Exerted via the Protein A Kinase Tpk2 in Ashbya gossypii.

Authors:  Lisa Wasserstrom; Klaus Lengeler; Andrea Walther; Jürgen Wendland
Journal:  Eukaryot Cell       Date:  2015-04-10

Review 5.  Genomics and the making of yeast biodiversity.

Authors:  Chris Todd Hittinger; Antonis Rokas; Feng-Yan Bai; Teun Boekhout; Paula Gonçalves; Thomas W Jeffries; Jacek Kominek; Marc-André Lachance; Diego Libkind; Carlos A Rosa; José Paulo Sampaio; Cletus P Kurtzman
Journal:  Curr Opin Genet Dev       Date:  2015-11-30       Impact factor: 5.578

6.  A case of convergent-gene interference in the budding yeast knockout library causing chromosome instability.

Authors:  Molly R Gordon; Jin Zhu; Victoria Qu; Rong Li
Journal:  G3 (Bethesda)       Date:  2021-05-07       Impact factor: 3.154

7.  Evolutionary mobility of the ribosomal DNA array in yeasts.

Authors:  Estelle Proux-Wéra; Kevin P Byrne; Kenneth H Wolfe
Journal:  Genome Biol Evol       Date:  2013       Impact factor: 3.416

Review 8.  Unisexual reproduction.

Authors:  Kevin C Roach; Marianna Feretzaki; Sheng Sun; Joseph Heitman
Journal:  Adv Genet       Date:  2014       Impact factor: 3.880

9.  Genomes of Ashbya fungi isolated from insects reveal four mating-type loci, numerous translocations, lack of transposons, and distinct gene duplications.

Authors:  Fred S Dietrich; Sylvia Voegeli; Sidney Kuo; Peter Philippsen
Journal:  G3 (Bethesda)       Date:  2013-08-07       Impact factor: 3.154

10.  Genome Sequence of the Native Apiculate Wine Yeast Hanseniaspora vineae T02/19AF.

Authors:  Facundo M Giorello; Luisa Berná; Gonzalo Greif; Laura Camesasca; Valentina Salzman; Karina Medina; Carlos Robello; Carina Gaggero; Pablo S Aguilar; Francisco Carrau
Journal:  Genome Announc       Date:  2014-05-29
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.