Literature DB >> 23749448

Genomes of Ashbya fungi isolated from insects reveal four mating-type loci, numerous translocations, lack of transposons, and distinct gene duplications.

Fred S Dietrich1, Sylvia Voegeli, Sidney Kuo, Peter Philippsen.   

Abstract

The filamentous fungus Ashbya gossypii is a cotton pathogen transmitted by insects. It is readily grown and manipulated in the laboratory and is commercially exploited as a natural overproducer of vitamin B2. Our previous genome analysis of A. gossypii isolate ATCC10895, collected in Trinidad nearly 100 years ago, revealed extensive synteny with the Saccharomyces cerevisiae genome, leading us to use it as a model organism to understand the evolution of filamentous growth. To further develop Ashbya as a model system, we have investigated the ecological niche of A. gossypii and isolated additional strains and a sibling species, both useful in comparative analysis. We isolated fungi morphologically similar to A. gossypii from different plant-feeding insects of the suborder Heteroptera, generated a phylogenetic tree based on rDNA-ITS sequences, and performed high coverage short read sequencing with one A. gossypii isolate from Florida, a new species, Ashbya aceri, isolated in North Carolina, and a genetically marked derivative of ATCC10895 intensively used for functional studies. In contrast to S. cerevisiae, all strains carry four not three mating type loci, adding a new puzzle in the evolution of Ashbya species. Another surprise was the genome identity of 99.9% between the Florida strain and ATCC10895, isolated in Trinidad. The A. aceri and A. gossypii genomes show conserved gene orders rearranged by eight translocations, 90% overall sequence identity, and fewer tandem duplications in the A. aceri genome. Both species lack transposable elements. Finally, our work identifies plant-feeding insects of the suborder Heteroptera as the most likely natural reservoir of Ashbya, and that infection of cotton and other plants may be incidental to the growth of the fungus in its insect host.

Entities:  

Keywords:  fungal ecology; intron evolution; mating type; tandem duplications

Mesh:

Substances:

Year:  2013        PMID: 23749448      PMCID: PMC3737163          DOI: 10.1534/g3.112.002881

Source DB:  PubMed          Journal:  G3 (Bethesda)        ISSN: 2160-1836            Impact factor:   3.154


The filamentous fungus A. gossypii was first isolated from diseased cotton bolls and described as a pathogen of cotton nearly 100 years ago by Ashby (Ashby 1916) and Nowell (Nowell 1915, 1916). They referred to this organism as a member of the “fungus of stigmatomycosis” (Ashby and Nowell 1926) and also realized, as later verified (Pearson 1934; Williams 1934), that the disease of cotton was always associated with specific insects, the cotton stainers, members of the suborder Heteroptera. A. gossypii played a role in the discovery of biotin (Farries and Bell 1930), and the elucidation of the riboflavin biosynthetic pathway (Bacher ). The ability of A. gossypii to overproduce riboflavin is exploited commercially for the production of this vitamin (Stahmann ). The interest in developing A. gossypii into a genetically tractable system and to conduct genomic sequencing began when synteny with S. cerevisiae was discovered (Altmann-Jöhl and Philippsen 1996) and when it was shown that, unlike other filamentous fungi, homologous recombination was the rule, not the exception (Steiner ). The genome sequence of the A. gossypii strain (ATCC10895), the source for the development of riboflavin overproducers and for biological investigations (Philippsen ; Wendland and Walther 2005), revealed greater than 90% synteny of the annotated protein-coding genes with the gene set of S. cerevisiae (Dietrich ). The A. gossypii genome sequence has been used in numerous comparative genome studies (Fisk ; Gordon ; Seret ; Souciet ) and for experimental studies aimed at understanding the evolution of budding yeast and filamentous fungus life styles starting from the same ancestral set of genes (Wendland and Philippsen 2001; Wendland 2003; Philippsen ; Gladfelter ; Knechtle ; Schmitz ; Koehli ; DeMay ; Kaufmann and Philippsen 2009; Grava and Philippsen 2010; Grunler ; Lang ; Nair ; Finlayson ; Jorde ; Gibeaux ). The genome sequence is also of commercial interest, being used to identify ways to increase riboflavin production in A. gossypii (Kato and Park 2012). Until the recent genomic sequencing of Eremothecium cymbalariae, A. gossypii was the only sequenced fungal genome of a species related to budding yeast growing in a strictly filamentous mode with multinucleated and multibranching hyphae (Schmitz and Philippsen 2011; Wendland and Walther 2011). To find out whether this combination, budding yeast-like genome and growth as multinucleated hyphae, is rare, we aimed to analyze additional strains and species of Ashbya isolated from nature. For example, by comparing Ashbya genomes, we wanted to determine whether important tandem gene duplications and gene losses described for A. gossypii ATCC10895 (Koehli ; Kaufmann and Philippsen 2009) are specific properties of that strain or are conserved in other Ashbya isolates. It was also important to analyze the mating type loci in novel isolates, as the ATCC10895 genome only carries MATa copies and lacks MATα information. Finally, we expected to define the environmental niche in which these organisms are found.

Materials and Methods

Strains, media, and polymerase chain reaction (PCR) primers

More than 30 new wild A. gossypii strains were isolated from large milkweed bugs (Oncopeltus fasciatus) feeding on oleander (Nerium oleander) or on common milkweed (Asclepias syriaca). Six A. aceri strains were obtained from the eastern boxelder bug (Boisea trivittata) collected from boxelder trees (Acer negundo) and maple trees (Acer sp.). In addition, three Ashbya strains were isolated from the western boxelder bug (Boisea rubrolineata) feeding on maple trees (Acer sp.) and seven Ashbya strains from the red-shouldered bug (Jadera hematoloma) feeding on golden raintrees (Koelreuteria paniculata). Fungal isolation was performed by crushing the juvenile or adult insects on yeast extract peptone dextrose (Sherman ) or Ashbya full media (Altmann-Jöhl and Philippsen 1996) with ampicillin (100 µg/mL) and tetracycline (100 µg/mL) added to limit bacterial growth. A range of filamentous fungi and yeasts were growing on the plates, but in most cases it was possible to identify colonies resembling those of A. gossypii strain ATCC10895. Mycelium from these colonies was restreaked to pure culture and stored at −80°. DNA isolations were performed using a standard yeast protocol (Sherman ) except that the fungi were collected by filtration instead of centrifugation. Internal transcribed sequence (ITS) sequences were generated using the ITS1 and ITS4 primers (ITS1: 5′TCCGTAGGTGAACCTTGCGG3′; ITS4: 5′TCCTCCGCTTATTGATATGC3′). Ashbya spp. were the only fungi consistently isolated from these insects. The A. gossypii strain Agleu2Δthr4Δ was obtained by targeted deletion of the LEU2 and THR4 genes of A. gossypii strain ATCC10895 and screening for subsequent excision of the selectable marker. Thus, the deletions are unmarked and contain no foreign DNA (Altmann-Jöhl and Philippsen 1996).

Sequencing strategy

Genomic sequencing was performed using genomic DNA prepared by standard methods (Sherman ) using the short read Solexa sequencing technology from Illumina (www.illumina.com) (Bentley 2006). Sequences were generated at GATC (www.gatc-biotech.com) resulting in 36 million 36 base reads for each of the two A. gossypii genomes, and at Duke University in the group of Kevin Shiana resulting in 15 million reads for the Ashbya aceri genome. An additional 29 million pairs of 58 base long Illumina Solexa mate pair sequences were generated at GATC for insect isolate 1 and 31 million pairs of 58 base long mate pair sequences for A. aceri. The 36 base pair sequence reads were assembled with the use of a standard heuristic hash-based algorithm coded in C and compiled under gcc 4.2 (http://gcc.gnu.org/). To summarize in brief, the sequence and quality score were compressed to 2 bits for the sequence, 2 bits for the quality score. Sequences that were identical or differed only at low quality bases were combined. Reads that overlapped by 35 of 36 bases were then combined to create initial contigs. Branch points were identified as divergence of multiple high quality bases. The initial contigs were then combined by sequentially joining of contigs of decreasing overlap down to 20 bases while blocking extension at identified branch points. Once contig assembly was completed, the depth of coverage was calculated for each contig and a scaffold was created. It should be noted that this algorithm was successful in assembling the single read 36 base pair reads into less than 800 contigs for each strain primarily because A. gossypii has no transposable elements, has a GC content of close to 50%, and has very few repetitive sequences. Contigs and scaffolds were then assembled by alignment to the original A. gossypii sequence (Dietrich ) using FASTA (Lipman and Pearson 1985), Basic Local Alignment Search Tool, i.e., BLAST (Altschul ), and LAGAN (Brudno ). When ambiguities occurred, the original chromatograms and pairing information from that project was investigated. Most valuable were the 80- to 100-kb bacterial artificial chromosome (BAC) end sequences from the earlier project in scaffolding the 36 base pair derived contigs. Multiple ambiguities were present in the assemblies based solely on the 36 base reads, which were addressed by using the pairing information from the 58 base mate pair reads. Additional assemblies were carried out using maq (Li ) and velvet (Zerbino and Birney 2008); contigs from these assemblies were aligned to the assembly described previously and each discrepancy was individually investigated. Further confirmation of the sequence was obtained by aligning sequence reads back to the completed sequence using BWA (Li and Durbin 2009) and SAMtools (Li ) and regions of discrepancy were investigated. Investigation of ambiguities in the assemblies was carried out using a set of scripts to carry out exhaustive local alignments. Phylogenetic analysis was carried out using clustalx (Thompson ).

Annotation of the assembled genomes

Annotation was performed with standard tools, including BLAST (Altschul ), FASTA (Lipman and Pearson 1985), C, Perl, BioPerl (Stajich ), EMBOSS (Rice ), weblogo (Crooks ), TBl2asn, and Sequin (http://www.ncbi.nlm.nih.gov/Sequin). All gene names were maintained from the original annotation, with the exception that ACR186W is the syntenic ortholog of YJR080C (AIM24) and ACR185W is the syntenic ortholog of YJR082C (EAF6). The names were erroneously reversed in the original annotation. New open reading frames (ORFs) were named by the upstream ORF adding an A or B after the systematic name, e.g., ADL139C-A. All ORFs from the A. gossypii insect isolate 1 from Florida were named like the ORFs from strain ATCC10895 but adding an F before the systematic name, e.g., FABL001 for the first gene on the left arm of chromosome 2. All ORFs from the A aceri insect isolate 38 were also named following the A. gossypii nomenclature of the reference strain ATCC10895 irrespective of the translocations but adding an “Aaceri” prior to the systematic name.

Results

Fungi associated with insects belonging to the subfamily Heteroptera

We hypothesized that Ashbya-like fungi may be associated with insects related to the cotton stainer, which belongs to the Heteroptera subfamily. Indeed, Ashbya strains could be isolated from adults and juveniles, but not eggs, from large milkweed bugs found feeding on oleander in Florida, the U.S. Virgin Islands, and North Carolina and on common milkweed in North Carolina and Virginia (Figure 1). All fungal isolates from these insect species grew as multinucleated lateral branching and tip-splitting hyphae, produced needle-shaped spores, and appeared to be riboflavin overproducers based on the characteristic diffusible yellow coloration of colonies typical for A. gossypii (Figure 2). All tested isolates had identical ITS1 and ITS2 sequences to that of A. gossypii ATCC 10895, the reference strain. The new A. gossypii strain (insect isolate 1), whose genome sequence is described below, was isolated from a large milkweed bug collected on oleander near Miami, Florida, in August 2005.
Figure 1

Fungi most closely related to A. gossypii. Neighbor joining phylogenetic tree of the known and newly isolated Nematosporaceae based on ITS sequences, along with Kluyveromyces lactis, and with S. cerevisiae as an outgroup. Ashbya sp. RS isolated from red-shouldered bugs and Ashbya sp. western boxelder (WBE) isolated from western boxelder bugs are as-yet uncharacterized beyond ITS sequencing. A. aceri is a fungus isolated from an eastern box elder bug shown in the insert. Its complete genome sequence was determined during this work. A. gossypii Florida isolate was isolated from a large milkweed bug shown in the insert. Its complete genome sequence also was determined during this work. The white arrows in the insect images indicate the probosci through which these insects feed, and through which the fungus is transmitted between the plant and the insect. A. gossypii has been described before to be spread by the cotton stainer (Ashby and Nowell 1926; Frazer 1944). A. gossypii ATCC10895 refers to the reference strain for all Ashbya species the genome of which was resequenced for the comparative analyses presented in this study This A. gossypii reference strain from the American Type Culture Collection was isolated from diseased cotton (Ashby 1916) and most likely originated from the US Agricultural Research Service strain collection (NRRL Y-1056), where it was obtained from William J. Robbins, who reported obtaining it from the Centraalbureau Voor Schimmelcultures (CBS) (Robbins and Schmidt 1939), where A. gossypii had been deposited by S. F. Ashby in 1926 (CBS 109.26), and possibly the same strain was deposited by Alexandre Guilliermond in 1928 (CBS 117.28). Holleya sinecada has been reported to be spread by the False Chinch bug (Burgess and McKenzie 1991), and Nematospora coryli by the Green stink bug (Clarke and Wilde 1970). Specific insect species have not been associated with Eremothecium cymbalariae or Eremothecium ashbyii. It has been suggested that all of the fungi of the family Nematosporaceae are spread by heteropterous insects (Batra 1973). GenBank accession numbers for the ITS sequences of the other Nematosporaceae are U09326.1 for Nematospora coryli, FJ422506.1 for Holleya sinecauda, AY046219.1 for Eremothecium cymbalariae, AB478315.1 for Eremothecium ashbyii, AJ229069.1 for the yeast Kluyveromyces lactis, and NC_001144 for Saccharomyces cerevisiae. The available ITS sequence data cannot well resolve the structure of the tree at the base of the Nematosporaceae clade.

Figure 2

Growth of A. gossypii insect isolate 1 strain and A. aceri (insect isolate 38). (A) Ascus from insect isolate 1. (B) Ascus from insect isolate 38. (C) Hyphal tip branching of insect isolate 1. (D) Hyphal tip branching of insect isolate 38. (E) Hyphal mat formed by insect isolate 1. (F) Hyphal mat formed by insect isolate 38. No aerial mycelial growth was observed.

Fungi most closely related to A. gossypii. Neighbor joining phylogenetic tree of the known and newly isolated Nematosporaceae based on ITS sequences, along with Kluyveromyces lactis, and with S. cerevisiae as an outgroup. Ashbya sp. RS isolated from red-shouldered bugs and Ashbya sp. western boxelder (WBE) isolated from western boxelder bugs are as-yet uncharacterized beyond ITS sequencing. A. aceri is a fungus isolated from an eastern box elder bug shown in the insert. Its complete genome sequence was determined during this work. A. gossypii Florida isolate was isolated from a large milkweed bug shown in the insert. Its complete genome sequence also was determined during this work. The white arrows in the insect images indicate the probosci through which these insects feed, and through which the fungus is transmitted between the plant and the insect. A. gossypii has been described before to be spread by the cotton stainer (Ashby and Nowell 1926; Frazer 1944). A. gossypii ATCC10895 refers to the reference strain for all Ashbya species the genome of which was resequenced for the comparative analyses presented in this study This A. gossypii reference strain from the American Type Culture Collection was isolated from diseased cotton (Ashby 1916) and most likely originated from the US Agricultural Research Service strain collection (NRRL Y-1056), where it was obtained from William J. Robbins, who reported obtaining it from the Centraalbureau Voor Schimmelcultures (CBS) (Robbins and Schmidt 1939), where A. gossypii had been deposited by S. F. Ashby in 1926 (CBS 109.26), and possibly the same strain was deposited by Alexandre Guilliermond in 1928 (CBS 117.28). Holleya sinecada has been reported to be spread by the False Chinch bug (Burgess and McKenzie 1991), and Nematospora coryli by the Green stink bug (Clarke and Wilde 1970). Specific insect species have not been associated with Eremothecium cymbalariae or Eremothecium ashbyii. It has been suggested that all of the fungi of the family Nematosporaceae are spread by heteropterous insects (Batra 1973). GenBank accession numbers for the ITS sequences of the other Nematosporaceae are U09326.1 for Nematospora coryli, FJ422506.1 for Holleya sinecauda, AY046219.1 for Eremothecium cymbalariae, AB478315.1 for Eremothecium ashbyii, AJ229069.1 for the yeast Kluyveromyces lactis, and NC_001144 for Saccharomyces cerevisiae. The available ITS sequence data cannot well resolve the structure of the tree at the base of the Nematosporaceae clade. Growth of A. gossypii insect isolate 1 strain and A. aceri (insect isolate 38). (A) Ascus from insect isolate 1. (B) Ascus from insect isolate 38. (C) Hyphal tip branching of insect isolate 1. (D) Hyphal tip branching of insect isolate 38. (E) Hyphal mat formed by insect isolate 1. (F) Hyphal mat formed by insect isolate 38. No aerial mycelial growth was observed. After the isolation of new strains of A. gossypii from large milkweed bugs, additional Heteroptera species were examined. Eastern boxelder bugs were collected in North Carolina, Wisconsin, and New York and tested for the presence of this fungus. In each case, including in over-wintering bugs from New York, a fungus could be isolated from these insects that by appearances is quite similar to A. gossypii, but colonies grown for a week on yeast extract peptone dextrose or Ashbya full media plates have a white-to-cream color and no sign of the yellow color that is ubiquitous among the A. gossypii isolates (Figure 2F). On the basis of the ITS sequence, these organisms appear closely related to A. gossypii but most likely represent a new Ashbya species (Figure 1). The Ashbya strain associated with an eastern boxelder bug, collected in North Carolina from a boxelder tree in August 2007 (insect isolate 38), was selected for genome sequencing because CHEF gel analysis of its karyotype had revealed different chromosome sizes but a similar number of chromosomes to that of A. gossypii (Supporting Information, Figure S1). This isolate is here named Ashbya aceri after the genus name Acer of the boxelder and maple trees on which the insects harboring this fungus feed. Ashbya-like fungi could also be isolated from western boxelder bugs feeding on maple trees in California and New Mexico and from red-shouldered bugs feeding on golden rain tree in North Carolina. ITS sequences from these fungi are similar but not identical to A. gossypii ITS sequences. For one isolate each, a genome analysis is in progress. All ITS sequences determined during this screening study are different from the known ITS sequences of the other Nematosporaceae species shown in the phylogenetic tree of Figure 1.

Re-annotation of A. gossypii ATCC10895 based on sequencing of Agleu2Δthr4Δ

To perform a reliable comparative analysis with the newly sequenced genomes, we at first had to correct sequence errors and fill gaps in the genome of the A. gossypii reference strain ATCC10895. The original sequences were generated using dideoxy shotgun sequencing and clone walking of plasmid and BAC clones using paired-end information for assembly purposes, and sequencing of PCR products to close gaps. The overall fourfold sequence coverage of the 9 MB genome gave an average sequence accuracy of 99.8% (Dietrich ). To establish a highly accurate sequence we decided not to resequence the ATCC10895 genome but the genome of the host strain for functional analyses, derived from the ATCC10895 strain by targeted gene deletions of AgLEU2 and AgTHR4 followed by excision of the selection markers (Altmann-Jöhl and Philippsen 1996). Using the high throughput Illumina sequencing technology (Bentley 2006) 17,336,954 sequences of 36 bases in length were generated. The sequence assembly of this 35-fold coverage short read sequence data were consistent with the gene order previously reported, and the analysis suggests that the finished sequences (with the AgLEU2 and AgTHR4 sequences added) represent the entire genome of A. gossypii strain ATCC10895. Combining the short read sequence data with the original A. gossypii genome sequence resulted in identification and correction of more than 10,000 sequence errors. These included 8301 substitutions, 668 one- to five-base deletions, and 369 one- to five-base insertions, where most of the insertion/deletion errors were of a single base (Figure S2). The sequence across the three previous gaps has been completed, although in one case, that of a poly-C stretch in the upstream noncoding region of AFL160C, the sequence quality is low. The sequence has been completed to the telomere terminal repeats for all 14 chromosome ends, reaching the terminal 24-bp telomeric repeat, TGAGAGACCCATACACCACACCGC. A complete re-annotation of the genome, taking advantage of both the sequence corrections and the genomic sequences of additional species published since the initial release of the A. gossypii genome has resulted in an updated set of the seven A. gossypii chromosomes (GenBank accession numbers AE016814 through AE016820). For the mitochondrial genome, no errors were detected and its annotation remained unchanged (AE016821). The reannotation added 31 protein-coding genes, most notably a fourth copy of MATa that was identified at the right subtelomeric region of chromosome VI discussed below. In addition, 3 noncoding RNA genes, 15 introns, and 1 transfer RNA (tRNA) gene (Table 1, Table 2, and Table 3) were added. A total of 15 protein coding genes, 3 tRNA genes, and 1 noncoding RNA gene were deemed incorrect and removed. The coding capacity of the reference strain now encompasses 4776 proteins, 221 tRNAs, 83 small RNAs, and 35 copies of rDNA. The reannotation also corrected the amino acid sequence of proteins at 1165 positions, and it increased or decreased the length of 152 open reading frames, primarily as a result of changes at their 5′ end. There are two defective genes: AFR753C contains multiple stop codons and is a syntenic homolog of S. cerevisiae YNL246W (VPS75); the other is an apparently defective copy of a leucine tRNA. Reannotation also identified eight genes that are apparently translated across frameshifts. These genes include homologs of four genes translated across frameshifts in S. cerevisiae (ADL016C − EST3, ACR130W − ABP140, AGL265W − OAZ1, and ABR148CA − YJR112W-A), and four genes additional genes (ACR287W − ATS1, ADR251W − CIN4, AGR057C IOC2, and AFR597W). The AFR597W gene appears to be a case of −1 frameshifting; the other seven are +1 frameshifting. AFR597W has no homolog in S. cerevisiae but is similar to S. kluyveri SAKL0H03652g.
Table 1

Genes added to the annotation of A. gossypii strain ATCC10895

Location Added:FeaturePositionStrandA.g. ORF NameS.c.1° HomologS.c.2° HomologS.c.1° Homolog Common NameS.c.2° Homolog Common Name
Chr1CDS189767..189973+AAL088W-ANOHBY121
Chr2CDS2047..2991+ABL211WNOHBY219
Chr2ncRNA286717..286792AgSNR86SNR86
Chr2ncRNA404973..405057+AgSNR87SNR87
Chr25′UTR458552..4586945′ UTR intron
Chr2CDS862752..863330+ABR250WNOHBY220
Chr2CDS867475..867642ABR251CNOHBY221
Chr3CDS222051..222212+ACL074W-ANOHBY335
Chr3CDS471357..471584+ACR063W-AYIL102C-A
Chr4CDS10088..10672ADL397C-BNOHBY454
Chr4CDS10088..10672ADL397C-BNOHBY454
Chr4CDS11914..12576ADL397C-ANOHBY453
Chr4CDS11914..12576ADL397C-ANOHBY453
Chr4CDS83599..84255, 84309..84314ADL356C-ANOHBY452
Chr45′UTR153033..153181+5′ UTR intron
Chr4CDS240411..241580+ADL265W-AYOR099WKTR1
Chr4CDS430981..431586ADL148CNOHBY450
Chr4CDS434768..435013+ADL147W-AYGR236CSPG1
Chr45′UTR472058..4725605′ UTR intron
Chr4CDS593768..594280ADL052C-ANOHBY451
Chr4CDS712125..712700+ADR004WNOHBY422
Chr45′UTR877761..878116+5′ UTR intron
Chr4CDS921189..921761+ADR121W-ANOHBY455
Chr5ncRNA22986..23002AgSNR50SNR50
Chr5CDS98045..98974+AEL289W-AYKR005C
Chr55′UTR318815..318910+5′ UTR intron
Chr5CDS471962..472540AEL083C-ANOHBY534
Chr5CDS563288..565171+AEL037WNOHBY503
Chr55′UTR733654..733809+5′ UTR intron
Chr55′UTR800547..8006845′ UTR intron
Chr5CDS939696..941048AER160C-ANOHBY536
Chr5CDS1017648..1018565+AER204W-ANOHBY535
Chr55′UTR1105232..1105307+5′ UTR intron
Chr5CDS1132015..1133691AER270C-ANOHBY533
Chr55′UTR1325900..13260765′ UTR intron
Chr6CDS412760..413410AFL013CNOHBY671
Chr65′UTR790825..790986+5′ UTR intron
Chr65′UTR791737..791787+5′ UTR intron
Chr6tRNA1251500..1251538, 1251548..1251583+tRNA-TyrtRNA-Tyr
Chr6CDS1251695..1252657+AFR451W-AYDL209CCWC2
Chr65′UTR1300412..13006215′ UTR intron
Chr6CDS1802735..1803337+AFR742WNOHBY668
Chr75′UTR181129..1812505′ UTR intron
Chr7CDS573775..574320+AGL073W-CYMR073CIRC21
Chr7CDS574575..575699AGL073C-AYKL032CYMR072WIXR1ABF2
Chr7CDS575980..577428AGL073C-BNOHBY747
Chr7CDS619742..619921,619973..620005AGL048CYPR010C-A
Chr7CDS673624..674040+AGL024W-ANOHBY748
Chr75′UTR945704..9458295′ UTR intron
Chr7CDS1291412..1292176AGR294C-ANOHBY749
Chr75′UTR1426879..1427068+5′ UTR intron

ORF, open reading frame; CDS, coding sequence; ncRNA, noncoding RNA; UTR, untranslated region; tRNA, transfer RNA.

Table 2

Genes removed from the annotation of A. gossypii strain ATCC10895

Location Deleted:FeaturePositionStrandA.g. ORF NameS.c.1° HomologS.c.2° HomologS.c.1° Homolog Common NameS.c.2° Homolog Common Name
Chr2snRNA286517..286773+AgSNR81SNR81
Chr3CDS564351..564956+ACR121WNOHBY323
Chr3CDS711557..712282ACR208CNOHBY331
Chr4CDS114447..114788ADL337C-AYBR108WX
Chr4CDS430731..431204+ADL148WNOHBY411
Chr4tRNA683817..683888tRNA-SectRNA-Sec
Chr4CDS712052..712354ADR004CNOHBY422
Chr4CDS937410..938060+ADR129WNOHBY428
Chr4CDS1380467..1380700+ADR376WNOHBY446
Chr5tRNA102468..102503,102525..102562tRNA-GlntRNA-Gln
Chr5tRNA103053..103090,103112..103147+tRNA-GlntRNA-Gln
Chr5CDS564134..565534AEL037CNOHBY503
Chr6CDS411639..412373+AFL013WNOHBY602
Chr6CDS1120279..1121118+AFR379WNOHBY639
Chr6CDS1799446..1800129AFR742CNOHBY668
Chr7CDS616255..616749+AGL048WNOHBY705
Chr7CDS913067..913483+AGR094WNOHBY739
Chr7CDS944867..945574+AGR109WNOHBY740
Chr7CDS1308521..1309006AGR307CNOHBY745

ORF, open reading frame; snRNA, small nuclear RNA; CDS, coding sequence; ncRNA, noncoding RNA; tRNA, transfer RNA.

Table 3

Genes annotations modified for A. gossypii strain ATCC10895

Location Change of StatusFeaturePositionStrandA.g. ORF NameS.c.1° HomologS.c.2° HomologS.c.1° Homolog Common NameS.c.2° Homolog Common Name
Former
 Chr1CDS548298..548819+AAR114WNOHBY113
 Chr1CDS637960..638250AAR163CNOHBY116
 Chr2CDS670947..671588ABR143CYGR272C
 Chr3CDS670703..672574+ACR185WYJR080CFMP26
 Chr3CDS670809..671105ACR186WYJR082CEAF6
 Chr4CDS136074..138218ADL318CYBR098WMMS4
 Chr4CDS652348..653358+ADL027WYAL018C
 Chr4tRNA681277..681348tRNA-AsntRNA-Asn
 Chr4tRNA683817..683888tRNA-SectRNA-Sec
 Chr4CDS1266115..1267167+ADR318WNOHBY438
 Chr4tRNA1280568..1280617, 1280766..1280803pseudo tRNA-LeutRNA-OTHER
 Chr5CDS566187..566612+AEL036WNOHBY502
 Chr5CDS756469..757149+AER066WNOHBY513
 Chr7CDS104690..104863+AGL322WYBL039W-AYBL039W-B
Current
 Chr1CDS548273..548794+AAR114WYLR224W
 Chr1CDS637934..638224AAR163CYPL187WYGL089CMFΑ1MFΑ2
 Chr2CDS670766..671506ABR143CYGR271C-AEFG1
 Chr3CDS670815..671111+ACR186WYJR080CAIM24
 Chr3CDS671405..672580+ACR185WYJR082CEAF6
 Chr4CDS136197..138341ADL318CYBR098WMMS4
 Chr4CDS652405..653415+ADL027WYOL048CYAL018C
 Chr4tRNA671190..671262+tRNA-ThrtRNA-Thr
 Chr4tRNA683864..683935tRNA-ArgtRNA-Arg
 Chr4CDS1266092..1267144+ADR318WYLR224W
 Chr4tRNA1280543..1280592,1280741..1280778tRNA-LeutRNA-Leu
 Chr5CDS565382..565807+AEL036WYFL017CYOL024W
 Chr5CDS755657..756337+AER066WYDL069CCBS1
 Chr7CDS104819..104992+AGL322WYBL039W-B

ORF, open reading frame; CDS, coding sequence; tRNA, transfer RNA.

ORF, open reading frame; CDS, coding sequence; ncRNA, noncoding RNA; UTR, untranslated region; tRNA, transfer RNA. ORF, open reading frame; snRNA, small nuclear RNA; CDS, coding sequence; ncRNA, noncoding RNA; tRNA, transfer RNA. ORF, open reading frame; CDS, coding sequence; tRNA, transfer RNA. All but 181,456 sequence reads were used in the genome assembly. More than 90% of these remaining reads are low quality or are apparently bacterial and S. cerevisiae contamination. The only unused sequence reads that assembled into contigs using velvet (Zerbino and Birney 2008) were variants of the canonical 24 bp A. gossypii terminal telomeric sequence, arising from a result of a high rate of sequence variation. The overall 35-fold short read sequence coverage appeared to be very close to randomly distributed across these genomes. There was one gap in both the short read sequence data of strain ATCC10895 and insect isolate 1, described below, and these gaps were at the same location, in a polyC region in the non-coding sequence adjacent to AFL160C, the A. gossypii homolog of GAL4 located on chromosome VI. Efforts to PCR across this region have been unsuccessful, strongly suggesting that this gap results from a technical difficulty. An additional deviation from randomness is found in the Agleu2Δthr4Δ strain sequence, there are 80 short regions of 1 to 83 bases where sequence coverage is less than eightfold coverage. All but two of these are short stretches that are either more than 85% GC or less that 15% GC. All of these regions were checked by visual inspection. Based on synteny and protein similarity, the A. gossypii nuclear genome appears to encode 4776 protein coding genes, 4300 (90%) of which have syntenic homologs in S. cerevisiae, and another 171 (3.6%) of protein coding genes have nonsyntenic homologs, leaving 270 (5.7%) of the protein coding genes in A. gossypii with no homolog in Baker’s yeast (NOHBY). A comparison with the more closely related Kluyveromyces lactis sequence (Dujon ) and other sequenced fungal genomes identifies 146 of the 270 NOHBY genes (54%) as having a syntenic homolog in at least one species, and 24 of the 260 NOHBY genes (9.2%) with at least one nonsyntenic homolog. Thus, currently only 90 protein coding genes identified in A. gossypii, or less than 2% of the predicted proteins, have no apparent homolog in other fungi.

Sequencing A. gossypii insect isolate 1

We also performed short-read sequencing of insect isolate 1. A total of 17,134,963 sequences of 36 bases in length assembled into eight contigs using as template the updated genome of the A. gossypii reference strain. The initial assembly of the genome sequence using only the single read Illumina sequence reads allowed assembly of most of the genome but could not resolve the sequence of small repetitive regions, particularly the subtelomeric sequence. An additional 58,091,226 sequences were generated using the Illumina Mate Pair strategy (www.illumina.com) consisting of 18,674,012 pairs of sequence reads with insert lengths averaging 1.6 kb in length where both ends can be aligned to the genome. The pairing data provided sufficient information to complete the assembly across the repetitive regions of the genome, providing the organizational information that was obtained by BAC and plasmid end pair sequence data for the genomic sequence of strain ATC10895. Both genomes have the same gene order. The genome sequence of insect isolate 1 is 99.9% identical to that of ATCC10895, and thus shares the high level of synteny with the budding yeast genome previously reported (Figure 3). The deposited sequence reveals only 15,337 single-nucleotide polymorphisms (SNPs), 424 single-base insertion/deletions differences (indels), and 952 indels of more than one base relative to ATCC10895.
Figure 3

Synteny between orthologous chromosomal regions of A. gossypii and S. cerevisiae. The yellow and red rectangles represent ORFs 267−294 of the right arm of chromosome 7 of A. gossypii ATCC10895 and insect isolate 1, respectively. The dark gray and light gray rectangles represent S. cerevisiae ORFs from the right arm of chromosome XV (above) and the left arm of chromosome XII (below), which are syntenic to the A. gossypii ORFs. Open triangles show transcription directions and filled arrow heads mark ORFs with intron. Open squares are tRNA genes and closed squares small nuclear RNA genes. The gene order is conserved between the two A. gossypii strains and also the lengths of the ORFs (number of codons) and the sizes of the inter-ORF regions (number of base pairs). The synteny with S. cerevisiae is divided between two chromosomal regions. At the time of the S. cerevisiae genome duplication both regions showed complete synteny to the A. gossypii gene order. During evolution many of the duplicated genes lost one copy seen as ORF-free regions in this synteny map. The synteny map also reveals six cases (five ORFs and one tRNA gene) where both copies of the duplication are retained. To distinguish these duplications from tandem duplications the term twin genes was coined (Dietrich ).

Synteny between orthologous chromosomal regions of A. gossypii and S. cerevisiae. The yellow and red rectangles represent ORFs 267−294 of the right arm of chromosome 7 of A. gossypii ATCC10895 and insect isolate 1, respectively. The dark gray and light gray rectangles represent S. cerevisiae ORFs from the right arm of chromosome XV (above) and the left arm of chromosome XII (below), which are syntenic to the A. gossypii ORFs. Open triangles show transcription directions and filled arrow heads mark ORFs with intron. Open squares are tRNA genes and closed squares small nuclear RNA genes. The gene order is conserved between the two A. gossypii strains and also the lengths of the ORFs (number of codons) and the sizes of the inter-ORF regions (number of base pairs). The synteny with S. cerevisiae is divided between two chromosomal regions. At the time of the S. cerevisiae genome duplication both regions showed complete synteny to the A. gossypii gene order. During evolution many of the duplicated genes lost one copy seen as ORF-free regions in this synteny map. The synteny map also reveals six cases (five ORFs and one tRNA gene) where both copies of the duplication are retained. To distinguish these duplications from tandem duplications the term twin genes was coined (Dietrich ). A total of 63% of the SNPs are purine/purine or pyrimidine/pyrimidine transitions (see Table S1). These polymorphisms are distributed somewhat unevenly across the genome, as seen in Figure 4. One 5-kb region on chromosome IV containing four protein-coding genes, ADL294 to ADL297, is only 92% identical between the two strains. This region, which interestingly encodes a key enzyme for riboflavin synthesis, accounts for nearly 5% of the polymorphisms seen in the nontelomeric regions between these two strains and appears to be an introgression event in which one of these strains has obtained this sequence from a closely related species. This introgression is similar to those reported in S. cerevisiae and S. paradoxus (Liti ). The subtelomeric regions, particularly the chromosome VI right end, contribute nearly half of all SNPs, and more than half of all indel differences seen between these strains. One of the few genes showing multiple polymorphisms between these strains is ABR072C. In contrast to S. cerevisiae where the homolog is a single copy of the cell wall mannoprotein, CWP1, both A. gossypii strains sequenced have four copies of this gene, at a syntenic location. Two of these genes contain internal tandem repeats. In ABR027C, these internal repeats are differentially arranged in the two A. gossypii sequences.
Figure 4

Blocks of sequence conservation of up to 450 genes between ATCC10895 and insect isolate 1. (A) Distribution of sequence identity across the genomes was averaged over 100-kb intervals reveals that some regions are more similar, and some more diverged. On chromosome V the region from approximately 501,000 to 1,270,000, spanning 410 protein coding genes is 99.96% identical between these strains. On chromosome VI the region from approximately 700,000 to 1,478,000, spanning 434 protein coding genes, is 99.80% identical between these strains. The mitochondrial genome labeled “M” is more diverged than the nuclear genome. The telomeric regions of chromosomes V, VI, and VII show more sequence divergence, particularly rearrangements in repetitive elements, than the genome overall and are not shown in this figure. The nuclear genomes are on average 99.9% identical, excluding the telomeric regions. (B) A syntenic region of 5450 bases of significantly lower homology, approximately 92% identity, between A. gossypii strains ATCC10895 and insect isolate 1 is found on chromosome 4 (red bar in A), with boundaries from 179,139 to 184,589 bases in ATCC10895. Percent identity was averaged over windows of 1 kb. Of the 439 SNPs in the introgression region, 139 are in inter-ORF regions, which have an average identity of 92.6%. The remaining 300 SNPs, 186 synonymous and 97 nonsynonymous, fall in the four open reading frames of this region, ADL294C, ADL295W, ADL296C, and ADL297W, which have an average identity of 91.6%. Interestingly, one of the genes, ADL296C, encodes the enzyme GTP cyclohydrolase, the first step in riboflavin biosynthesis. Although the introgressed regions are 92% identical to each other, they are both approximately equally diverged from A. aceri at only 78% identity each, suggesting the source of the introgression is not A. aceri, but another Ashbya species more closely related to A. gossypii.

Blocks of sequence conservation of up to 450 genes between ATCC10895 and insect isolate 1. (A) Distribution of sequence identity across the genomes was averaged over 100-kb intervals reveals that some regions are more similar, and some more diverged. On chromosome V the region from approximately 501,000 to 1,270,000, spanning 410 protein coding genes is 99.96% identical between these strains. On chromosome VI the region from approximately 700,000 to 1,478,000, spanning 434 protein coding genes, is 99.80% identical between these strains. The mitochondrial genome labeled “M” is more diverged than the nuclear genome. The telomeric regions of chromosomes V, VI, and VII show more sequence divergence, particularly rearrangements in repetitive elements, than the genome overall and are not shown in this figure. The nuclear genomes are on average 99.9% identical, excluding the telomeric regions. (B) A syntenic region of 5450 bases of significantly lower homology, approximately 92% identity, between A. gossypii strains ATCC10895 and insect isolate 1 is found on chromosome 4 (red bar in A), with boundaries from 179,139 to 184,589 bases in ATCC10895. Percent identity was averaged over windows of 1 kb. Of the 439 SNPs in the introgression region, 139 are in inter-ORF regions, which have an average identity of 92.6%. The remaining 300 SNPs, 186 synonymous and 97 nonsynonymous, fall in the four open reading frames of this region, ADL294C, ADL295W, ADL296C, and ADL297W, which have an average identity of 91.6%. Interestingly, one of the genes, ADL296C, encodes the enzyme GTP cyclohydrolase, the first step in riboflavin biosynthesis. Although the introgressed regions are 92% identical to each other, they are both approximately equally diverged from A. aceri at only 78% identity each, suggesting the source of the introgression is not A. aceri, but another Ashbya species more closely related to A. gossypii.

MAT gene in novel Ashbya isolates

Interestingly, the genome of the insect isolate carries two additional genes not found in the reference strain ATCC10895. These genes are orthologs of MATα1 (YCR040W) and MATα2 (YCR039C) genes of S. cerevisiae and map at the right subtelomeric region of chromosome VI, which harbors in the reference strain the originally overlooked fourth MATa copy (Figure 5). In both A. gossypii and S. cerevisiae this pair of genes are divergently transcribed. This strain also carries three copies of the MATa genes, one at the presumptive active locus on the right arm of chromosome VI and the other two at subtelomeric regions of chromosomes IV and V like in the reference strain. Five other wild isolates of A. gossypii also encode both MATa and MATα sequences, based on PCR assays (data not shown). The lack of MATα sequences in the genome of ATCC10895 and the 100% sequence identity distal to the MAT loci in the sub-telomeric regions of chromosome IV and chromosome VI suggests that the MATα genes together with the distal portion of chromosome VI were lost by a gene conversion event as indicated in Figure 5A. This event possibly occurred during the lengthy passaging of ATCC10895 in the laboratory.
Figure 5

A. gossypii mating type regions of ATCC10895 and the insect isolate 1 strain. (A) Overall organization of the four mating type loci on chromosomes IV, V, and VI. The three chromosomes are shown in the orientation as annotated. Circles mark the centromere locations; colored squares mark the locations of the mating type loci MAT1 to MAT4. The enlarged sections show the genetic map of these regions in both strains. No differences were found except for the MAT4 locus at the right telomere of chromosome 6 that carries α1/α2 information in the Florida isolate and a1/a2 information in ATCC10895. Interestingly, the order of genes distal to MAT1 and MAT4 is identical in ATCC10895. It is therefore very likely that the MAT4 locus of ATCC10895 originally carried α1/α2 genes, like the Florida isolate, which were replaced with a1/a2 genes by a gene conversion event with the left telomere of chromosome 4 initiated by a break in the homology region around RNH203 proximal to MAT4. Table S2 presents the nomenclature of genes associated with the four MAT loci. (B) Fine structure of the four MAT loci of the Florida isolate and ATCC10895 before the gene conversion at MAT4. All gene names refer to the S. cerevisiae homologs, except for a2, which is a homolog of the K. lactis MATa2 gene (Astrom ). The telomeric loci on chromosomes IV and V are flanked by partial copies of the RCY1 and VPS75 genes, marked in lower case. Vertical bars and dotted lines indicate the junctions of homology at the mating type loci, the centromeric and telomeric ends being marked by “Cen” and “Tel.” Only the nontelomeric MAT1 locus is flanked by intact RCY1 and VPS75 genes, suggesting that this locus on chromosome VI is the active mating type locus, with ATCC10895 and the Florida isolate 1 being MATa. The orientation shown is opposite of that in part A. The chromosome VI telomeric MAT4 locus in the Florida strain carries MATα2 and MATα1 genes inserted into remnants of MATa2 and MATa1 genes, indicated in lower case. The locus is somewhat larger, containing more sequence from the still truncated RCY1 and VPS75 genes. MATα specific sequences are shown in red. The sequence arrangements at the MAT loci were confirmed by DNA hybridizations using synthetic oligonucleotides with homology to the positions indicated by arrow heads (data not shown).

A. gossypii mating type regions of ATCC10895 and the insect isolate 1 strain. (A) Overall organization of the four mating type loci on chromosomes IV, V, and VI. The three chromosomes are shown in the orientation as annotated. Circles mark the centromere locations; colored squares mark the locations of the mating type loci MAT1 to MAT4. The enlarged sections show the genetic map of these regions in both strains. No differences were found except for the MAT4 locus at the right telomere of chromosome 6 that carries α1/α2 information in the Florida isolate and a1/a2 information in ATCC10895. Interestingly, the order of genes distal to MAT1 and MAT4 is identical in ATCC10895. It is therefore very likely that the MAT4 locus of ATCC10895 originally carried α1/α2 genes, like the Florida isolate, which were replaced with a1/a2 genes by a gene conversion event with the left telomere of chromosome 4 initiated by a break in the homology region around RNH203 proximal to MAT4. Table S2 presents the nomenclature of genes associated with the four MAT loci. (B) Fine structure of the four MAT loci of the Florida isolate and ATCC10895 before the gene conversion at MAT4. All gene names refer to the S. cerevisiae homologs, except for a2, which is a homolog of the K. lactis MATa2 gene (Astrom ). The telomeric loci on chromosomes IV and V are flanked by partial copies of the RCY1 and VPS75 genes, marked in lower case. Vertical bars and dotted lines indicate the junctions of homology at the mating type loci, the centromeric and telomeric ends being marked by “Cen” and “Tel.” Only the nontelomeric MAT1 locus is flanked by intact RCY1 and VPS75 genes, suggesting that this locus on chromosome VI is the active mating type locus, with ATCC10895 and the Florida isolate 1 being MATa. The orientation shown is opposite of that in part A. The chromosome VI telomeric MAT4 locus in the Florida strain carries MATα2 and MATα1 genes inserted into remnants of MATa2 and MATa1 genes, indicated in lower case. The locus is somewhat larger, containing more sequence from the still truncated RCY1 and VPS75 genes. MATα specific sequences are shown in red. The sequence arrangements at the MAT loci were confirmed by DNA hybridizations using synthetic oligonucleotides with homology to the positions indicated by arrow heads (data not shown). Unlike S. cerevisiae and other available sequences, the AgMATα2 gene contains an intron, as does the MATα2 genes in three Candida species (Figure 6A), although at a different position. The intron sequences in MATα2 of A. gossypii and A. aceri (see below) are shown in Figure 6B. The sequence of this intron has weak sequence similarity to the intron sequence of AFL149C (Figure 6, B and D). The MATα2 and AFL149C coding regions have no obvious DNA or protein sequence homology at the splice sites (data not shown).
Figure 6

An unusual intron in Ashbya MATα2. (A) A neighbor joining phylogenetic tree of the MATα2 protein. Numbers refer to bootstrap values. Species are A. aceri (Aa), A. gossypii (Ag), H. sinecauda (Hs), S. cerevisiae (Sc), Kluyveromyces (Vanderwaltozyma) polyspora (Kp) (Scannell ), Kluyveromyces delphensis (Kd) (Wong ), Candida glabrata, (Cg) (Dujon ), Zygosaccharomyces rouxi (Zr) (Souciet ), Kluyveromyces lactis (Kl) (Dujon ), Candida thermotolerans (Ct) (Souciet ), Candida albicans (Ca) (Hull and Johnson 1999), and Candida dubliniensis (Cd). (B) Alignment of the introns of A. gossypii gene AFL149C with the homologous introns from H. sinecauda and A. aceri, and the introns from the MATα2 gene of A. gossypii and A. aceri. An intron at this position is found in no other MATα2 genes currently available in GenBank. The 5′ splice site, branch point, and 3′ splice site are marked. Conserved sequence within the intron is marked in bold. (C) A partial alignment of the Ashbya and H. sinecauda MATα2 proteins is shown with the position of the intron marked. The intron is outside the conserved homeobox domain. The alignment suggests no sequences have been gained or lost at the site of this intron. (D) A phylogenetic tree of the intron sequences of MATα2 and AFL149C.

An unusual intron in Ashbya MATα2. (A) A neighbor joining phylogenetic tree of the MATα2 protein. Numbers refer to bootstrap values. Species are A. aceri (Aa), A. gossypii (Ag), H. sinecauda (Hs), S. cerevisiae (Sc), Kluyveromyces (Vanderwaltozyma) polyspora (Kp) (Scannell ), Kluyveromyces delphensis (Kd) (Wong ), Candida glabrata, (Cg) (Dujon ), Zygosaccharomyces rouxi (Zr) (Souciet ), Kluyveromyces lactis (Kl) (Dujon ), Candida thermotolerans (Ct) (Souciet ), Candida albicans (Ca) (Hull and Johnson 1999), and Candida dubliniensis (Cd). (B) Alignment of the introns of A. gossypii gene AFL149C with the homologous introns from H. sinecauda and A. aceri, and the introns from the MATα2 gene of A. gossypii and A. aceri. An intron at this position is found in no other MATα2 genes currently available in GenBank. The 5′ splice site, branch point, and 3′ splice site are marked. Conserved sequence within the intron is marked in bold. (C) A partial alignment of the Ashbya and H. sinecauda MATα2 proteins is shown with the position of the intron marked. The intron is outside the conserved homeobox domain. The alignment suggests no sequences have been gained or lost at the site of this intron. (D) A phylogenetic tree of the intron sequences of MATα2 and AFL149C.

Introns in A. gossypii

A total of 263 protein-coding genes in both A. gossypii genomes contain a single intron, seven have two introns, and 49 tRNA genes contain an intron. An additional 15 introns are located in the 5′ UTR of protein coding genes. The intron splice consensus sequence for protein coding genes is very similar to that of S. cerevisiae as shown in Figure S3, although the average length of introns in A. gossypii (107 bases) is less than half of the average length of introns in S. cerevisiae (244 bases). Only one gene, ADR221C, contains an intron that in both Ashbya species has two of the preferred branch point sequences and two 3′ splice sites. Both of these possible 3′ splice sites are in-frame, although there is a stop codon between them, so that one of the possible splices will result in an mRNA with an in-frame premature stop codon, whereas the splicing of the longer form of the intron will bypass the stop codon (Figure 7). An unusually large intron is found at the same position in the coding region and in the same reading frame in Candida albicans (420nt), Kluyveromyces thermotolerens (978nt), Zygosaccharomyces rouxi (752 nt), K. lactis (342), and K. polysporus (1 gene, 660nt). In each of these cases the intron appears to have only a single 3′ splice site. In S. cerevisiae and Candida glabrata the duplicate copies resulting from the genome duplication have been retained, though the intron has been lost from both copies. In S. cerevisiae, the two orthologs are SKI7 and HBS1. The SKI7 gene has been shown to play a role in degrading mRNA containing premature stop codons (van Hoof ) and the structure of the intron in the A. gossypii homolog of SKI7 suggests a possible novel mechanism of feedback regulation in this gene.
Figure 7

Unique case of an intron with two 3′ splice sites in Ashbya. (A) The intron in A. gossypii ADR221C is shown to scale with the two branch points and two 3′ splice sites. (B) The sequence of the A. gossypii ADR221C intron, total size 105 nucleotides for the longer form. The 5′ Splice site, two branch points, and two 3′ splice sites are shown in upper case, with the translation below. (C) A. aceri ADR221C intron, with a total size 110 nucleotides for the longer form.

Unique case of an intron with two 3′ splice sites in Ashbya. (A) The intron in A. gossypii ADR221C is shown to scale with the two branch points and two 3′ splice sites. (B) The sequence of the A. gossypii ADR221C intron, total size 105 nucleotides for the longer form. The 5′ Splice site, two branch points, and two 3′ splice sites are shown in upper case, with the translation below. (C) A. aceri ADR221C intron, with a total size 110 nucleotides for the longer form.

Genome sequence of Ashbya aceri isolated from a boxelder bug

We have carried out short read genomic sequencing of the A. aceri strain insect isolate 38 and assembled its genome from 36 million single 36 base sequence reads and an additional 30 million mate pairs of 58 base long Illumina data. Problems arose at GC rich sequences, at break points of translocations, at telomeres, and particularly at the homologs of A. gossypii AFL095W and AFL092C. These genes are a tandem inverted duplicate pair homologs of S. cerevisiae FLO5 with nearly 8 kb of internally repetitive sequence between them in both Ashbya species. Although multiple genes containing internal inverted repeats are found in S. cerevisiae (Verstrepen ), none are in this convergent tandem orientation that potentially allows for diversity to be generated by inversions between repetitive sequences. Most of these problems could be solved by visual inspections. The DNA sequence of A. aceri is 90% identical to that of A. gossypii strain ATCC10895 and contains eight reciprocal translocations not including those at telomeres (Table 4). The genome has three MATa loci and one MATalpha locus at positions identical to MAT loci of the A. gossypii insect isolate 1 (Figure 5). Protein identity ranges from 40 to 100% with an average of 89% identity compared with A. gossypii. The lowest identity was found for a protein encoded by AFR028W, a gene present at syntenic positions in many yeasts, but with unknown function in S. cerevisiae. Other proteins with low identity are encoded by NOHBYs, genes with no homolog in Baker’s yeast, but present in Ashbya and in some cases other related fungi. The gene order is highly conserved between these species, other than at the mentioned translocation breakpoints.
Table 4

Locations of translocations between A. aceri and A. gossypii

Chromosome in A. aceriChromosome in A. gossypiiGene to Left of Break PointGene to Right of Break PointChromosome in A. gossypiiTranslocation Type
AaChr7AgChr7AGR242CADR160WAgChr4Reciprocal
AaChr4AgChr4ADR159CAGR243WAgChr7A.g. Ancestral
AaChr3AgChr6AFR280WACL074WAgChr3Reciprocal
AaChr6AgChr6AFR279CACL075CAgChr3A.a. Ancestral
AaChr2AgChr4ADR357CAGR346CAgChr7Reciprocal
AaChr4AgChr7AGR345CADR358WAgChr4A.g. Ancestral
AaChr1AgChr1AAR190WAEL287CAgChr5Reciprocal
AaChr5AgChr1AAR191CAEL286CAgChr5A.g. Ancestral
AaChr7AgChr4ADR165CAER303WAgChr5Adjacent
AaChr5AgChr5AER302CADR166WAgChr4Reciprocal
AaChr7AgChr7AGR242CADR160WAgChr4Translocations
AaChr4AgChr4ADR159CAGR243WAgChr7Unclear ancestry
AaChr2AgChr2ABR182WAFR451W-AAgChr6Adjacent
AaChr3AgChr2ABR183WAFR451CAgChr6Reciprocal
AaChr2AgChr6AFR466CABR186WAgChr2Translocations
AaChr3AgChr6AFR467WABR184CAgChr2Unclear ancestry
AaChr6AgChr4ADL268CAFL185WAgChr6Adjacent
AaChr7AgChr4ADL267WAFL186WAgChr6Reciprocal
AaChr4AgChr5AER443WADL265W-AAgChr4Translocations
AaChr7AgChr5AER442WADL265WAgChr4A.g. Ancestral
AaChr7AgChr3ACL203CAGL351WAgChr7Telomeric
AaChr6AgChr7AGL352WADL395CAgChr4Gene exchange
AaChr3AgChr4ADL397CAFR747WAgChr6Unclear ancestry
AaChr2AgChr2ABR208WADR329WAgChr4Three way
AaChr3AgChr3ACR239CABR209WAgChr2Translocation
AaChr5AgChr4ADR328WACR240WAgChr3A.a. Ancestral

A. aceri chromosomes are numbered and oriented based on the conserved centromeric regions. No translocations are present at the centromeres. The first column lists the A. aceri chromosome. A. gossypii protein coding genes listed are adjacent to the translocation. Four of the translocations are reciprocal translocations and the other five are either a pair of translocations at near-by genes, or are three-way transloctions. In most cases it is possible to identify if the A. aceri or A. gossypii gene order is ancestral by comparison with related species E. cymbalariae (Wendland and Walther 2011) and K. lactis (Dujon ).

A. aceri chromosomes are numbered and oriented based on the conserved centromeric regions. No translocations are present at the centromeres. The first column lists the A. aceri chromosome. A. gossypii protein coding genes listed are adjacent to the translocation. Four of the translocations are reciprocal translocations and the other five are either a pair of translocations at near-by genes, or are three-way transloctions. In most cases it is possible to identify if the A. aceri or A. gossypii gene order is ancestral by comparison with related species E. cymbalariae (Wendland and Walther 2011) and K. lactis (Dujon ). Only a few genes differences were noted between the A. aceri and the A. gossypii genomes. For example, A. aceri lacks two tandem duplications, one triplication and one quadruplication found in both sequenced A. gossypii genomes (see Table 5). A. aceri carries only one syntenic homolog of the S. cerevisiae CDC123 gene involved in nutritional control of the cell cycle and only one syntenic homolog of the S. cerevisiae RAI1 gene involved in decapping of mRNAs (Bieganowski ; Jiao ).
Table 5

Tandem duplications of protein coding genes in A. gossypii strains

A. gossypii GeneIdentityaS. cerevisiae Homolog 1S. cerevisia Homolog 2bA. gossypiicA. aceric
AAL179W47%YJL079C(PRY1)YKR013W(PRY2)22
AAL178W
ABL189W38%YDL237W22
ABL188W
ABR025C26–46%YKL096W(CWP1)44
ABR026C
ABR027C
ABR028C
ACR272C58%YKL096W(CWP1)22
ACR273W
AFL095W56%YHR211W(FLO5)22
AFL092C
ABR182W73%YPR165W(RHO1)22
ABR183W
ABR246W65–84%YIR035CYIR036C40
ABR247W
ABR248W
ABR249W
ACL202W81–94%YMR238W(DFG5)31
ACL201W
ACL200W
ACR098C45%YPL129W(TAF14)YOR213C(SAS5)22
ACR099C
ACR143W36%YPL154C(PEP4)22
ACR144W
ADL156C66%YOL119C(MCH4)22
ADL155C
ADR081C82%YLR215C(CDC123)21
ADR082C
ADR336C60%YNR055C(HOL1)22
ADR337C
ADR403C25–27%YAL051W(OAF1)YOR363C(PIP2)33
ADR404C
ADR405C
AER452C74–80%YJR107W33
AER453C
AER454C
AFR262C87%YGL246C(RAI1)21
AFR263C
AGL352W59%YMR307W(GAS1)22
AGL351W
AGL326W29%YJL172W(CPS1)22
AGL325W
AGR038C72%YDR046C(BAP3)YBR068C(BAP2)22
AGR039C
AGR188W<30%YDR227W(SIR4)22
AGR189W
AGR405C83%YCL057W(PRD1)22
AGR406C

Identity between tandem gene pair in A. gossypii.

Tandem copies in S. cerevisiae, or gene duplicate pairs.

Number of tandem genes at respective location; bold indicates differences between A. gossypii and A. asceri.

Identity between tandem gene pair in A. gossypii. Tandem copies in S. cerevisiae, or gene duplicate pairs. Number of tandem genes at respective location; bold indicates differences between A. gossypii and A. asceri. These two genes are tandemly duplicated in A. gossypii. Furthermore, one syntenic and one telomeric copy of the S. cerevisiae DFG5 gene, encoding a mannosidase essential for cell wall biosynthesis (Kitagaki ), are present in A. aceri. Interestingly, in A. gossypii the telomeric copy has amplified to a tandem triplication. Finally, A. aceri and A. gossypii each carry one syntenic homolog of the S. cerevisiae tandem gene duplication YIR035C/036C encoding putative benzyl reductases which could be involved in detoxification reactions (Maruyama ). A. gossypii additionally carries a tandem quadruplication of this putative reductase gene, absent in A. aceri, near the right telomere of chromosome 2. The three sequenced Ashbya genomes carry a gene, (AGL178W), with homology to the reverse transcriptase of the S. cerevisiae TY3 elements, though these species lack transposable elements. There is no evidence of introgression between A. aceri and A. gossypii, with the largest region of >95% sequence identity being the rDNA. We are confident that this organism represents a new species of the genus Ashbya and here give the following description: Ashbya aceri Nov. sp. ; Ashbya Guilliermond Isolated from Boisea trivittata found on Acer negundo. Hyphal mat color white to cream. Hyphae fail to invade agar. Some aerial mycelia. Hyphae, with lateral and tip branching. Yeast cells not observed. Asci arise from vegetative mycelium. Ascospores needle-shaped, typically 8 per ascus. Etymology: From genus Acer, maple and boxelder trees, M. Latin aceri, from Acer. The genus Ashbya was defined by Alexandre Guilliermond (Guilliermond 1928).

Discussion

It is yet to be shown if the relationship between the “fungi of stigmatomycosis” and the insects in which they are found represents a symbiosis or is a commensal relationship. It is possible that these fungi provide nutrients that allow these insects to live on the plants on which they are found, in a manner analogous to that seen in insects that harbor symbiotic bacteria, such as Buchnera (Lai and Baumann 1992). This finding is consistent with the observation that these fungi typically are found in the mouth parts of these insects (Frazer 1944; Foster and Daugherty 1969). The overproduction of riboflavin in Ashbya strains found in insects living on milkweed and oleander plants that produce toxic alkaloids (Everist 1981; Lewis and Elvin-Lewis 1986). The lack of such overproduction in strains isolated from insects found on the non-toxic boxelder and maple trees may be explained by the hypothesis that overproduction of riboflavin allows the insects to live on alkaloid-producing toxic plants using a mechanism of detoxification of alkaloids using flavin cofactor (Miranda ; Cashman ; Sehlmeyer ; Langel and Ober 2011). Although there has so far been only one member of the genus Ashbya, it is quite possible that this is largely due to a lack of sampling. The known species of the Nematosporaceae are all associated with the plant feeding bugs of the suborder Heteroptera, including the fungi Holleya sinecauda and N. coryli that have been associated with the false chinch bug, Nysius ericae (Burgess ; Burgess and Weegar 1986) and green stink bugs, Acrosternum hilare (Clarke and Wilde 1970), respectively (Figure 1). There are conservatively estimated to be 35,000 species of Heteroptera (Slater 1982), though some such as the assassin bug (family Reduviidae) feed on other insects, not on plants, and when tested did not appear to carry a specific fungus (data not shown). Comparative analysis of completely sequenced genomes can be used to reveal the frequency and distribution of SNPs, and the conservation of gene arrangements, e.g., presence of introns or overlapping transcripts, functional gains by tandem duplications or modifications of pathways by specific gene losses. The distribution of polymorphisms across the two A. gossypii genomes as shown in Figure 4 suggests that there has been reassortment of genetic material in the wild so that some portions of these two genomes are more closely related than other parts. Although this could result either from a sexual cycle or a parasexual cycle, the presence of both the MATa and MATalpha loci in wild isolates of Ashbya is similar to what is found in other Hemiascomycetes, and suggests that A. gossypii likely has a sexual cycle. More than 200 of the 270 intron containing protein coding genes in A. gossypii have an intron containing homolog in S. cerevisiae, with intron loss in the S. cerevisiae lineage being the most likely explanation for the remaining cases. It has long been speculated that introns in S. cerevisiae may have been lost by a mechanism involving reverse transcription and gene conversion (Fink 1987), and an example in Cryptococcus neoformans where this appears to have occurred has recently been described (Stajich and Dietrich 2006). The intron found in the MATα2 gene of A. gossypii insect isolate1 and A. aceri appears to be a case of intron loss in multiple lineages, though the possibility of intron gain cannot be ruled out (Figure 6D). After resequencing and reannotating of strain ATCC10895, there are no cases of protein coding ORFs currently annotated that overlap at the 5′ end except for RNH203 adjacent to the MAT loci (Figure 5). The original annotation reported an overlap at the 5′ end for 15 pairs of ORFs. In 8 cases the 5′ ends of transcripts could be determined leading to reannotations of the start codon downstream of the originally annotated start codons (data not shown). The GenBank files of these ORFs were updated, and the ORF pairs no longer overlapped. The remaining cases were validated by multiple alignments with sequences from other available genomes and it is clear that these were also cases with an incorrectly annotated start codons. The homology began at the second or even third or fourth ATG. There are, however, 26 pairs of convergently transcribed ORFs that overlap at their 3′ ends. These are not hypothetical genes, but genes conserved at least among the Hemiascomycetes. Examination of the sequence in these regions of overlap, and homology with orthologs of other species strongly suggests that these overlaps are real. Some had already been described before the release of the complete A. gossypii sequence (Brachat ). The overlaps are typically quite short, less than 10 nucleotides. The longest overlap in A. gossypii is between AEL311W and AEL310C, overlapping by 172 nucleotides. In A. aceri these two ORFs overlap by 166 nucleotides. The tandemly duplicated genes in each Ashbya species are shown in Table 5. Of the 21 sets of duplicated genes in A. gossypii, 17 are also tandemly duplicated in A. aceri suggesting that these are clade specific and not strain or species specific duplications. Interestingly, the unique functional divergence of the tandemly duplicated A. gossypii RHO1 genes (ABR182W and ABR183W) is conserved in A. aceri. In these fungi the GTPases Rho1a and Rho1b are functionally diverged, with a change of the usually conserved tyrosine to histidine in the switch I region of Rho1a, introducing a novel specificity for a GTPase activating protein and also influencing the localization of Rho1a (Koehli ). Another interesting case is the duplication of the SIR4 gene (AGR188W and AGR189W) encoding an important protein for gene silencing. In S. cerevisiae, a heterodimer encoded by the SIR3 and SIR4 gene plays a key role in gene silencing (Rusche ), but the two Ashbya species analyzed here lacks a specific SIR3 gene, which in the S. cerevisiae lineage evolved from an ORC1 duplication. Another unique feature is the conservation of a tandem triplication of a lipase gene (AER452C to AER454C) and a quadruplication of CWP1, a cell wall gene, (ABR025C to ABR028C) in both Ashbya species. For each of these genes, only a single syntenic copy is present in the S. cerevisiae genome. The genome of the related fungus E. cymbalariae carries 8 of the 21 tandem gene duplications found in A. gossypii including RHO1 and SIR4 but lacks among others the mentioned lipase gene triplication and the CWP1 quadruplication. It also lacks nontandemly repeated Ashbya genes (Table S3), for example the five MNT3 homologs encoding mannosyl transfereases and other telomere located gene amplifications. Furthermore, compared with Ashbya genomes the genome of E. cymbalariae has a much lower GC-content (40% vs. 52%), carries one additional chromosome, shows over 200 genome rearrangements, and the average protein identity is only 60% compared to A. gossypii, which is similar to the average protein identity between the distantly related yeasts S. cerevisiae and K. lactis (Wendland and Walther 2011). A group of gene losses was recently associated with the ability of A. gossypii hyphae to substantially accelerate their elongation speed (Kaufmann and Philippsen 2009). These genes are also absent in A. aceri. The orthologous genes in S. cerevisiae encode an endochitinase (CTS1), an endoglucanase (EGT2) and a cell wall protein (SCW11) important for cell separation. The absence of these genes is likely essential for acceleration of hyphal growth, as cell separation does not occur at the occasionally forming septa in Ashbya. The multinucleated apical hyphal compartments increase in length over time concomitantly increasing the cytoplasmic space for assembling secretory vesicles. The higher the rate of secretory vesicle production and transport to the hyphal tips, the faster the tips grow, a principle apparently conserved in Ashbya fungi. Ashbya genomics can contribute significantly to our understanding of the ecological importance of this genus. First, insects free of fungi can be colonized at will with different Ashbya species or, most importantly, with designed mutants allowing examination of the role of genes when the organism is grown in its native environment. For example, large milkweed bugs grown in containers at the Carolina Biological Supply Company (www.carolina.com) lack A. gossypii, though these insects could take up and maintain A. gossypii when fed on sunflower seeds that had been injected with this fungus (F. D. unpublished data). And second, unlike S. cerevisiae that has been isolated from numerous environments, A. gossypii specifically, and the fungi of stigmatomycosis in general, have only been isolated from the mouthparts of specific insects from the suborder Heteroptera. Not only does the large number of Heteroptera species provide the opportunity to isolate additional strains and species of these fungi for comparative analysis, but it also provides the opportunity to investigate how the specific environment in which these fungi live has shaped their genomes.
  63 in total

1.  LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA.

Authors:  Michael Brudno; Chuong B Do; Gregory M Cooper; Michael F Kim; Eugene Davydov; Eric D Green; Arend Sidow; Serafim Batzoglou
Journal:  Genome Res       Date:  2003-03-12       Impact factor: 9.043

2.  The function of two closely related Rho proteins is determined by an atypical switch I region.

Authors:  Michael Köhli; Sabrina Buck; Hans-Peter Schmitz
Journal:  J Cell Sci       Date:  2008-03-11       Impact factor: 5.285

3.  Mapping short DNA sequencing reads and calling variants using mapping quality scores.

Authors:  Heng Li; Jue Ruan; Richard Durbin
Journal:  Genome Res       Date:  2008-08-19       Impact factor: 9.043

4.  Pseudogenes in yeast?

Authors:  G R Fink
Journal:  Cell       Date:  1987-04-10       Impact factor: 41.582

5.  The Ashbya gossypii fimbrin SAC6 is required for fast polarized hyphal tip growth and endocytosis.

Authors:  Sigyn Jorde; Andrea Walther; Jürgen Wendland
Journal:  Microbiol Res       Date:  2011-01-14       Impact factor: 5.415

Review 6.  Riboflavin production by Ashbya gossypii.

Authors:  Tatsuya Kato; Enoch Y Park
Journal:  Biotechnol Lett       Date:  2011-12-21       Impact factor: 2.461

7.  From function to shape: a novel role of a formin in morphogenesis of the fungus Ashbya gossypii.

Authors:  Hans-Peter Schmitz; Andreas Kaufmann; Michael Köhli; Pierre Philippe Laissue; Peter Philippsen
Journal:  Mol Biol Cell       Date:  2005-10-19       Impact factor: 4.138

8.  Identification of a quality-control mechanism for mRNA 5'-end capping.

Authors:  Xinfu Jiao; Song Xiang; Chanseok Oh; Charles E Martin; Liang Tong; Megerditch Kiledjian
Journal:  Nature       Date:  2010-08-29       Impact factor: 49.962

9.  Homologous recombination as the main mechanism for DNA integration and cause of rearrangements in the filamentous ascomycete Ashbya gossypii.

Authors:  S Steiner; J Wendland; M C Wright; P Philippsen
Journal:  Genetics       Date:  1995-07       Impact factor: 4.562

10.  Of bars and rings: Hof1-dependent cytokinesis in multiseptated hyphae of Ashbya gossypii.

Authors:  Andreas Kaufmann; Peter Philippsen
Journal:  Mol Cell Biol       Date:  2008-11-24       Impact factor: 4.272

View more
  13 in total

Review 1.  New biotechnological applications for Ashbya gossypii: Challenges and perspectives.

Authors:  Tatiana Q Aguiar; Rui Silva; Lucília Domingues
Journal:  Bioengineered       Date:  2016-10-28       Impact factor: 3.269

Review 2.  Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina).

Authors:  Bernard A Dujon; Edward J Louis
Journal:  Genetics       Date:  2017-06       Impact factor: 4.562

Review 3.  Genomics and the making of yeast biodiversity.

Authors:  Chris Todd Hittinger; Antonis Rokas; Feng-Yan Bai; Teun Boekhout; Paula Gonçalves; Thomas W Jeffries; Jacek Kominek; Marc-André Lachance; Diego Libkind; Carlos A Rosa; José Paulo Sampaio; Cletus P Kurtzman
Journal:  Curr Opin Genet Dev       Date:  2015-11-30       Impact factor: 5.578

Review 4.  Unisexual reproduction.

Authors:  Kevin C Roach; Marianna Feretzaki; Sheng Sun; Joseph Heitman
Journal:  Adv Genet       Date:  2014       Impact factor: 3.880

5.  Genome-wide metabolic re-annotation of Ashbya gossypii: new insights into its metabolism through a comparative analysis with Saccharomyces cerevisiae and Kluyveromyces lactis.

Authors:  Daniel Gomes; Tatiana Q Aguiar; Oscar Dias; Eugénio C Ferreira; Lucília Domingues; Isabel Rocha
Journal:  BMC Genomics       Date:  2014-09-24       Impact factor: 3.969

Review 6.  Fungal model systems and the elucidation of pathogenicity determinants.

Authors:  Elena Perez-Nadales; Maria Filomena Almeida Nogueira; Clara Baldin; Sónia Castanheira; Mennat El Ghalid; Elisabeth Grund; Klaus Lengeler; Elisabetta Marchegiani; Pankaj Vinod Mehrotra; Marino Moretti; Vikram Naik; Miriam Oses-Ruiz; Therese Oskarsson; Katja Schäfer; Lisa Wasserstrom; Axel A Brakhage; Neil A R Gow; Regine Kahmann; Marc-Henri Lebrun; José Perez-Martin; Antonio Di Pietro; Nicholas J Talbot; Valerie Toquin; Andrea Walther; Jürgen Wendland
Journal:  Fungal Genet Biol       Date:  2014-07-07       Impact factor: 3.495

7.  Differential gene retention as an evolutionary mechanism to generate biodiversity and adaptation in yeasts.

Authors:  Guillaume Morel; Lieven Sterck; Dominique Swennen; Marina Marcet-Houben; Djamila Onesime; Anthony Levasseur; Noémie Jacques; Sandrine Mallet; Arnaux Couloux; Karine Labadie; Joëlle Amselem; Jean-Marie Beckerich; Bernard Henrissat; Yves Van de Peer; Patrick Wincker; Jean-Luc Souciet; Toni Gabaldón; Colin R Tinsley; Serge Casaregola
Journal:  Sci Rep       Date:  2015-06-25       Impact factor: 4.379

8.  Non-model model organisms.

Authors:  James J Russell; Julie A Theriot; Pranidhi Sood; Wallace F Marshall; Laura F Landweber; Lillian Fritz-Laylin; Jessica K Polka; Snezhana Oliferenko; Therese Gerbich; Amy Gladfelter; James Umen; Magdalena Bezanilla; Madeline A Lancaster; Shuonan He; Matthew C Gibson; Bob Goldstein; Elly M Tanaka; Chi-Kuo Hu; Anne Brunet
Journal:  BMC Biol       Date:  2017-06-29       Impact factor: 7.431

9.  Transposable Elements Contribute to Genome Dynamics and Gene Expression Variation in the Fungal Plant Pathogen Verticillium dahliae.

Authors:  David E Torres; Bart P H J Thomma; Michael F Seidl
Journal:  Genome Biol Evol       Date:  2021-07-06       Impact factor: 3.416

10.  Chromosome number reduction in Eremothecium coryli by two telomere-to-telomere fusions.

Authors:  Jürgen Wendland; Andrea Walther
Journal:  Genome Biol Evol       Date:  2014-05-06       Impact factor: 3.416

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.